ID: 1135585774

View in Genome Browser
Species Human (GRCh38)
Location 16:23669770-23669792
Sequence CCAGGCTCAGGTACCCCCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 1, 2: 3, 3: 24, 4: 233}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135585774_1135585785 16 Left 1135585774 16:23669770-23669792 CCACTGGGGGTACCTGAGCCTGG 0: 1
1: 1
2: 3
3: 24
4: 233
Right 1135585785 16:23669809-23669831 AGGATATTGCCTAGCCAAAGTGG 0: 1
1: 0
2: 2
3: 5
4: 85
1135585774_1135585782 -7 Left 1135585774 16:23669770-23669792 CCACTGGGGGTACCTGAGCCTGG 0: 1
1: 1
2: 3
3: 24
4: 233
Right 1135585782 16:23669786-23669808 AGCCTGGATTAGAGGGCAGGGGG 0: 2
1: 1
2: 3
3: 33
4: 315
1135585774_1135585780 -9 Left 1135585774 16:23669770-23669792 CCACTGGGGGTACCTGAGCCTGG 0: 1
1: 1
2: 3
3: 24
4: 233
Right 1135585780 16:23669784-23669806 TGAGCCTGGATTAGAGGGCAGGG 0: 2
1: 0
2: 3
3: 19
4: 248
1135585774_1135585784 -4 Left 1135585774 16:23669770-23669792 CCACTGGGGGTACCTGAGCCTGG 0: 1
1: 1
2: 3
3: 24
4: 233
Right 1135585784 16:23669789-23669811 CTGGATTAGAGGGCAGGGGGAGG 0: 2
1: 0
2: 3
3: 30
4: 419
1135585774_1135585781 -8 Left 1135585774 16:23669770-23669792 CCACTGGGGGTACCTGAGCCTGG 0: 1
1: 1
2: 3
3: 24
4: 233
Right 1135585781 16:23669785-23669807 GAGCCTGGATTAGAGGGCAGGGG 0: 2
1: 0
2: 1
3: 28
4: 357
1135585774_1135585786 17 Left 1135585774 16:23669770-23669792 CCACTGGGGGTACCTGAGCCTGG 0: 1
1: 1
2: 3
3: 24
4: 233
Right 1135585786 16:23669810-23669832 GGATATTGCCTAGCCAAAGTGGG 0: 1
1: 0
2: 1
3: 3
4: 61
1135585774_1135585779 -10 Left 1135585774 16:23669770-23669792 CCACTGGGGGTACCTGAGCCTGG 0: 1
1: 1
2: 3
3: 24
4: 233
Right 1135585779 16:23669783-23669805 CTGAGCCTGGATTAGAGGGCAGG 0: 2
1: 0
2: 1
3: 23
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135585774 Original CRISPR CCAGGCTCAGGTACCCCCAG TGG (reversed) Exonic
900185254 1:1330410-1330432 CCAGGCGCAGGCCCTCCCAGGGG - Intergenic
900757243 1:4444743-4444765 CCAGGCACAGGTGGCCTCAGCGG - Intergenic
901656413 1:10772284-10772306 TCAGTCCCAGGCACCCCCAGAGG + Intronic
903767304 1:25743068-25743090 CCTGGCTCAGGAACCTGCAGTGG + Intronic
904418720 1:30378064-30378086 CCACTCTCAGGTTCCCCCATGGG + Intergenic
904852052 1:33466829-33466851 CAAGGCCCAGGCATCCCCAGAGG - Intergenic
906035186 1:42746460-42746482 ACAGGCCCAGCCACCCCCAGGGG - Exonic
906555710 1:46711316-46711338 CCATACTCAGGTACCCCGAAGGG + Intronic
907239286 1:53071648-53071670 CCAGGGTCAGGGACACCAAGTGG + Intronic
907289258 1:53402445-53402467 CCAGGCCAAGGTACCCACAAGGG - Intergenic
