ID: 1135573503

View in Genome Browser
Species Human (GRCh38)
Location 16:23567268-23567290
Sequence AACTGATGGAAGGTGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 219}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135573503 Original CRISPR AACTGATGGAAGGTGTGTGT GGG (reversed) Intronic
900869460 1:5291659-5291681 AGCTGTTGAAAGATGTGTGTAGG - Intergenic
902435057 1:16393143-16393165 AAGTGATGAGAGGTGGGTGTGGG + Intronic
903640130 1:24853786-24853808 AACAAATGGAATGTTTGTGTTGG - Intergenic
904923388 1:34026715-34026737 AACAGTTGGGAGTTGTGTGTGGG + Intronic
905850347 1:41269479-41269501 AAGTGATGGAGGGTGGGAGTGGG - Intergenic
905884864 1:41486171-41486193 AACTGATGGAGGGTGAGAGCAGG + Intergenic
906683407 1:47746804-47746826 AAGAGATGGGAGGTGGGTGTAGG - Intergenic
907626832 1:56038797-56038819 CGCTGATGGAGGGTGTCTGTGGG - Intergenic
907629840 1:56069473-56069495 ATTTGATGGAGGGTGAGTGTGGG + Intergenic
908559064 1:65286633-65286655 AAAAGATGGTAGGAGTGTGTTGG + Intronic
914824213 1:151129727-151129749 AACTGATGGAATCTGTCTGCTGG + Intergenic
915206352 1:154273099-154273121 AACTGGGGGAAGGTGTATGAAGG + Intronic
915389020 1:155524120-155524142 AAATGATAGTGGGTGTGTGTTGG - Intronic
915594804 1:156890401-156890423 AAGGGATGAGAGGTGTGTGTGGG - Intergenic
915737996 1:158096664-158096686 GTCACATGGAAGGTGTGTGTTGG - Intronic
916513758 1:165496659-165496681 AACAGCTGGAAAGTGGGTGTGGG - Intergenic
919501994 1:198348771-198348793 AACTGATGGTCTGTGAGTGTTGG - Intergenic
921168590 1:212525803-212525825 AAAAGAAGGAATGTGTGTGTAGG + Intergenic
922864278 1:228846047-228846069 CACTTATGGAAGGTGTGATTTGG + Intergenic
1067065627 10:43102545-43102567 AACTGGTGGAAGGTGCCTGGGGG - Exonic
1067296311 10:44976989-44977011 AACTGGTGGTAGGGGTGTGAGGG - Exonic
1068130916 10:52894183-52894205 AAGTACTGGAAGGTGTGAGTAGG + Intergenic
1069881199 10:71594773-71594795 AACTGATGCAGAGTGTGTGGGGG - Intronic
1071242182 10:83719536-83719558 AACTATTGTAAGTTGTGTGTTGG - Intergenic
1072918434 10:99555239-99555261 AACAGATTGATTGTGTGTGTTGG + Intergenic
1073080385 10:100856244-100856266 AACTGATAGAAGGGCTGTCTTGG - Intergenic
1074453534 10:113578364-113578386 AACTGATGGAAGGTGGGCTAGGG - Intronic
1074755725 10:116622523-116622545 AAGTGTTGGAAGGTGTGAGTTGG - Intronic
1075034023 10:119047444-119047466 AAAAAAGGGAAGGTGTGTGTGGG + Intronic
1075067076 10:119296290-119296312 AACTGATGGAGGGTGTCTGCTGG - Intronic
1075692540 10:124408009-124408031 CACTGGTGGAGGGTTTGTGTTGG - Intronic
1076628540 10:131838301-131838323 AATTGATTGACCGTGTGTGTAGG - Intergenic
1076807142 10:132864532-132864554 CACTGAGGGCAGGTGTGTGCAGG - Intronic
1076807153 10:132864591-132864613 CACTGAGGGCAGGTGTGTGCAGG - Intronic
1076807179 10:132864709-132864731 CACTGAGGGCAGGTGTGTGCAGG - Intronic
1076807215 10:132864886-132864908 CACTGAGGGCAGGTGTGTGCAGG - Intronic
