ID: 1135573001

View in Genome Browser
Species Human (GRCh38)
Location 16:23563625-23563647
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135573001_1135573005 -7 Left 1135573001 16:23563625-23563647 CCTGGGTACCCGTGCTCAAGGAC No data
Right 1135573005 16:23563641-23563663 CAAGGACCTTTGGCTGTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135573001 Original CRISPR GTCCTTGAGCACGGGTACCC AGG (reversed) Intronic
No off target data available for this crispr