908195434 1:61742593-61742615 CCAGGCGCGGGGACACCCAGGGG - Intronic
908600783 1:65737582-65737604 CCAGGCTGAGGTAGTCTCAGAGG + Intergenic
912453717 1:109783833-109783855 CCAGGCTTGGGTCGCCCCAGTGG - Intergenic
912553252 1:110497952-110497974 CCTAGCTCAGGCACCTCCAGTGG - Intergenic
915942529 1:160127830-160127852 TCAGGCTGAGGTGCCACCAGGGG + Intronic
916040195 1:160954930-160954952 CCAGGCTCAGGTACCCTCAGAGG - Intergenic
918024165 1:180726559-180726581 TCAGTCTCAGGGACCCCAAGAGG - Intronic
918512580 1:185327737-185327759 CAAGGCTCAGGAACCCACAGTGG + Intergenic
921639350 1:217533476-217533498 AGAGTCTCAGGGACCCCCAGTGG + Intronic
922158090 1:223055595-223055617 CCAGGCTGAGATCCCGCCAGGGG - Intergenic
1064231770 10:13535561-13535583 CCAGGCTGAGGTCCATCCAGAGG + Intergenic
1066278675 10:33892989-33893011 ACAGGCTCAGGTGCTCCCAAAGG + Intergenic
1068388217 10:56359674-56359696 CCAGGCCAAGGTACACCCAGGGG - Exonic
1069608653 10:69757552-69757574 CCAGGCTCAGCTGCCCTCTGGGG + Intergenic
1069916363 10:71789500-71789522 CCAGGCTCACCTCCCTCCAGAGG + Intronic
1073250380 10:102117546-102117568 CCTGGGTCAGGGAGCCCCAGGGG - Intronic
1074447805 10:113534576-113534598 CCAGGCTGAGCCACCCCCAAAGG - Intergenic
1074777185 10:116775088-116775110 CCTGGCACAGGTGCCCCCAAGGG + Intergenic
1074829717 10:117240406-117240428 CCCTGCTCAGGTGGCCCCAGAGG + Intergenic
1076566777 10:131404360-131404382 CCAGGCTCAGGGGCTCCCATAGG + Intergenic
1077284306 11:1758980-1759002 CCTGGCTCAGGTACCCGGAGAGG + Exonic
1077364492 11:2156054-2156076 CCAGCCTCAGTAGCCCCCAGGGG + Intronic
1077550616 11:3198431-3198453 CCAGGAGCAGCCACCCCCAGGGG - Intergenic
1078448254 11:11421181-11421203 CCAGGCTCAGGCAGCTTCAGCGG + Intronic
1081861521 11:46335799-46335821 CCAGGCCCAGGGGACCCCAGGGG + Intronic
1083769617 11:64859238-64859260 TCAGGCTCAGTAAACCCCAGAGG + Intronic
1083899471 11:65636648-65636670 CCAGCCTCAGGGAGCCCCAAAGG + Exonic
1084459267 11:69287078-69287100 CCGGGCCCAGGTTCCCACAGAGG + Intergenic
1085045891 11:73353170-73353192 CCAAGTTCAGGTCCACCCAGGGG - Intronic
1086508202 11:87528037-87528059 CCAGACACAGGTACCCACAGTGG - Intergenic
1089291052 11:117438140-117438162 CCAGCCTCAGGTACCCCAACAGG + Intronic
1089383104 11:118050289-118050311 CCAGGCACAGGTTGCCCCACAGG + Intergenic
1089586444 11:119512684-119512706 CGAAGCCCAGATACCCCCAGGGG - Intergenic
1090566082 11:127993533-127993555 CCAGGCTCAGAAACTCCCTGGGG - Intergenic
1090615922 11:128514801-128514823 CCAGGCTCAGGTGGCCCCATGGG - Intronic