1076807220 10:132864916-132864938 CACTGAGGGCAGGTGTGTGCAGG - Intronic
1076807229 10:132864976-132864998 CACTGAGGGCAGGTGTGTGCAGG - Intronic
1076901180 10:133338675-133338697 GACTGGTGTCAGGTGTGTGTTGG - Intronic
1077494406 11:2879636-2879658 AATTGCTGGATGGTGTGTGGCGG - Intergenic
1077661615 11:4073706-4073728 AACTGAGGGAATGTGTGTGACGG + Intronic
1077993027 11:7428984-7429006 AATTAATGGAGGGTCTGTGTTGG + Intronic
1080312930 11:30915094-30915116 GAAAGAGGGAAGGTGTGTGTTGG + Intronic
1080765875 11:35296313-35296335 AACTCTTGGAATGTGTGTTTAGG - Intronic
1085121171 11:73968539-73968561 GACTGATGGCAGGTGGTTGTGGG - Intronic
1085621857 11:78043789-78043811 AACTGATGGCAGCTTTGTCTTGG + Intronic
1086932889 11:92712250-92712272 AACTGATGGGGGATGTGTGGCGG - Intronic
1087899131 11:103621019-103621041 AAGTGATGGCAGTTGTGTTTGGG - Intergenic
1089063182 11:115642848-115642870 ACCTCATGGAAGCTGTGTGGTGG + Intergenic
1089794605 11:120970232-120970254 AGCTGACGGAAGGCGTGTGGTGG + Intronic
1091085713 11:132719751-132719773 AACTCATAGAAGCTGTGTTTAGG - Intronic
1091960585 12:4690863-4690885 ACCTGCTGAAATGTGTGTGTTGG + Exonic
1092491271 12:8947924-8947946 AACTTAGGGAAGGTGGGAGTTGG - Intronic
1094698354 12:32843587-32843609 ATCTAATGGAAGCTCTGTGTAGG - Intronic
1095370389 12:41460009-41460031 ACCTGATGGAGAGTATGTGTGGG + Intronic
1099062603 12:77930793-77930815 AACTGTTGGAAAGTTTGTCTAGG + Intronic
1099186997 12:79526049-79526071 AACTGAGGGAAGGTATGAGAGGG + Intergenic
1101647918 12:106648269-106648291 AGGTGATGGATCGTGTGTGTGGG + Intronic
1102033903 12:109760178-109760200 AAGTGGTGAAATGTGTGTGTGGG - Intronic
1104348251 12:128021940-128021962 AAGTGATTGAAGCTGTGTTTCGG + Intergenic
1105728108 13:23185848-23185870 AACTGAAGGAAGGAGTGTCTTGG + Intronic
1109163758 13:59008366-59008388 AACTGATAGAAGGTTTTTATGGG + Intergenic
1110182845 13:72637754-72637776 AACTGGTGGGAGGTGGGTGATGG + Intergenic
1111698027 13:91649994-91650016 AACTGAAGGAAGTTGTGTAGAGG - Intronic
1111830726 13:93325747-93325769 GAGTGATGGAGGGTGTGGGTGGG + Intronic
1112676567 13:101708920-101708942 AACTGGTGGAAGATCTGTTTGGG - Intronic
1112975158 13:105308695-105308717 AATTGCTGGAAGCTGGGTGTGGG + Intergenic
1114115453 14:19617926-19617948 ACATGACTGAAGGTGTGTGTGGG + Intergenic
1118598356 14:67453424-67453446 GGCTGATGGGAGGTGTGTGCAGG - Intronic
1120195659 14:81479556-81479578 AAATGATGGAAGGTCTGTCCTGG - Intronic
1121329994 14:93043859-93043881 AACTGTAGGAAGATGTGTATTGG - Intronic
1122145853 14:99688492-99688514 AACAGCTGGAAGGTGTGCGTGGG - Intronic
1122977854 14:105178351-105178373 AACTGGGGGTAGGGGTGTGTGGG - Intronic
1123896324 15:24833821-24833843 AACAGACGGTAGGTGTGTCTGGG + Intronic
1124134184 15:27019622-27019644 AACTGAAGGAAGGTTGGTGATGG + Intronic
1126901074 15:53314775-53314797 AACTGATGGAAGGGCTCTCTAGG + Intergenic
