ID: 1135590313

View in Genome Browser
Species Human (GRCh38)
Location 16:23700599-23700621
Sequence TCCGGCTGGCCCCCGAGTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135590310_1135590313 -9 Left 1135590310 16:23700585-23700607 CCTCTTCTGGCTCCTCCGGCTGG 0: 1
1: 0
2: 1
3: 22
4: 257
Right 1135590313 16:23700599-23700621 TCCGGCTGGCCCCCGAGTGCAGG 0: 1
1: 0
2: 1
3: 6
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135590313 Original CRISPR TCCGGCTGGCCCCCGAGTGC AGG Exonic
900315985 1:2056529-2056551 TCCGCCTGGCCCGTCAGTGCAGG + Exonic
902641416 1:17768661-17768683 TCCGGCTGGGCCTCTAGGGCTGG + Intronic
904600660 1:31670975-31670997 TCCACCTGTCCCCCGAGTGGGGG + Intronic
919451212 1:197775179-197775201 TCCGTCCGGCCCCCGCGCGCTGG + Exonic
919820542 1:201469255-201469277 TCCGGCAGGGCCCCGGGGGCGGG + Intergenic
920021166 1:202957916-202957938 CCCGGCTGTCCCCCGACTCCCGG - Intronic
920093031 1:203467766-203467788 TCCTGCTGGGGCCAGAGTGCAGG + Intergenic
920171491 1:204074761-204074783 TCCGGGAGGACCCCGAGCGCTGG + Intronic
920351995 1:205343699-205343721 TCCATCTGGCTCCCGAGCGCCGG + Exonic
920704921 1:208243907-208243929 TCCGGGTGCCCCCTGAGAGCCGG - Exonic
922831598 1:228557191-228557213 ACCGCCTGGCCCCCGTGTTCTGG - Intergenic
922832075 1:228609173-228609195 ACCGCCTGGCCCCCGTGTTCTGG - Intergenic
922833196 1:228613655-228613677 ACCGCCTGGCCCCCGTGTTCTGG - Intergenic
922834314 1:228618137-228618159 ACCGCCTGGCCCCCGTGTTCTGG - Intergenic
922835425 1:228622571-228622593 ACCGCCTGGCCCCCGTGTTCTGG - Intergenic
922836541 1:228627053-228627075 ACCGCCTGGCCCCCGTGTTCTGG - Intergenic
922837660 1:228631536-228631558 ACCGCCTGGCCCCCGTGTTCTGG - Intergenic
922838218 1:228633776-228633798 ACCGCCTGGCCCCCGTGTTCTGG - Intergenic
922838777 1:228636001-228636023 ACCGCCTGGCCCCCGTGTTCTGG - Intergenic
922839336 1:228638242-228638264 ACCGCCTGGCCCCCGTGTTCTGG - Intergenic
922839897 1:228640473-228640495 ACCGCCTGGCCCCCGTGTTCTGG - Intergenic
922841020 1:228644945-228644967 ACCGCCTGGCCCCCGTGTTCTGG - Intergenic
923157264 1:231289805-231289827 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
924421876 1:243917351-243917373 TCCCGCGGGCCCCCGAGGCCGGG + Intergenic
924799052 1:247313897-247313919 TCCGGATGGCCACCAAGTGCAGG + Intronic
1064218161 10:13417694-13417716 TCTGGTTGGTCCCCGAGGGCAGG + Intergenic
1067443549 10:46326723-46326745 GCCGACTGGACCCAGAGTGCAGG - Intronic
1073196245 10:101694543-101694565 TCCGGCAGGCGCCAGAGCGCAGG + Exonic
1077250452 11:1558478-1558500 CACGGCTGGCCTCCGACTGCAGG + Intronic
1077305354 11:1866508-1866530 TCCGGCTGTCACCTGAGTTCAGG + Exonic