1090635446 11:128688050-128688072 CCGGGCTCGGGTACTCCGAGTGG - Intronic
1090717650 11:129444349-129444371 TCAGGGTCAGGTCCCCCCAGAGG - Intronic
1090868954 11:130726139-130726161 CCAGGCTCAGGACACCTCAGAGG + Intergenic
1091778983 12:3201962-3201984 CCAGGTTCTGGGAGCCCCAGTGG + Intronic
1094095406 12:26698679-26698701 CCAGCCTCAAGTCCCCTCAGTGG - Intronic
1094851008 12:34382344-34382366 CGAGGCACAGGTCCCCCCAAAGG - Intergenic
1095635789 12:44431753-44431775 CCTGGCTGAGGTGCCCCGAGCGG + Intergenic
1096392379 12:51239258-51239280 CCGCGCTCCGGAACCCCCAGCGG + Intronic
1097750650 12:63348783-63348805 CCAGGCCCAGGGTGCCCCAGGGG - Intergenic
1101579284 12:106027337-106027359 CCAGGAGCCGGTACCCTCAGTGG - Intergenic
1101818625 12:108165357-108165379 CCAGGCTCTGTTACCCCAAAGGG + Intronic
1104768772 12:131346880-131346902 CCAGACTCAGGCACCTCCAGTGG - Intergenic
1104981946 12:132577159-132577181 CCAGGCCCAGGTCCACCCTGGGG - Intronic
1105301116 13:19135504-19135526 CCAGGCTCAGCAGCCCACAGAGG - Intergenic
1105863668 13:24439968-24439990 CCAGGCTCAGGTGGCCCCGTAGG - Intronic
1112046368 13:95602066-95602088 CCAGCCTCAGGAACACTCAGCGG + Intronic
1113592696 13:111512265-111512287 CCAGGCTGAGTCAGCCCCAGGGG + Intergenic
1114189369 14:20429222-20429244 CCAGCCCGAGGTACCCCCATAGG + Exonic
1114269467 14:21092144-21092166 GCAGGCTCAGGTAGCCCAAGAGG + Exonic
1114485382 14:23058506-23058528 CCACGCTCAGATATCCACAGTGG + Intergenic
1114621294 14:24097996-24098018 CCAGGGGCAGAGACCCCCAGAGG + Intronic
1114646671 14:24259902-24259924 CCAGGGTCACATACACCCAGAGG - Intronic
1119428346 14:74550341-74550363 CCAGGCTCAGGGACACCCCAAGG + Intronic
1122588535 14:102827992-102828014 CCGGGCTCAGGTACGCCCTGCGG - Intronic
1122645107 14:103189084-103189106 CCACGCCCGGGTGCCCCCAGGGG + Intergenic
1122652629 14:103233804-103233826 CAAGGCTCTGCCACCCCCAGGGG + Intergenic
1123034219 14:105465339-105465361 CCAGGCTCAGGCAGACCCACTGG + Intronic
1123111110 14:105867205-105867227 CCAGGCTAAGTGACCCTCAGGGG - Intergenic
1123119263 14:105909310-105909332 CCAGGCTGAGGTGGCCCCAGGGG - Intergenic
1127853439 15:62935310-62935332 CCTTGCTCAGGCACCTCCAGGGG - Intergenic
1127914637 15:63445364-63445386 CCAGCCTGAGGAAGCCCCAGTGG - Intergenic
1128236949 15:66074126-66074148 TCAGGCTCAGGTTACCCCTGGGG - Intronic
1128654966 15:69453781-69453803 ACATGCTAAAGTACCCCCAGCGG + Intronic
1132091653 15:98952260-98952282 CCAGGCTCCCGGATCCCCAGTGG - Intronic
1132148035 15:99440076-99440098 CCATGCTCAGCCACCCCAAGTGG - Intergenic
1132333391 15:101027640-101027662 GCAGGCTCAGGTAGCTCCTGGGG - Exonic
