ID: 1135589576

View in Genome Browser
Species Human (GRCh38)
Location 16:23695385-23695407
Sequence GTCCCCTGGAAAGTGGGTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 246}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135589566_1135589576 29 Left 1135589566 16:23695333-23695355 CCAAAGCACTCGCGGAGGAGCCG 0: 1
1: 0
2: 0
3: 4
4: 28
Right 1135589576 16:23695385-23695407 GTCCCCTGGAAAGTGGGTGATGG 0: 1
1: 0
2: 0
3: 21
4: 246
1135589567_1135589576 9 Left 1135589567 16:23695353-23695375 CCGCTTGACAGCCACTGCCCGTC 0: 1
1: 0
2: 1
3: 6
4: 139
Right 1135589576 16:23695385-23695407 GTCCCCTGGAAAGTGGGTGATGG 0: 1
1: 0
2: 0
3: 21
4: 246
1135589568_1135589576 -2 Left 1135589568 16:23695364-23695386 CCACTGCCCGTCCCTCAAACTGT 0: 1
1: 0
2: 3
3: 30
4: 243
Right 1135589576 16:23695385-23695407 GTCCCCTGGAAAGTGGGTGATGG 0: 1
1: 0
2: 0
3: 21
4: 246
1135589570_1135589576 -9 Left 1135589570 16:23695371-23695393 CCGTCCCTCAAACTGTCCCCTGG 0: 1
1: 0
2: 7
3: 36
4: 345
Right 1135589576 16:23695385-23695407 GTCCCCTGGAAAGTGGGTGATGG 0: 1
1: 0
2: 0
3: 21
4: 246
1135589569_1135589576 -8 Left 1135589569 16:23695370-23695392 CCCGTCCCTCAAACTGTCCCCTG 0: 1
1: 1
2: 4
3: 27
4: 297
Right 1135589576 16:23695385-23695407 GTCCCCTGGAAAGTGGGTGATGG 0: 1
1: 0
2: 0
3: 21
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135589576 Original CRISPR GTCCCCTGGAAAGTGGGTGA TGG Exonic
900078939 1:841300-841322 GTGACCTGGAAGGTGTGTGAGGG + Intergenic
900658235 1:3770673-3770695 GGCCCCAGGAACGTGGGTGCTGG - Intronic
901369541 1:8784872-8784894 GTTCTGTGAAAAGTGGGTGAAGG - Intronic
901391919 1:8951661-8951683 GTCCTCTGGAAATTGGGAGGCGG - Intronic
901922523 1:12547330-12547352 ATCCCCTGGAGAGAGGGTGGAGG - Intergenic
903354032 1:22735615-22735637 GACCCCTGGGAAGTGGGAGAAGG - Intronic
904061761 1:27716606-27716628 ATCACCTGGAGAGTGAGTGAAGG - Intergenic
904903310 1:33874971-33874993 CAGCCCTGGCAAGTGGGTGAGGG + Intronic
906513570 1:46424923-46424945 GTCCCCTGGATGGTGATTGATGG + Intergenic
906791039 1:48659040-48659062 GTCACCTGGTAAGTTGGTGGTGG - Intronic
911251922 1:95585952-95585974 CTCCCATGGAAAGTGGGTGGAGG + Intergenic
912153928 1:106892496-106892518 GTCTCCTGAAAGGTGTGTGAAGG - Intergenic
912419349 1:109532659-109532681 GTCCCCAGGCATGTGGGTGAGGG + Intergenic
916151488 1:161796452-161796474 GGACCCTGGGATGTGGGTGATGG + Intronic
916666873 1:166975080-166975102 GTCTGGTGGAAAGTGGGGGAGGG - Intronic
918083163 1:181222882-181222904 GACCCCGAGAATGTGGGTGAAGG + Intergenic