1129034122 15:72639534-72639556 TACTGCTGGGATGTGTGTGTTGG - Intergenic
1129099267 15:73243976-73243998 AATTGATGGAAGGTGGATATTGG - Intronic
1129215760 15:74097682-74097704 TACTGCTGGGATGTGTGTGTTGG + Intergenic
1129732895 15:77942010-77942032 TACTGCTGGGATGTGTGTGTTGG + Intergenic
1130381010 15:83372438-83372460 AGCTGAGGGAGGGTGAGTGTCGG - Intergenic
1131105850 15:89733904-89733926 AACTGATGGAAGTTTACTGTGGG - Intronic
1132486138 16:192393-192415 AGCTGTTGGAGGCTGTGTGTGGG - Intronic
1133804164 16:9110739-9110761 AACTGATGGATGGTATGGCTGGG + Intronic
1135573503 16:23567268-23567290 AACTGATGGAAGGTGTGTGTGGG - Intronic
1137931735 16:52594865-52594887 TACTGGTGGAAGCTGTGAGTGGG + Intergenic
1139128234 16:64108097-64108119 AACAGTTTGGAGGTGTGTGTTGG + Intergenic
1139492871 16:67296063-67296085 AAGTGCTGGAAGCTGTGTGAGGG + Intronic
1141287608 16:82687211-82687233 CAGTGATGGAAGGTGTGTAAAGG + Intronic
1141357718 16:83364267-83364289 AACTGTTGGTAGCTGTGTTTTGG + Intronic
1141544283 16:84753899-84753921 AACAGATGGCAGCTGTTTGTAGG + Intronic
1142171253 16:88624003-88624025 TTCTGATGGAAGGTCTATGTGGG - Exonic
1143776657 17:9203984-9204006 AACAGATGGAAGGCTTGTGCTGG + Intronic
1148938561 17:51186366-51186388 GACTGACTGAATGTGTGTGTTGG + Intronic
1150266488 17:63835403-63835425 AACTGCTGGATGATGTGAGTTGG - Exonic
1152536542 17:80953422-80953444 AACTTATGGGAGCTGGGTGTGGG - Intronic
1152657475 17:81526751-81526773 AACTGTGGGAGAGTGTGTGTGGG + Intergenic
1153377590 18:4398567-4398589 AACTGATGGAAGATGATTGCGGG + Intronic
1154176763 18:12091341-12091363 GACTGATGGAAAGTCTGTCTAGG + Intergenic
1155150766 18:23121278-23121300 AGCAGATGGATGGTGTGTGGTGG - Intergenic
1155511015 18:26577198-26577220 AAGAAATGGAAGGAGTGTGTAGG - Intronic
1155877349 18:31102629-31102651 AACTGCTTGTGGGTGTGTGTAGG - Intergenic
1156520995 18:37722184-37722206 AACAGATGGGAGGTGGGGGTGGG + Intergenic
1157901119 18:51518759-51518781 AATGGAGTGAAGGTGTGTGTTGG + Intergenic
1157991313 18:52499775-52499797 AAATGAAGGAAGCTCTGTGTGGG - Intronic
1163534034 19:17866772-17866794 AACAAAGGGATGGTGTGTGTGGG - Intergenic
1166210049 19:41300742-41300764 AAGTGATGGCAGGTGTGTCCTGG - Intronic
1166395959 19:42441318-42441340 AACTGAAGGAAGCTGTGGGAAGG + Intronic
925256697 2:2495783-2495805 AACTGCTTGAAGGTTTGTGGAGG - Intergenic
925304251 2:2837551-2837573 CACTGAGGGAGGGTGTGAGTCGG - Intergenic
925824715 2:7836398-7836420 AATTGCTGGAAGGTGTTTGCAGG + Intergenic
926441141 2:12890014-12890036 AAGTGAGGGAAGGGTTGTGTGGG + Intergenic
926563887 2:14448063-14448085 TACTAATGGAACGTGTTTGTTGG - Intergenic
926787697 2:16534562-16534584 AACTGATTGAAGTAGTGTGGTGG - Intergenic
928106657 2:28474878-28474900 AACTGATGGATGATGTGTGTAGG - Intronic
928191173 2:29169913-29169935 AAAGGCTGGGAGGTGTGTGTGGG - Intronic