1132355411 15:101167984-101168006 CCAGGCACAGGAAGCCCCGGGGG + Intergenic
1132570021 16:640509-640531 CCAGGCTGAGGTGCACCCAGAGG - Intronic
1132600166 16:769598-769620 CCAGGGGCAGGTACCCCAGGGGG + Exonic
1135435772 16:22425722-22425744 CCAGGCTCTGCTTTCCCCAGGGG - Intronic
1135585774 16:23669770-23669792 CCAGGCTCAGGTACCCCCAGTGG - Exonic
1135882729 16:26274599-26274621 CCAGGCTCTGGTACCAGTAGTGG - Intergenic
1136453827 16:30369732-30369754 CCAGGACCAGGGACCCCCACCGG - Exonic
1136544846 16:30949138-30949160 CCAGGAAGAGGCACCCCCAGTGG - Exonic
1139430187 16:66907022-66907044 CCTGGCTCAGGTACCCCCACTGG - Intergenic
1139715506 16:68810071-68810093 CTAGGCTCTGAGACCCCCAGTGG - Intronic
1141892417 16:86935283-86935305 CCAGCCCCAGGATCCCCCAGGGG + Intergenic
1142127365 16:88416865-88416887 TCAGGCTCTGGTCCCCCAAGAGG - Intergenic
1142279306 16:89139374-89139396 CCCGCCTCAGGAAGCCCCAGGGG - Intronic
1142306641 16:89289671-89289693 CCAGGGACAGGTCCCTCCAGGGG + Intronic
1142661946 17:1436741-1436763 CCAGGCTCCGGCCCACCCAGTGG + Exonic
1145013260 17:19381795-19381817 CGAGGCTCAGGAGCCTCCAGGGG - Exonic
1145909483 17:28534277-28534299 CCAGGCTCAGGAAGCCAGAGCGG - Intronic
1146006482 17:29163735-29163757 CCAGGCCCAGGGCCCCACAGAGG + Intronic
1146224092 17:31050864-31050886 CAGGGCTCAGGTGACCCCAGGGG + Intergenic
1146341222 17:32021267-32021289 CAGGGCTCAGGTGGCCCCAGGGG - Exonic
1146647055 17:34582496-34582518 CCCGGCTGAGGTAACACCAGGGG + Intronic
1148161707 17:45453904-45453926 CCAGCCTGAGGAACCCCCCGAGG - Exonic
1148785935 17:50146243-50146265 CCAGGCAGGGGTGCCCCCAGTGG + Intronic
1149312082 17:55404566-55404588 GCAGGATCAGATACCCACAGTGG + Intronic
1150315499 17:64165543-64165565 TCAGGCCCAGGCAGCCCCAGTGG + Intronic
1150330815 17:64292912-64292934 CCAGGCTTAGGTAGCCCCTCTGG - Intergenic
1150392944 17:64800549-64800571 CCAGCCTGAGGAACCCCCCGAGG - Intergenic
1150607342 17:66705669-66705691 CCAGGCCCTGGTACCCACAGGGG + Intronic
1152409827 17:80117741-80117763 CCTGGCCCAGGTACCTGCAGGGG - Intergenic
1152739464 17:82012640-82012662 CAGGGCTCAGGGAGCCCCAGAGG + Intronic
1152753581 17:82077729-82077751 CCAAGCTCATGTCCACCCAGCGG + Intergenic
1153282604 18:3427979-3428001 AGTGCCTCAGGTACCCCCAGGGG - Intronic
1155442640 18:25877992-25878014 CCAGGCTGAGCCATCCCCAGAGG - Intergenic
1157194157 18:45606862-45606884 CCAGGCTCAGGTTCCGCCACAGG + Intronic
1158468616 18:57713983-57714005 CTAGACTCAGGGACCCCAAGAGG - Intronic
1160967399 19:1752783-1752805 CCAGGCTCCAGTGCCTCCAGCGG + Exonic