920068709 1:203287442-203287464 GTCCCCAGGGGAGTGGGTGGAGG + Intergenic
921699392 1:218250242-218250264 GTTCCTTGCAAAGTGGGTGATGG + Intergenic
922533383 1:226361764-226361786 ATCCTCTGGAAACTGGGGGAAGG + Intronic
922548195 1:226474182-226474204 GTCCCCTGCTGATTGGGTGATGG + Intergenic
922707068 1:227795441-227795463 CTCCCCTGGAAGGAGGGTGTTGG - Intergenic
923103879 1:230839261-230839283 GTTCCCTGGAAATGGCGTGAGGG + Exonic
1062799784 10:370416-370438 GTCCCCTGGAGACAGGGAGAGGG - Intronic
1062970347 10:1643460-1643482 GTCACCTGGAGGGTGGCTGATGG + Intronic
1063070594 10:2659118-2659140 GTCCCCTGTGGCGTGGGTGATGG + Intergenic
1066694998 10:38069448-38069470 GTACCCTGGCAAGTGGGTTCAGG - Intergenic
1067478997 10:46583540-46583562 TACCCCTGGAAAGTGGGGGTAGG - Intronic
1067615741 10:47758261-47758283 TACCCCTGGAAAGTGGGGGTAGG + Intergenic
1069852403 10:71418420-71418442 GACCCCTGGAGAGTTGCTGATGG - Intronic
1070682360 10:78457325-78457347 GTCCCCTGGGTTGTGGGGGAAGG - Intergenic
1070772116 10:79088574-79088596 GTCCCAGGGAAGGTTGGTGAAGG - Intronic
1070786335 10:79164284-79164306 GCCACCTGTAAAATGGGTGAAGG + Intronic
1071297001 10:84228546-84228568 GTGCTCTGGAAAGTGGATGTGGG - Intergenic
1072010391 10:91298352-91298374 AGCCCCTGGAAAGTGGGGGAGGG + Intergenic
1072711547 10:97718745-97718767 ATGCCCTGGAAAGGGTGTGAGGG + Intergenic
1073295205 10:102434669-102434691 GGCCCCTAGGAAGGGGGTGATGG + Intergenic
1073722026 10:106183526-106183548 ATGCCCTTGAAAGTGGCTGAGGG + Intergenic
1074325014 10:112441791-112441813 GTGCCCTGGAAGGTGGCTCATGG - Intronic
1074431602 10:113399489-113399511 GTCCCAGGCAAGGTGGGTGACGG + Intergenic
1075326175 10:121533883-121533905 CTCCACTGCAAAGTGGGGGAGGG + Intronic
1076319057 10:129564787-129564809 GTCCCCAGAAAAGAGGCTGAGGG - Intronic
1076385744 10:130053852-130053874 GTCCCTGGGAGAGTGGGGGAAGG + Intergenic
1077320260 11:1937868-1937890 GTGCCCAGGAACGTGTGTGAGGG + Intronic
1079020346 11:16905740-16905762 ATCCCCTGGAATGGGGGTAATGG + Intronic
1080033631 11:27688390-27688412 CTCCCCCGGAAAGGGGCTGAAGG - Intronic
1080262364 11:30363516-30363538 AGCGTCTGGAAAGTGGGTGAAGG + Intergenic
1080262442 11:30364222-30364244 AGCGTCTGGAAAGTGGGTGAAGG - Intergenic
1080416950 11:32077782-32077804 GTGGCCTGGATAGAGGGTGATGG - Intronic
1082795350 11:57374889-57374911 GCCCTGGGGAAAGTGGGTGATGG - Intergenic
1082840058 11:57681938-57681960 GTCCCCTGGCAAGGGGGAGGCGG + Intronic
1084358657 11:68655657-68655679 GTGCCCAGGAACCTGGGTGATGG - Intergenic
1084525328 11:69694330-69694352 GTCACCTTGACAGTGGGGGAGGG + Intergenic