929084322 2:38153410-38153432 AAGTGATGGGAGGTGGGAGTGGG + Intergenic
929217376 2:39429581-39429603 CACTGGGGGAAGGTGGGTGTTGG + Intronic
934155127 2:89192112-89192134 CACTGATGAAAGGACTGTGTGGG - Intergenic
934212187 2:89990615-89990637 CACTGATGAAAGGACTGTGTGGG + Intergenic
935713458 2:105919198-105919220 CACTGATGGCCAGTGTGTGTCGG - Intergenic
935720447 2:105974632-105974654 AAGTGGTAGAAGGTGTGTGTGGG - Intergenic
936600972 2:113894015-113894037 AAATGAAGGAAGGTATATGTGGG + Intronic
936621684 2:114106097-114106119 AAAAGATGCAAGATGTGTGTTGG - Intergenic
937681371 2:124648198-124648220 AACTGTTGCAGGGTGGGTGTTGG - Intronic
939097208 2:137847067-137847089 AAAAGATGAAAGGTGAGTGTTGG + Intergenic
939119907 2:138103748-138103770 CACTGGTGGAGGCTGTGTGTAGG - Intergenic
941747500 2:169102709-169102731 AAATGATGGACAGTGTGTGCAGG + Intergenic
942623835 2:177877526-177877548 AACAGATGGAAAGTCTGTCTGGG + Intronic
948338175 2:237227585-237227607 AAGTGATGGCAGCTTTGTGTGGG + Intergenic
948943480 2:241207849-241207871 AAGTGCTGGGAGGTGTGTGCCGG - Intronic
1169273913 20:4220579-4220601 AACTGATGGCTGCTGTCTGTTGG - Intergenic
1170238152 20:14131597-14131619 CACTAATGGAAGGAGAGTGTAGG + Intronic
1173704526 20:45100260-45100282 AAATGATGCAAGGTGTTTATCGG + Exonic
1174708928 20:52684863-52684885 GAGTGATGAAAGGTGTGTGTTGG + Intergenic
1174837658 20:53873514-53873536 CACTGATGCAGAGTGTGTGTGGG - Intergenic
1175633555 20:60561558-60561580 TTCTGATGGAAGGTGTTGGTGGG + Intergenic
1176256010 20:64153326-64153348 AACTGATGGCCTGTGTGTGCTGG + Intronic
1178779500 21:35588011-35588033 AAGTGGTGGGAGGTGTGTGAAGG - Intronic
1179473357 21:41626958-41626980 ATCTGAGGGAACGTGGGTGTGGG + Intergenic
1179498012 21:41786863-41786885 ACCTGAAGGCAGGTGTGGGTTGG + Intergenic
1180241102 21:46506507-46506529 AACTGTTGGAAAGGGTGTGGAGG - Intronic
1180621315 22:17164334-17164356 AACTAATAGAAAATGTGTGTGGG - Intronic
1182754690 22:32669261-32669283 TAGGGATGGGAGGTGTGTGTTGG + Intronic
1183232991 22:36594550-36594572 CACAGATGGAAGGTGTGTCCAGG + Intronic
1183330398 22:37217240-37217262 AGCTGATGGAAGGCGTCTGTCGG + Intergenic
1184058431 22:42067454-42067476 AGCCGCTGGGAGGTGTGTGTTGG - Intronic
1184218225 22:43081516-43081538 AAAAAATGGAAGGGGTGTGTGGG - Intronic
1184326764 22:43793790-43793812 AACCGATGGATGGTGTCTGTTGG - Intronic
950364374 3:12472649-12472671 AAATGAGGCAAGGTGTGTGAAGG - Intergenic
950488108 3:13284838-13284860 AACAGCTGGAAGGGGTGTCTGGG - Intergenic
952072588 3:29656634-29656656 ACCTGTTAGCAGGTGTGTGTGGG + Intronic
952134096 3:30397785-30397807 AACTGTTGGAAGGTGTGTTCAGG + Intergenic
952414502 3:33078356-33078378 CACTGATGGAAATTGTGTGAAGG + Intronic
953544519 3:43854539-43854561 TTCTCATGGAATGTGTGTGTGGG - Intergenic
957391173 3:79572459-79572481 AACTAAGAGAAGGTGTGTTTAGG + Intronic
