ID: 1135588087

View in Genome Browser
Species Human (GRCh38)
Location 16:23686387-23686409
Sequence TAGTAAAAATAGATGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135588087_1135588088 -8 Left 1135588087 16:23686387-23686409 CCATGTTTCATCTATTTTTACTA No data
Right 1135588088 16:23686402-23686424 TTTTACTAGTTATCAACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135588087 Original CRISPR TAGTAAAAATAGATGAAACA TGG (reversed) Intronic
No off target data available for this crispr