1085799571 11:79576854-79576876 GGCACCTGGAGAGTGGGTGCAGG - Intergenic
1086734074 11:90283860-90283882 GTTCACTGGTACGTGGGTGAGGG + Intergenic
1092641413 12:10514866-10514888 GTAGCCTAGAAAGTGGGTGGGGG - Intronic
1094137489 12:27143902-27143924 TTCAACTGGAAAGTGGATGAGGG - Intergenic
1094151823 12:27293306-27293328 GTCCACTGGAAAGTGGCTGTAGG - Intronic
1094186945 12:27653916-27653938 TTCAACTGGAAAGTGGATGAGGG - Intronic
1095762149 12:45851601-45851623 GTCCCTTGGAAAATGGTTGCTGG - Exonic
1095960121 12:47829069-47829091 GGCCCCAGGCAAGTGGGGGAAGG - Intronic
1096127111 12:49128079-49128101 GTTCACTGGTACGTGGGTGAGGG - Exonic
1096145076 12:49273090-49273112 GTTCACTGGTACGTGGGTGAGGG + Exonic
1099063553 12:77944359-77944381 GTCCAGTTGAATGTGGGTGACGG + Intronic
1099532205 12:83797563-83797585 GATCCCTGAAAAGTGGGAGAAGG - Intergenic
1100000797 12:89832971-89832993 GTCCCCATGAAGGTGGGTGCAGG - Intergenic
1101282327 12:103271136-103271158 GACCCCTGTAAAGTGGGGCATGG + Intronic
1102341638 12:112126202-112126224 GTCCCCAGGAAGGTCGGTGATGG - Intronic
1102413262 12:112738613-112738635 GTCCCCTGGAAGGTGAGTGGTGG + Intronic
1103002217 12:117393857-117393879 GTGCCCTGGAAAGTGACAGAAGG + Intronic
1103187578 12:118973586-118973608 GTAGTGTGGAAAGTGGGTGAGGG + Intergenic
1104766588 12:131333825-131333847 GGCCCCTGGAGGGTGGCTGAGGG + Intergenic
1108504319 13:51097528-51097550 GCCCCATGGAAAGTGTGAGAAGG - Intergenic
1113502375 13:110786752-110786774 CTCCCATGGAAACTGGGAGAGGG + Intergenic
1113504667 13:110806988-110807010 TTCCCCTGGGAAGTGGCTGGAGG + Intergenic
1113766274 13:112882724-112882746 GTGCCCTGGCGAGTGGCTGATGG - Exonic
1114039226 14:18660801-18660823 GTCCCCTGGAATTTGGGGAATGG - Intergenic
1115763799 14:36602202-36602224 GGTCCCTGAAAAGTGGCTGATGG - Intergenic
1117816814 14:59607241-59607263 AGCCCCTGGTCAGTGGGTGAGGG + Intronic
1118247822 14:64128820-64128842 CTCCCCTGGCAAGAGGATGAGGG - Intronic
1119544227 14:75460180-75460202 GACCCCTGGAATGGGGGAGAAGG - Intronic
1120262190 14:82199792-82199814 GCCCCCTGAAAGGTGGCTGATGG + Intergenic
1122320774 14:100854507-100854529 TCTCCCTGGGAAGTGGGTGATGG + Intergenic
1124251659 15:28110181-28110203 GGCCAATGGAAAGTGGGTGGAGG + Intergenic
1125505735 15:40266522-40266544 GTCCACTGGGGAGTGGGTGTAGG + Intronic
1127957604 15:63866449-63866471 TTTCCCTGGAAAGTGGGAAACGG - Intergenic
1128735862 15:70053591-70053613 GTCCCCTGGGAAATGGGGGGGGG + Intronic
1129319971 15:74769074-74769096 GTCCCCAAGACAGTGGGTAAAGG - Intergenic