960536162 3:118816575-118816597 ATATGATAGTAGGTGTGTGTTGG - Intergenic
961454950 3:127019394-127019416 GACTGGAGGCAGGTGTGTGTTGG + Intronic
961675950 3:128566830-128566852 AACTGAGAGAAAGTTTGTGTTGG + Intergenic
965372975 3:167887907-167887929 AACTGATGGAAAGTATGAGGTGG - Intergenic
965755362 3:172021083-172021105 GACTGGTGGAGGGTGTGTGGGGG - Intergenic
968231014 3:197004396-197004418 AAATGAGGGATGGTGTGGGTGGG + Intronic
968712573 4:2129856-2129878 CACTGATTGAAGGTCTATGTGGG + Intronic
969572209 4:8015683-8015705 AAGTGGTGGGAGGTGTGTGTTGG + Intronic
970411913 4:15817152-15817174 AACTGAGGGTTGGTGTGTTTAGG + Intronic
972937608 4:44157747-44157769 AACTAATGAAAGGTGTTTGGTGG - Intergenic
974514384 4:62890161-62890183 CAGTGATGGAAGTTCTGTGTGGG - Intergenic
977402717 4:96554286-96554308 AACTGGTGGCAGGGGTCTGTGGG - Intergenic
981766401 4:148255080-148255102 AGCAGGTGGGAGGTGTGTGTTGG - Intronic
987005342 5:13704435-13704457 ATCTGCTGGAAGGTGAGTTTTGG - Intronic
988175463 5:27717873-27717895 AACAGATGGAAAGTAAGTGTTGG + Intergenic
988612309 5:32738436-32738458 ACCTGATGTTATGTGTGTGTGGG - Intronic
990150212 5:52809419-52809441 AACTAATGGAAGATCAGTGTGGG - Intronic
994837300 5:104872143-104872165 ATCTGAAGGAAGGAGTGTCTTGG - Intergenic
996187469 5:120495433-120495455 TACAGATGGAGGCTGTGTGTAGG - Intronic
997165924 5:131660120-131660142 AACTGGTGGCAGGTGTGGATGGG + Intronic
998970701 5:147588909-147588931 AAGAGAAGGAAGGTGTGTGTTGG + Exonic
999265280 5:150263010-150263032 TTCTGATGGAAGGTGTTGGTTGG + Intronic
999402102 5:151273236-151273258 ACATGATGGCAGGTTTGTGTTGG - Intergenic
1001178649 5:169497269-169497291 AACTCATGGGAGGTGGGGGTTGG + Intergenic
1001304807 5:170563983-170564005 AGCAGAAGGAAGGGGTGTGTTGG - Intronic
1003621710 6:7706570-7706592 CAAGGAAGGAAGGTGTGTGTGGG - Intergenic
1007007570 6:38380038-38380060 AAATGAAGAAAGGTGGGTGTGGG + Intronic
1007810787 6:44484374-44484396 ATCTGATAGTTGGTGTGTGTAGG + Intergenic
1008526564 6:52413178-52413200 AACTGGGGGATGGGGTGTGTGGG + Intergenic
1008570919 6:52815699-52815721 AAATGCTGGGAGGTGTCTGTGGG - Intergenic
1008580792 6:52904776-52904798 AAATGCTGGGAGGTGTCTGTGGG - Intronic
1011972132 6:93238812-93238834 AACAGCTGGTAGGAGTGTGTGGG + Intergenic
1012370115 6:98494316-98494338 AACTGTTGGAAGATGTCTATTGG + Intergenic
1013107009 6:107034279-107034301 AACTTATGGATGGGGAGTGTGGG + Intronic
1014316294 6:119869542-119869564 TACTGATGGAAAGAGTGAGTTGG + Intergenic
1018049748 6:159998486-159998508 ATGTGATGGAAGGTGTTTTTAGG + Intronic
1018804095 6:167245446-167245468 AATACATGGAAGGTGTATGTTGG - Intergenic
1022778428 7:33552962-33552984 AAGTGAAGGAAGATTTGTGTGGG - Intronic
1022795332 7:33727349-33727371 AAGTGATGGGAGGAGTGTTTGGG + Intronic
1026030811 7:66792262-66792284 AAGTGAGGGCAGGTTTGTGTTGG - Intronic
1026102338 7:67393483-67393505 AACAGATGGAAGGTGTAGGTGGG + Intergenic