1160999919 19:1905471-1905493 CCAGGCTCAGACTTCCCCAGAGG + Intronic
1161699661 19:5787778-5787800 ACTGGCTCAGGGCCCCCCAGTGG - Intronic
1161846184 19:6713147-6713169 CCAGGCTCAGGACCACCAAGTGG - Intronic
1162581804 19:11536022-11536044 GCAGCCCCGGGTACCCCCAGGGG - Intergenic
1163408997 19:17141649-17141671 CCTGCCTCAAGTTCCCCCAGGGG + Intronic
1164911819 19:32018953-32018975 CAAGGCTGGGGTGCCCCCAGGGG + Intergenic
1165363280 19:35349946-35349968 GGAGGCTCAGGTGACCCCAGTGG + Intergenic
1166230711 19:41424631-41424653 CCATCCTCAGCTACCCCGAGAGG + Exonic
1166275548 19:41751065-41751087 CCAGGCTGAGCCATCCCCAGAGG + Intronic
1166318683 19:42003284-42003306 GCAGGAACAGGGACCCCCAGGGG - Intronic
1167520746 19:49953148-49953170 CCAGGCTGAAGTTCACCCAGTGG - Intronic
925617122 2:5754244-5754266 CCAGCCTCAGGCAAGCCCAGGGG + Intergenic
925994045 2:9277272-9277294 CCAGGCTCAGCCAGCACCAGTGG - Intronic
926683761 2:15682472-15682494 CCAGGCTCAAGTACCCACACAGG - Intergenic
927249061 2:20981859-20981881 CCAGGTCCAGGAACCCACAGAGG - Intergenic
927709579 2:25316191-25316213 CTAGGCTTAGGGACACCCAGAGG + Intronic
928427580 2:31191971-31191993 CCAGGCACAGGTGCCGCAAGCGG - Exonic
931464295 2:62473326-62473348 CCAGGCTCAGCTGCTCCCTGTGG + Intergenic
932885516 2:75545868-75545890 CCTGGAAGAGGTACCCCCAGAGG + Intronic
933274613 2:80270207-80270229 ACAAACTCAGGTACCCACAGGGG - Intronic
933363393 2:81316317-81316339 CCAGTGTCATCTACCCCCAGAGG + Intergenic
935677654 2:105609685-105609707 CCAGGCTCAGGCTGCCCCAGGGG + Intergenic
937065430 2:119013342-119013364 GCAGGCCCAGGTAGCCCCAAAGG - Intergenic
937345227 2:121121216-121121238 CCAGGCCCAGGTACGGACAGAGG + Intergenic
937762450 2:125622297-125622319 CCAGGCTGAGGTAGTCCCAGAGG + Intergenic
938115080 2:128597107-128597129 CCAGCCTCAGGGAGCTCCAGTGG + Intergenic
938233010 2:129678246-129678268 CCCTGCTCAGGTACCAACAGAGG - Intergenic
942884463 2:180906248-180906270 CCAAGCTCAGGTACCCAAGGTGG + Intergenic
944242410 2:197499499-197499521 CCAGGCGCAGGTTGCACCAGCGG + Intronic
948237602 2:236402233-236402255 CCTGGCTCAAGTGTCCCCAGGGG + Intronic
948696635 2:239736253-239736275 CCGGGCTCTGGGACCCGCAGGGG - Intergenic
948953370 2:241269821-241269843 CCAGGCTAAGGTGCCCCAACAGG + Intronic
1169227522 20:3865714-3865736 CCAGGCTGAGCTGCCTCCAGTGG - Exonic
1171531800 20:25858156-25858178 CCAGGATGAGGAAACCCCAGGGG - Intronic
1174058875 20:47818569-47818591 CCTAGCTCAGGAACTCCCAGAGG - Intergenic
1174110409 20:48194460-48194482 CCAGGCCCAGGTTCCCCATGCGG + Intergenic