1077968836 11:7166127-7166149 TCAGGCAGGCCCCAGAGTCCAGG + Intergenic
1079296914 11:19241973-19241995 TCCGGCTGGAGTCCGAGGGCAGG - Intergenic
1083180042 11:60979367-60979389 TCCTGCTGGCCCCAAGGTGCAGG - Intronic
1086397778 11:86433851-86433873 TCCAGCTGGCCCACAAGCGCCGG + Intergenic
1088658647 11:112025647-112025669 TGCGGCTGGACCCCCAGTTCTGG + Exonic
1091034548 11:132221483-132221505 TCGGTCTGTCCCCAGAGTGCAGG + Intronic
1095234333 12:39778365-39778387 TACAGCTGGCCCCCAAGAGCTGG - Intronic
1095446356 12:42286889-42286911 TCCGTCTGTTCCCCGAGGGCCGG - Intronic
1096647712 12:53047522-53047544 TCTGGCTGGCCGCGGAGAGCTGG + Intronic
1098515964 12:71376888-71376910 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
1102534414 12:113570013-113570035 TCCGGCTGCTCCCAGAGAGCAGG - Intergenic
1108601153 13:51996397-51996419 TCCTTCTGGTCCCCGAGTGGTGG - Intronic
1113785452 13:113000008-113000030 GCCGGCAGGCCCCAGAGTGGAGG + Intronic
1114625855 14:24129799-24129821 TCAGGCTGGTCCCAAAGTGCTGG + Intronic
1116452327 14:45080467-45080489 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1122270094 14:100565119-100565141 CCCGGTTGGCCCTCCAGTGCCGG - Intronic
1122780952 14:104143302-104143324 TCCGGGTGGCCCCTGTGTACAGG + Intronic
1123035922 14:105471927-105471949 TCGGGCTTGCCTCCCAGTGCTGG + Intergenic
1126974429 15:54158897-54158919 CCCGCCTGGCCCCGAAGTGCTGG + Intronic
1129810722 15:78507724-78507746 TCGGGGTCGCCCCCGAGGGCAGG + Intronic
1130963685 15:88681852-88681874 TGTGGCCGGCCCCCGAGGGCGGG + Intergenic
1132679290 16:1133141-1133163 TCGGGCTGGCCTCTGGGTGCTGG + Intergenic
1132820820 16:1869365-1869387 TCCGGCCGCCCCCAAAGTGCTGG + Intronic
1133823758 16:9259535-9259557 TCCTTCTGGCTCCCGAATGCAGG + Intergenic
1133868586 16:9667250-9667272 CCTGGCTGGCCCCCGAATGGTGG + Exonic
1134074561 16:11281463-11281485 GCGGGCAGGCCCCCGAGTGTAGG + Intronic
1135590313 16:23700599-23700621 TCCGGCTGGCCCCCGAGTGCAGG + Exonic
1136154561 16:28374379-28374401 TCCGCCTGGGCCCCGAGGGAAGG + Intergenic
1136208530 16:28740885-28740907 TCCGCCTGGGCCCCGAGGGAAGG - Intergenic
1136264618 16:29107551-29107573 TCCGCCTGGGCCCCGAGGGAAGG - Intergenic
1136561609 16:31042373-31042395 TCCCGGTGGCCCTGGAGTGCAGG + Intronic
1137423803 16:48359473-48359495 TCCGCCTGCCTCCCAAGTGCTGG - Intronic
1139433422 16:66923329-66923351 TCCGGAAGGCCCCAGAGGGCTGG - Intronic
1141465768 16:84204911-84204933 TCCAGCTGGTCCGCAAGTGCCGG + Intergenic
1142226641 16:88880859-88880881 CCTGGCTGGGCCCTGAGTGCAGG + Intronic
1144519714 17:15945602-15945624 TCCGACGGGGCCCCGAGTTCGGG - Intronic
1146941788 17:36848377-36848399 TCCCGCAGCCCACCGAGTGCAGG - Intergenic