1027993495 7:85394930-85394952 CACTGATGCAAGATGTGGGTTGG + Intergenic
1028271859 7:88801270-88801292 AACTGCTAGAAGGTGAGTGGTGG + Intronic
1029116940 7:98242456-98242478 GATGGATGGAAGGTGTGTGCAGG - Intronic
1030135220 7:106240125-106240147 AACTGATTTTATGTGTGTGTGGG + Intergenic
1031028812 7:116712701-116712723 GAATGAAGGAGGGTGTGTGTGGG - Intronic
1031984854 7:128157482-128157504 AACTGGTGGTGGGTGGGTGTGGG - Intergenic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034302723 7:150030742-150030764 AAGTGGTGGGAGGGGTGTGTGGG - Intergenic
1035660814 8:1346692-1346714 AACTCATGGTAGCTGTGTGGAGG + Intergenic
1035660821 8:1346790-1346812 AACTCATGGTAGATGTGTGGAGG + Intergenic
1039352066 8:36773714-36773736 AAGTGATGGAAGTTGTGGGGGGG + Intergenic
1039488710 8:37931506-37931528 ATCTAATTGAACGTGTGTGTTGG + Intergenic
1040513423 8:48115579-48115601 AACTAATTACAGGTGTGTGTTGG - Intergenic
1041415499 8:57603436-57603458 AATTGGTGGTAGTTGTGTGTTGG - Intergenic
1044109687 8:88256704-88256726 CCCTGATGGATGGTGTGTGTGGG - Intronic
1045124934 8:99078988-99079010 GGCTGCTGGAAGGTGTGTATGGG + Intronic
1047669786 8:127133122-127133144 AACTGATGAAAGATAAGTGTTGG + Intergenic
1047800194 8:128301252-128301274 CACAGAGGGAAAGTGTGTGTGGG + Intergenic
1051737217 9:20213012-20213034 GCCTGACGGAGGGTGTGTGTGGG + Intergenic
1052526562 9:29626721-29626743 TACTGATAGAAGCTCTGTGTTGG + Intergenic
1052831675 9:33221097-33221119 AACTGCTGTCAGGTGGGTGTTGG + Intronic
1054954244 9:70889512-70889534 TCCTGCTGGAAGGTGTGTGTTGG - Intronic
1055240911 9:74184412-74184434 AACTGGGTGTAGGTGTGTGTCGG + Intergenic
1056281386 9:85044349-85044371 AACTGAATGATGTTGTGTGTAGG + Intergenic
1056522280 9:87412118-87412140 AACTGAGGGAAGGGGTTTGGGGG - Intergenic
1057688517 9:97261027-97261049 AAGTGATGGTATGTGTATGTGGG - Intergenic
1058216114 9:102236032-102236054 AACACTTGCAAGGTGTGTGTAGG + Intergenic
1059557728 9:115298263-115298285 AACAGGAGGATGGTGTGTGTGGG + Intronic
1060876800 9:127089792-127089814 AACTGTGGGAAGGTGTGCGCGGG + Intronic
1062008400 9:134253140-134253162 AACTGAGGGTAGGGATGTGTGGG + Intergenic
1062044885 9:134420371-134420393 TGCTGATGGAAGGTTTGTGGAGG + Intronic
1187544524 X:20234844-20234866 AACTGATGTGAGGTCTGTTTTGG - Intronic
1188469496 X:30521718-30521740 AACTGATGAAAAGTGTGAGTAGG - Intergenic
1188804691 X:34572292-34572314 AGAGGATGGAAGGTGTGTGGTGG + Intergenic
1188925409 X:36036242-36036264 AACTCATGGAAGCAGAGTGTAGG - Intronic
1190137573 X:47810991-47811013 AACTTATGGAAGGTTTATGAAGG - Intergenic
1194087585 X:89548018-89548040 AACCAATAGAATGTGTGTGTGGG + Intergenic
1199883643 X:151997099-151997121 AATTGATTGATGTTGTGTGTAGG + Intergenic
1200440230 Y:3203888-3203910 AACCAATAGAACGTGTGTGTGGG + Intergenic
1201557785 Y:15282560-15282582 GGCAAATGGAAGGTGTGTGTTGG - Intergenic