1130306045 15:82712710-82712732 GAGCCTGGGAAAGTGGGTGAAGG + Intergenic
1130809352 15:87360025-87360047 TTCTCCTGGAGAGTGAGTGATGG - Intergenic
1132556703 16:575765-575787 GTCCCCTGCACAGTGGGGGACGG + Intronic
1133017237 16:2949696-2949718 GTCCCCTGGCAAGTTGGCCACGG + Exonic
1133166244 16:3949603-3949625 GACCCTTGGAAAGTGGGTGGGGG - Intergenic
1133602209 16:7350547-7350569 TTCCTCTGGAAAGTGGGAGGAGG + Intronic
1135589576 16:23695385-23695407 GTCCCCTGGAAAGTGGGTGATGG + Exonic
1136105168 16:28025234-28025256 GTCACCAGGAGAGTGGGTGCAGG + Intronic
1136366228 16:29810468-29810490 GTCCCCTGGACAGTGGGCAGGGG + Exonic
1136456355 16:30381961-30381983 CTCCCCTGGGAAATGGGTGCAGG - Intronic
1136631941 16:31493932-31493954 GTCTCCTGGAAAATGGCAGAGGG + Exonic
1141644738 16:85361450-85361472 GTGGCCTGGAAAGAGGGAGACGG - Intergenic
1142625023 17:1186530-1186552 GGCCCCTGGGAAGTGTGTGGGGG - Intronic
1142686673 17:1581129-1581151 GTTCCCAGGAATGTGGGTGGTGG + Intronic
1143431662 17:6892463-6892485 GTCTCCTGATAAGTTGGTGATGG - Intronic
1145932633 17:28696978-28697000 GTGACCTGGAAAGTCAGTGATGG + Exonic
1147563334 17:41522060-41522082 GGCCCCTGGAATGTGGCTGCGGG - Exonic
1147588333 17:41665772-41665794 GTCACCTGGATGGTGGGTGCGGG + Intergenic
1147877778 17:43633595-43633617 GTCCCCAGGAAAATGGGGTAAGG - Intergenic
1148050792 17:44769174-44769196 GGCCCCTGGAAACTGGGCGACGG - Intronic
1148061696 17:44841144-44841166 GGACCCTGGAAAGTGTGTAATGG - Intergenic
1148205010 17:45774682-45774704 GTCCCAAGGCAAGGGGGTGAAGG - Intergenic
1148667166 17:49383359-49383381 TTCCCATGGAAACTGGGTGGTGG - Intronic
1149095366 17:52833387-52833409 GTCCCCTGGACCCTGGGTGGTGG + Intergenic
1149521137 17:57319027-57319049 GCCCACTGGAAAGTGTGTGTGGG + Intronic
1149867263 17:60157798-60157820 GTTCCCCGGGAAGTGGGGGATGG - Intronic
1150223584 17:63510670-63510692 ATCCTCTGGGAAGAGGGTGAGGG - Intronic
1152942461 17:83180012-83180034 GTCCCCTGGCCAGTCGGGGAAGG - Intergenic
1153589587 18:6659312-6659334 GTCCACTAGGAAGTGGATGAAGG - Intergenic
1153624566 18:7011932-7011954 CTCCCCTGGGAGGTGGGTGGGGG - Intronic
1153959735 18:10130676-10130698 TTCCCCTGGAAATTGGGAAAGGG + Intergenic
1153980070 18:10301245-10301267 GGACCCTGGGAAGTGGGTGGTGG + Intergenic
1153986108 18:10352266-10352288 GTCCTATGGGCAGTGGGTGAGGG + Intergenic
1155551026 18:26965197-26965219 GTCCCCTGGCTGGTGGGTCATGG + Intronic
1156842600 18:41627388-41627410 GTTGCCAGGAAAGTGGGAGAGGG - Intergenic
1159354636 18:67322062-67322084 CTCCATTGAAAAGTGGGTGAAGG - Intergenic