1174215354 20:48912129-48912151 TCAGCCTCAGGTGCCCGCAGAGG - Intergenic
1175379424 20:58552595-58552617 CCTGGCAGAGGTTCCCCCAGAGG + Intergenic
1175454664 20:59103003-59103025 TCAGGCTCTGGTACCGACAGAGG - Intergenic
1178314286 21:31556323-31556345 CCTGCCTCAGTTACCCCGAGTGG - Intronic
1178843699 21:36157198-36157220 CCAGGGTCGGGTAACCCTAGGGG - Intronic
1180157590 21:45985679-45985701 GCAGCCTCGGGTACCCCCACTGG - Intronic
1180233828 21:46444292-46444314 CCAGGCCCAGGGAGCACCAGGGG - Intronic
1180296568 22:10942970-10942992 CCAGGCTCAGCTGACTCCAGAGG - Intergenic
1180716195 22:17873922-17873944 TTAGGGTCAGGTTCCCCCAGGGG - Intronic
1181025377 22:20124589-20124611 CCAGGCACAGGCAGCCCCAAGGG - Intronic
1181174566 22:21028365-21028387 CCTGGCACAGGCACCCCCACGGG - Exonic
1183388117 22:37526647-37526669 CCAGGCTCAGGTAAGGCCACGGG + Intergenic
1184112441 22:42403187-42403209 CCAGGCTTCGGTTTCCCCAGTGG - Intronic
1184268478 22:43363738-43363760 CCAGGCTCAGCTTCCCCCAGTGG + Intergenic
951566987 3:24020447-24020469 CCAGGATCAGGTGATCCCAGTGG - Intergenic
953032496 3:39187681-39187703 CCAGCCTGAGGCACCCCCAAAGG - Exonic
953380687 3:42470068-42470090 CCAGGCTCAGGTAGTTTCAGTGG + Intergenic
954127223 3:48538727-48538749 CCAGCCTCAGGTTCCCGCACTGG - Intronic
954627844 3:52032345-52032367 CAAGGCTAAGGTACACCCTGTGG - Intergenic
955639545 3:61067576-61067598 CCAGTCTCCAGTCCCCCCAGAGG + Intronic
957530710 3:81437856-81437878 CCTGGCTTATGTACCCACAGTGG - Intergenic
959389627 3:105758773-105758795 CCAGACACAGGTGCCCACAGTGG - Intronic
959489382 3:106969769-106969791 TCAGGCTCAGCTACCTCCATGGG + Intergenic
961509686 3:127393257-127393279 CCAGGCTCAGAGACACACAGAGG + Intergenic
961651862 3:128420860-128420882 CAAGCCTGAGGTACCCCCAGAGG - Intergenic
963133078 3:141876448-141876470 CCAGGCTGAGGGAGCCCCCGAGG + Intronic
964203417 3:154143945-154143967 CCAGGCTCAGTAGCCCACAGCGG + Intronic
966649878 3:182288257-182288279 CCAGACTCAGGAACTCACAGTGG - Intergenic
967009750 3:185421679-185421701 TCTGGCTCAGGTACCCTCATGGG - Intronic
968599013 4:1500446-1500468 CCAGGCTGAGGAACCACCAGGGG + Intergenic
968764043 4:2458958-2458980 CCAGGGTCAGGGACCCCTTGAGG + Intronic
968905370 4:3448349-3448371 CCAGGCTCTGGGCTCCCCAGGGG - Intronic
969600129 4:8171320-8171342 CCAGCCCCAGGTGCCCGCAGGGG + Intergenic
972186083 4:36529779-36529801 ACATGCTTAGGTACCACCAGTGG + Intergenic
973534426 4:51867177-51867199 CCAGGTGCAGGTGCCCACAGTGG - Intronic
976092305 4:81471497-81471519 GCAGTCCCAGGTACCCGCAGCGG + Intronic