1148991222 17:51668803-51668825 TCGCGCTGGCCCACGAGTGCAGG - Intronic
1150359550 17:64519283-64519305 TCAGGCTGGGCCCTGAGTGAAGG + Intronic
1150612816 17:66747880-66747902 TCAGGGTGCCCCCCGAGTGCTGG + Intronic
1151656129 17:75496851-75496873 TTCAGCTGGCCCCTGAGTGAAGG - Intronic
1156454841 18:37287117-37287139 TCGGGCTGGCCCCCGAGATACGG + Intronic
1157099882 18:44719750-44719772 TCTGGCTGGGCCCTGATTGCAGG + Intronic
1160673917 19:378535-378557 TCCAACTCTCCCCCGAGTGCGGG - Intergenic
1161861515 19:6801677-6801699 TCCGGCCGGCTCCCTGGTGCTGG + Intronic
1163746586 19:19052393-19052415 TGCTCCTGGCCCCTGAGTGCTGG - Intronic
1163815484 19:19462379-19462401 TGGGGCCAGCCCCCGAGTGCAGG - Intronic
928595580 2:32856214-32856236 TTAGGCTGGCCCCAAAGTGCAGG - Intergenic
929070023 2:38020543-38020565 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
933254692 2:80067749-80067771 TCTGGCTGTCCCCAGAGTGAGGG - Intronic
936267428 2:111021268-111021290 TGCAGCTGGCCCCCGAATCCGGG + Intronic
942317630 2:174709897-174709919 TCCAGCTGGCCCGCAAGCGCGGG + Intergenic
947411959 2:229850749-229850771 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
947808406 2:232983885-232983907 TCCAGCTGGGCCCCGAGTCCGGG + Intronic
948800134 2:240429735-240429757 TCTGGCTGGCCCACCCGTGCTGG - Intergenic
1174135263 20:48374863-48374885 TCCTGCTGGTCCCCGGGTTCTGG - Intergenic
1175200065 20:57270612-57270634 GCCTGCTGGCCTCCCAGTGCTGG + Intergenic
1175715748 20:61253199-61253221 TCCGGCGGGGCCCCGGGGGCTGG + Intronic
1175895030 20:62332404-62332426 TCACGCTGGCCTCCGAGTCCAGG + Exonic
1178104143 21:29299290-29299312 CCGGGCTGGCGCCCGAGGGCAGG - Intronic
1179888534 21:44324774-44324796 TCCTGCTGGCCCCGGATCGCCGG + Intronic
1180650114 22:17370020-17370042 TCCTCCTGGCCCCCGACTCCCGG - Intronic
1181491519 22:23263205-23263227 TCCGGCAGGCGCCAGAGCGCTGG - Intronic
1181535089 22:23537674-23537696 TCCCGCTGGGTCCCGGGTGCTGG - Intergenic
1182933738 22:34200014-34200036 TGCTGCTGGTCCCTGAGTGCTGG + Intergenic
1183457685 22:37931686-37931708 TCCTGCTGGCCCTGGAGTGCTGG + Intronic
949769961 3:7568629-7568651 TCCAGCTGGCCCGCAAGCGCCGG - Intronic
952840501 3:37641504-37641526 TGCGGCTGGCTCCCGAGTTCTGG - Intronic
953002857 3:38951183-38951205 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
960148153 3:114225405-114225427 TCCTGCTGGCCCCTGAGGGTTGG + Intergenic
960282104 3:115791593-115791615 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
961965066 3:130894003-130894025 CGCGGCTGGCCCAGGAGTGCGGG + Intronic
964801668 3:160565138-160565160 TCCGCCGGGACCCCGAGTGTGGG - Intronic
966807631 3:183819230-183819252 TCCTCCTGGCACCCCAGTGCTGG - Intronic