1159515078 18:69448111-69448133 CTCATCTGGAAAGTGGGAGATGG + Intronic
1160733078 19:649897-649919 GGCCCCTGGTGAGTGGGTGGGGG - Intronic
1160733115 19:649989-650011 GGCCCCTGGTGAGTGGGTGGGGG - Intronic
1160733135 19:650035-650057 GGCCCCTGGTGAGTGGGTGGGGG - Intronic
1160733211 19:650219-650241 GGCCCCTGGTGAGTGGGTGGGGG - Exonic
1161025233 19:2033740-2033762 GTCCCCTGGAAAAGGGGCTATGG - Intronic
1162150284 19:8640151-8640173 GGCCCCAGGAAGGTGGGTGAGGG - Intergenic
1162542752 19:11307761-11307783 GACCCCTGCAAAGGGGGTCAGGG + Intronic
1164564807 19:29318189-29318211 GTGCCCTGGAAAGTGACTGTGGG + Intergenic
1164990334 19:32677906-32677928 ATCCCCTGGAATGTGCGTGCTGG + Exonic
1165953290 19:39486671-39486693 GTTCCCTGGAATCTGGGTGTGGG + Intronic
1166069431 19:40378421-40378443 TTGCCCTGGAAAGTGGGGGTGGG - Exonic
1166709441 19:44927286-44927308 ATAGCCTTGAAAGTGGGTGATGG + Intergenic
1166833722 19:45653989-45654011 CTCCCCTGGGAAGTGGGGGCTGG - Intergenic
1166976582 19:46608464-46608486 GTTCCCTGGAAGGTGGGGAAAGG - Exonic
927874820 2:26648279-26648301 CTCCCCAGAAAAGCGGGTGAGGG + Intergenic
930096169 2:47568954-47568976 GGCCCAGGGAAAGTGGGGGATGG + Intronic
932572603 2:72945862-72945884 GGCCTCTGGAGAGTGGGCGAGGG - Intronic
932621817 2:73269268-73269290 GTCGCCGGGGAAGTGGGCGAGGG + Exonic
934780832 2:96968658-96968680 GGCCCCTGGGAGGAGGGTGATGG - Intronic
934858052 2:97741252-97741274 GTCCCCTGGAAGGTGCTTGCAGG + Intergenic
937264224 2:120605990-120606012 GCCCCCAGGAAAGAGGCTGAGGG + Intergenic
938276538 2:130030341-130030363 GTACCTTGAAAAGTGGCTGAAGG + Intergenic
940211599 2:151261403-151261425 GTCGCCTGGGCAGTGGGTGTGGG + Intronic
941003184 2:160222089-160222111 GACACCTGGAAGGTGGTTGAGGG + Intronic
944635656 2:201673906-201673928 GGGCCCTGGAAAGGGGGTAAGGG - Intronic
945807424 2:214507535-214507557 GTCTCCTGGCAAGTCAGTGATGG + Intronic
946366168 2:219250464-219250486 GTGCACTGGTATGTGGGTGAGGG - Exonic
946719647 2:222590757-222590779 GTAGTGTGGAAAGTGGGTGAGGG + Intronic
947460204 2:230297694-230297716 TTCCCCTGGAAAGTGAGTATGGG + Intronic
948599183 2:239098477-239098499 GGCCCCTGGCGAGTGGGTGCCGG - Intronic
948913373 2:241017696-241017718 CTCCCACGGCAAGTGGGTGAAGG + Intronic
1169331639 20:4721228-4721250 GTCCCCTGGACAGGTGGTGCGGG - Intergenic
1173022789 20:39282280-39282302 GTGCCCTGGACAGTTGCTGAAGG - Intergenic
1175264447 20:57694059-57694081 GCCCCCAGGAAAGTGGGAGATGG - Intronic
1178985383 21:37298658-37298680 GTCCCCTGGGAAGGGAGGGATGG + Intergenic
1179729288 21:43358675-43358697 GTGTCCTGGAAGGTGGGTGGGGG + Intergenic