977453609 4:97229035-97229057 TCAGGCTCAGCTATCCACAGGGG - Intronic
978309014 4:107364901-107364923 CCAGGCTGAGGTGGCCTCAGAGG + Intergenic
982035588 4:151342798-151342820 ACAGGCTCAGGTATGCACAGAGG + Intergenic
982449186 4:155531889-155531911 CCAGGCTCTGGTAGCCCCAGGGG - Intergenic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
983966378 4:173817361-173817383 CCAAGGTCAGTAACCCCCAGCGG - Intergenic
985085548 4:186309002-186309024 CCAGAGTCAGATACCCACAGGGG - Intergenic
985649615 5:1101319-1101341 CCAGGCTGACCTATCCCCAGGGG + Intronic
985682967 5:1266067-1266089 GCAGGCTCAGGTGCACCCTGGGG + Intronic
985724059 5:1506456-1506478 CCAGCCTCAGGCACACCCATTGG + Intronic
985967604 5:3349395-3349417 CCAGCCTCAGGTCCCACCAGTGG + Intergenic
986153314 5:5147912-5147934 CCTGGCTCAGGGAAACCCAGGGG - Intronic
986318498 5:6608244-6608266 CCAACCTCAGCTTCCCCCAGAGG + Intronic
988492184 5:31714248-31714270 TGTGGGTCAGGTACCCCCAGAGG + Intronic
990699429 5:58459797-58459819 CCAGGCGCAAGTGCCCCCGGCGG - Exonic
994001992 5:94791793-94791815 CCAGGGTGGGGTAGCCCCAGTGG - Intronic
997048806 5:130353490-130353512 CCAGGCTCAGGTAACCTCTCTGG - Intergenic
997610929 5:135215265-135215287 CCTGTCTCAGAAACCCCCAGGGG + Intronic
997733611 5:136197858-136197880 CCAGGCTCAGGGGCCCCTGGTGG + Intergenic
999206146 5:149849524-149849546 CCAGGCTCAGGGAACCTGAGTGG - Exonic
999305205 5:150515101-150515123 ACATGCTCAGGTGCACCCAGGGG + Intronic
1000254515 5:159525256-159525278 CCATCCTCAGGCAGCCCCAGGGG - Intergenic
1001936857 5:175711662-175711684 GCAGGCTCAGATGCCACCAGTGG + Intergenic
1003220357 6:4155709-4155731 CATGTCTCAGGTACCCCTAGAGG - Intergenic
1006271382 6:32969324-32969346 CCCGGCTGCTGTACCCCCAGGGG - Intronic
1006644902 6:35509300-35509322 CCACGCTCAGGCACTCCCAAAGG - Exonic
1007768500 6:44175851-44175873 CCATACTCAGGTTCCCCCAGTGG - Intronic
1009588728 6:65638569-65638591 CCAGACACAGGTGCCCACAGTGG + Intronic
1010229459 6:73521661-73521683 CCAGGCCCGGGGACCCCGAGGGG + Intronic
1013227923 6:108133979-108134001 CCAGGCGCAGCTTCCCCCAGAGG + Intronic
1015901621 6:138074094-138074116 CCAGGCTGAGGTGACCTCAGAGG + Intergenic
1019353063 7:564209-564231 CAAGTCTCAGGTTCCCACAGGGG - Intronic
1019399998 7:847315-847337 CCAGGCTCCGGGATCCCCTGGGG + Intronic
1019483669 7:1277740-1277762 CCAGGCTCAGCTTTCCCCACTGG - Intergenic
1019488741 7:1301316-1301338 ACAGACTCAGGGGCCCCCAGCGG - Intergenic
1019534658 7:1522709-1522731 CCAGGCCGAGGGACCCCCAGAGG + Intergenic
1019577399 7:1744108-1744130 CCTGTCTCAGGACCCCCCAGGGG + Intronic