969052424 4:4382713-4382735 GCCGGCTGGTCCCAGCGTGCCGG + Intronic
969704995 4:8786841-8786863 TCCGCCTGGCCCTCTGGTGCAGG + Intergenic
973199300 4:47481738-47481760 CCAGGCTGGCCCCAGAGTTCTGG - Intergenic
978407803 4:108398422-108398444 TCCGGCTGCTGCCAGAGTGCTGG - Intergenic
978514592 4:109557489-109557511 GCCGGCCGCCCTCCGAGTGCGGG - Intergenic
979553722 4:122021108-122021130 CACGCCGGGCCCCCGAGTGCCGG - Intergenic
981146806 4:141333522-141333544 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
984928599 4:184827060-184827082 TCAGGCTGCCCCCAGAGTGTGGG + Intergenic
985683925 5:1271805-1271827 CCCAGCTGGCCCCTCAGTGCTGG - Intronic
986305239 5:6509455-6509477 TCCGGGTGACCCCCAAGTACAGG + Intergenic
986912420 5:12574273-12574295 TCCAGCTGGCCCGCAAGCGCCGG + Intergenic
993822003 5:92631365-92631387 TCCAGCTGGCCCGCAAGCGCCGG - Intergenic
1002501682 5:179651165-179651187 TCCCACAGGCCCCCGAGTGGTGG - Intergenic
1006518363 6:34556919-34556941 GCTGGCTGGCCCCCGATTACGGG - Intergenic
1010141473 6:72619929-72619951 CGCGGCTGGGCCCCGCGTGCAGG - Intergenic
1010235572 6:73572478-73572500 TCCACCTGCCCCCCCAGTGCGGG - Intergenic
1018551359 6:165001912-165001934 TCGTGCTGGCCCGCGAGCGCTGG + Intergenic
1019298644 7:291644-291666 TCCGCCTGTCCCCCCAGTCCAGG - Intergenic
1021731203 7:23597346-23597368 GGCGGCTGGCCCCCGAGTGCGGG + Intergenic
1028392751 7:90334827-90334849 TCCCGCTGGGACCCTAGTGCGGG + Intergenic
1033241018 7:139680238-139680260 TCCTCCTGTCCCCCGACTGCAGG + Intronic
1034632168 7:152539188-152539210 TCCAGCTGGCCCGCAAGCGCTGG + Intergenic
1035482540 7:159198836-159198858 TCCCACTGTCCCCCAAGTGCGGG + Intergenic
1037813947 8:22102269-22102291 TCAGCCTGGCCCCCGGCTGCAGG + Exonic
1039845339 8:41321696-41321718 TTGGGCTGGCCCCTGAGTGTGGG - Intergenic
1049236676 8:141515599-141515621 TGGGGCTGGCCCTCGAGGGCAGG - Intronic
1049566388 8:143341314-143341336 TCCGGCTGGGCACCGCCTGCAGG + Intronic
1049781197 8:144429755-144429777 CCAGGAAGGCCCCCGAGTGCTGG - Intronic
1056731056 9:89167098-89167120 TCCTGCTGGACCCCCAGGGCAGG - Intronic
1060634595 9:125189898-125189920 TCTGGCTGAACCCCGACTGCAGG + Exonic
1061245485 9:129399369-129399391 TCCCGCTGGGTCCCGGGTGCTGG + Intergenic
1061245789 9:129400805-129400827 TCCGGGTGGCCACCGCTTGCAGG - Intergenic
1061883592 9:133579819-133579841 TCTGGATGGCCCTGGAGTGCAGG + Intronic
1062204482 9:135328604-135328626 TCCAGCTGGCCCCCAACTGTGGG - Intergenic
1062220708 9:135413649-135413671 TCCGGCTGGACCCTGTGGGCTGG - Intergenic
1199991647 X:152990679-152990701 TCCAGCTTGCCCCTGAGGGCGGG + Exonic
1200111429 X:153742925-153742947 CCCGGCTGGCCCCCGGGTCTGGG + Intronic