ID: 1135594002

View in Genome Browser
Species Human (GRCh38)
Location 16:23727640-23727662
Sequence GTGGTGGCGGCCATCTGTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135594002_1135594009 20 Left 1135594002 16:23727640-23727662 CCGATACAGATGGCCGCCACCAC No data
Right 1135594009 16:23727683-23727705 TTTGTATTTTTAGTAGAGACGGG 0: 164005
1: 210050
2: 126715
3: 67031
4: 60843
1135594002_1135594008 19 Left 1135594002 16:23727640-23727662 CCGATACAGATGGCCGCCACCAC No data
Right 1135594008 16:23727682-23727704 TTTTGTATTTTTAGTAGAGACGG 0: 194929
1: 143151
2: 66814
3: 37831
4: 46551
1135594002_1135594010 21 Left 1135594002 16:23727640-23727662 CCGATACAGATGGCCGCCACCAC No data
Right 1135594010 16:23727684-23727706 TTGTATTTTTAGTAGAGACGGGG 0: 98173
1: 216399
2: 153384
3: 81062
4: 60801

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135594002 Original CRISPR GTGGTGGCGGCCATCTGTAT CGG (reversed) Intergenic
No off target data available for this crispr