1180163077 21:46006718-46006740 CTCCCCTGTAAGCTGGGTGAAGG + Intergenic
1180844393 22:18973347-18973369 GGGCCCTGGAAGGTGGGGGAAGG + Intergenic
1180938385 22:19641140-19641162 CTTCCCTGGAAAGAGGGTGGTGG - Intergenic
1181029989 22:20145049-20145071 TTCACCTGGAAAGCAGGTGAGGG - Intronic
1181057079 22:20265364-20265386 GGGCCCTGGAAGGTGGGGGAAGG - Intronic
1182335432 22:29580707-29580729 GGGCCCTGGAGAGTGGGAGAGGG - Intronic
1183314708 22:37130441-37130463 ATCCCCTGGGAAGTGGGGGTGGG + Intronic
1183384853 22:37508997-37509019 CTGCCCTGGATGGTGGGTGAGGG - Intronic
1183758982 22:39798785-39798807 GTCCCCTGGGCAGTGTGTGATGG + Intronic
951474232 3:23088136-23088158 ATCCCATCAAAAGTGGGTGAAGG - Intergenic
953772917 3:45792570-45792592 TTTACCTGTAAAGTGGGTGAGGG - Intronic
955215622 3:56982895-56982917 GTCCCTGGGCAGGTGGGTGACGG - Intronic
961473703 3:127134279-127134301 GCCCCCTTGAAAGGAGGTGAGGG - Intergenic
961547991 3:127649295-127649317 GTCCCCTGCCATGTGGGTGCTGG + Intronic
962201722 3:133405610-133405632 TATCCCTGGAAAGTAGGTGATGG + Intronic
962209684 3:133466952-133466974 GTGCCCTGGTAAGTGGGCCAAGG + Exonic
962929214 3:140021997-140022019 GTCACCTGGAAAGATGCTGAAGG + Intronic
963252855 3:143119022-143119044 GTCCTCTGGAATTGGGGTGATGG - Intergenic
965848128 3:172988511-172988533 ATCTCTTGGAAAGTGAGTGAGGG - Intronic
966878798 3:184338275-184338297 GTCTTCTGGAAGGTGGGGGAGGG + Intronic
967422729 3:189291865-189291887 GTCACATAGAAAGTTGGTGATGG + Intronic
967479240 3:189955381-189955403 GTCCCACAGAAAGTGGGTGAAGG - Intergenic
967951121 3:194841523-194841545 TTCCTCAGGGAAGTGGGTGATGG + Intergenic
968953060 4:3704419-3704441 GTCCCCAGGGAAGAGGTTGAGGG - Intergenic
969591090 4:8122307-8122329 GTCCCCTGGGAAATGGAGGATGG - Intronic
971028776 4:22614084-22614106 GTCCCCTGGCTGGTGGGTCATGG + Intergenic
975844199 4:78507736-78507758 GTCCTCTGGAAAGGGGATGATGG - Intronic
984225164 4:177026283-177026305 GTCACCTGGAAAGGAGCTGAAGG + Intergenic
988565183 5:32314952-32314974 GTCACCTGGAAACTGGGATAAGG - Intergenic
992452266 5:76885445-76885467 GTCCCCAGGAAAGTGGGAACGGG + Intronic
992612052 5:78516388-78516410 GTCCCCTGCAAAGTTGGTGTGGG - Intronic
995727930 5:115202369-115202391 CACCCCTGGAAAGTGTGGGAAGG + Intergenic
996119273 5:119652635-119652657 GTTCACTGGTACGTGGGTGAGGG - Intergenic
997698279 5:135878532-135878554 GTCCCTGGGAAAGGGGCTGATGG - Intronic
999147568 5:149406327-149406349 GGCTCCTGGAATCTGGGTGATGG - Intergenic
999242068 5:150133514-150133536 GCACCCAGCAAAGTGGGTGAGGG + Intronic