1019694993 7:2440604-2440626 CCAGCCCGAGGTACCCACAGTGG + Intergenic
1019776643 7:2915484-2915506 ACTGGCCCAGGAACCCCCAGGGG - Intronic
1023257042 7:38322632-38322654 CCAGGATCAGCTACACCCACTGG - Intergenic
1024217071 7:47256685-47256707 CCAGGCTCAGGTGCCCGCTGGGG - Intergenic
1028136870 7:87231262-87231284 CCAGACACAGGTGCCCACAGTGG + Intergenic
1029276948 7:99411231-99411253 ACAGGCTTAGATGCCCCCAGGGG + Intronic
1029538506 7:101169774-101169796 CCAGAATCAGGTACCTCAAGTGG - Intergenic
1035284165 7:157795722-157795744 ACAGGCTCAGGAACCCTCTGGGG - Intronic
1036793616 8:11740095-11740117 TCAGGCTCAGATACAACCAGGGG - Intronic
1037967723 8:23146820-23146842 GCAGGCTCAGGAAACCCCACAGG + Intronic
1046186935 8:110734199-110734221 CCAGACGCTGGTACCCACAGTGG - Intergenic
1049299796 8:141863463-141863485 ACAGGCTCAGGACTCCCCAGCGG + Intergenic
1049343209 8:142124816-142124838 CCAGCCTCAGGGGACCCCAGGGG - Intergenic
1049581219 8:143411944-143411966 CCAGGCTGGGGGACCCCAAGAGG - Intergenic
1049962182 9:747429-747451 CCAGGCCCGGGAACCACCAGAGG - Intergenic
1054173165 9:61858134-61858156 CCAGGATGAGGAAGCCCCAGGGG + Intergenic
1054336275 9:63813079-63813101 CTAGGATCCGGGACCCCCAGAGG - Intergenic
1054664377 9:67722647-67722669 CCAGGATGAGGAAGCCCCAGGGG - Intergenic
1055694635 9:78870647-78870669 CCAGGCTCAGGGGCTTCCAGGGG + Intergenic
1057484888 9:95475283-95475305 CCAGGCCCCGTCACCCCCAGAGG - Intronic
1057748599 9:97772043-97772065 GCAGGCCCAGGTGCCCTCAGAGG - Intergenic
1058487582 9:105457917-105457939 CCAGACGCAGGCACCCACAGAGG - Intronic
1060601353 9:124880339-124880361 ACAGGATCAGCTACCCCCTGAGG + Exonic
1061386838 9:130295482-130295504 CCACCCTCAGGGATCCCCAGGGG - Intronic
1061451668 9:130670305-130670327 CTAGGCCCTGGCACCCCCAGGGG - Intronic
1061860350 9:133464766-133464788 CCAGGCCCGGGGACACCCAGGGG - Intronic
1062469970 9:136698010-136698032 TCTGCCTCAGCTACCCCCAGGGG + Intergenic
1062523434 9:136969006-136969028 CCAGGGTCAGCCATCCCCAGGGG + Intergenic
1186967441 X:14803298-14803320 CCAGGCTCAAGTTCTCCCAAAGG + Intergenic
1192543312 X:71993216-71993238 GCACACTCAGCTACCCCCAGTGG + Intergenic
1193076616 X:77362566-77362588 CCAGAGCCAGGTAGCCCCAGTGG - Intergenic
1194930995 X:99887370-99887392 GCTGGGTCAGATACCCCCAGAGG - Intergenic
1202165058 Y:21978983-21979005 CCAGGCTGAAGTTCTCCCAGTGG - Intergenic
1202226298 Y:22607391-22607413 CCAGGCTGAAGTTCTCCCAGTGG + Intergenic
1202316817 Y:23588274-23588296 CCAGGCTGAAGTTCTCCCAGTGG - Intergenic
1202553948 Y:26081784-26081806 CCAGGCTGAAGTTCTCCCAGTGG + Intergenic