1002133690 5:177095947-177095969 CTCCTCTGTAAAGTGGGTGGAGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1003129868 6:3386464-3386486 CTTCTCTGGAAAGTGGGGGAGGG + Intronic
1003459465 6:6317068-6317090 GGCCCCCGGAAAGGGGGTGTAGG - Intronic
1003869329 6:10389886-10389908 GTCTCCGAGAAAGGGGGTGAGGG - Intergenic
1005236346 6:23766092-23766114 GTCACATGGAAAATGGATGAAGG + Intergenic
1005962305 6:30703027-30703049 GTGCCCTAGAAAGTGGTGGAAGG - Intronic
1015745682 6:136507167-136507189 CTCCCCAGAAAAGTGGGGGAAGG + Intronic
1016804092 6:148195628-148195650 TTCCCCTGGCAGGTGGGTGGTGG + Intergenic
1019115715 6:169760442-169760464 GACCCTTGGAAAGTGGGGCATGG - Intronic
1019413267 7:915858-915880 GTCTCGTGGAAAGTGGGCGCGGG - Intronic
1019415639 7:925484-925506 GGCCCCTGGAAGGCGGGTGGGGG - Intronic
1020398227 7:7742403-7742425 GGCTGCTGGAAGGTGGGTGACGG + Intronic
1021300997 7:18973003-18973025 GTCTACTGGAAGGTGGGTGGAGG + Intronic
1022449956 7:30505092-30505114 GTCCCATGGACACTGGCTGAAGG + Intronic
1023852179 7:44156693-44156715 GCCCACTGGGAAGTGTGTGAGGG - Intronic
1024626065 7:51209366-51209388 CACCCCTGGGAAGTGGGTGCTGG + Intronic
1025242962 7:57293419-57293441 CTCCCCTGGGAGGTTGGTGAAGG - Intergenic
1029148275 7:98462312-98462334 GTACCCTGGATGGTGAGTGATGG + Intergenic
1029544483 7:101203013-101203035 GTCCCCTGGGAAGAGGATGGTGG + Intergenic
1032012755 7:128357583-128357605 CTCCCTTGGATGGTGGGTGAGGG - Intronic
1032054221 7:128671938-128671960 GTCCCATGGAAGTTTGGTGAGGG + Intergenic
1032415560 7:131732869-131732891 GTGCCCTGGAGAGTGAGTTAAGG + Intergenic
1033207598 7:139436317-139436339 GTTCCCTAGACAGTGGGGGAAGG - Intergenic
1035025150 7:155820257-155820279 CTCCTCTGGAAAGTGGGGAAAGG - Intergenic
1035132720 7:156670362-156670384 ATCCCCTGGAAAGCGGGTCCAGG + Intronic
1035423860 7:158753817-158753839 AGCCCCTGGGAAGTGTGTGAAGG - Intronic
1035526692 8:318384-318406 GTGACCTGGAAGGTGTGTGAGGG - Intergenic
1036182326 8:6596270-6596292 CTCCCCTGGAAGGTAGGGGAGGG + Intronic
1036754614 8:11464065-11464087 GTCCTCTCGAGAGTGGCTGATGG + Intronic
1036797925 8:11769552-11769574 ATTCCCTGGAAAGTGGGTCTAGG - Intergenic
1037754639 8:21702973-21702995 GTTCCCTGGGATGGGGGTGAGGG + Exonic
1038583689 8:28771285-28771307 GTCACCTGGAGAGGGGATGAGGG - Intronic
1039005177 8:33028373-33028395 GGCCCCTGGGAAGTGTGTGCAGG - Intergenic
1040739580 8:50557090-50557112 CTGCCCTGGAAAGTGGGGGTGGG + Intronic
1041255749 8:55978581-55978603 GTCCCCTAGAGAGTGTGGGAAGG + Intronic
1041524797 8:58793156-58793178 GGTTCTTGGAAAGTGGGTGAGGG + Intergenic
1041794445 8:61731591-61731613 AGGCACTGGAAAGTGGGTGAAGG + Intergenic
1048255730 8:132903775-132903797 GTCACCTGGCAAGTGAGTGGTGG - Intronic
1048317038 8:133370112-133370134 TGGCCCTGGAAAGTGGGTCATGG - Intergenic
1048578232 8:135709651-135709673 GTCCCCGGGACACTGGGGGATGG + Intergenic
1049419733 8:142511306-142511328 GACCCCCGGAAAGTGGCTGATGG + Intronic
1049496175 8:142934726-142934748 GTCCACAGGAAACTGGGGGAGGG + Intergenic
1049534038 8:143169793-143169815 GTCCCCTGGAAAGGGGCTGCAGG + Intergenic
1050534760 9:6622272-6622294 GGCCCGTGGAAAGAGGGAGAGGG - Intronic
1051752951 9:20363308-20363330 GTTCCCTGTAAAGTGTGTGTAGG + Intronic
1051896321 9:21993665-21993687 CTCTCCTGGAAGGTGGGAGAGGG + Intronic
1055701458 9:78949331-78949353 GTCACTTTGAAACTGGGTGATGG + Intergenic
1056285532 9:85083872-85083894 CTCCCCTGAAAACAGGGTGAAGG - Intergenic
1056648293 9:88434494-88434516 TTCCACTGGAAAGTCAGTGATGG + Intronic
1057426349 9:94953136-94953158 TTCCCCCAGACAGTGGGTGATGG + Intronic
1057694143 9:97311583-97311605 GGCCCATGGAATTTGGGTGAGGG - Intronic
1057915687 9:99053469-99053491 CTCCCCTGGAAGGAGGGGGAGGG + Intronic
1059331876 9:113540718-113540740 CTCCCGAGGAAAGGGGGTGATGG - Intronic
1059760002 9:117328842-117328864 ATCCCCTATAGAGTGGGTGACGG + Intronic
1060551704 9:124488607-124488629 GACCCCTGGGAAGTGTGTGTCGG - Intronic
1060733056 9:126050011-126050033 GTCCCCTGGGACGGGGGTGGGGG + Intergenic
1061025153 9:128043648-128043670 GTCCCCAGCAGAGTGGGTGGAGG - Intergenic
1061623704 9:131827963-131827985 GTCACCTGGGAACTGGGGGACGG + Intergenic
1062239089 9:135526326-135526348 CTGCCCTGGAAAGGGGGGGAGGG - Intronic
1185732844 X:2475051-2475073 TTCCCTAGGAATGTGGGTGAGGG + Intronic
1187500939 X:19838246-19838268 GTGTCCTGGAGACTGGGTGAAGG - Intronic
1189860370 X:45265167-45265189 GTGCCCAGGATAGGGGGTGATGG + Intergenic
1191172133 X:57458980-57459002 CTCCCCTGGAAAGAGGGAAAGGG + Intronic
1191962957 X:66723905-66723927 GCCCCATAAAAAGTGGGTGAAGG + Intergenic
1192213556 X:69142751-69142773 GCCCCCTGGAAAATGGGTAAGGG + Intergenic
1193440676 X:81536405-81536427 GTCCCAGGGAAAGGGGGTCAGGG + Intergenic
1195736785 X:108019806-108019828 GTTCCCTGGAAACTGTGTGAAGG - Intergenic
1195861636 X:109389246-109389268 GTCCCCTGCAAAGCAGTTGAGGG - Intronic
1196191227 X:112796781-112796803 GTCCCCTGGATAGTTGGGCATGG - Intronic
1196708633 X:118739642-118739664 ATCCCCCAGAAACTGGGTGATGG - Intronic
1197267752 X:124393700-124393722 GTCCCCTAAAAGCTGGGTGAAGG - Intronic