ID: 1135606557

View in Genome Browser
Species Human (GRCh38)
Location 16:23831057-23831079
Sequence AAGGTGAGCCTACTAGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135606557_1135606564 30 Left 1135606557 16:23831057-23831079 CCATTGTCTAGTAGGCTCACCTT No data
Right 1135606564 16:23831110-23831132 TTTATTTTTTCCCTTTGAAGGGG No data
1135606557_1135606558 -8 Left 1135606557 16:23831057-23831079 CCATTGTCTAGTAGGCTCACCTT No data
Right 1135606558 16:23831072-23831094 CTCACCTTCTGATCATTCTCTGG No data
1135606557_1135606563 29 Left 1135606557 16:23831057-23831079 CCATTGTCTAGTAGGCTCACCTT No data
Right 1135606563 16:23831109-23831131 GTTTATTTTTTCCCTTTGAAGGG No data
1135606557_1135606559 -7 Left 1135606557 16:23831057-23831079 CCATTGTCTAGTAGGCTCACCTT No data
Right 1135606559 16:23831073-23831095 TCACCTTCTGATCATTCTCTGGG No data
1135606557_1135606561 7 Left 1135606557 16:23831057-23831079 CCATTGTCTAGTAGGCTCACCTT No data
Right 1135606561 16:23831087-23831109 TTCTCTGGGACAGTTTCTGTTGG No data
1135606557_1135606562 28 Left 1135606557 16:23831057-23831079 CCATTGTCTAGTAGGCTCACCTT No data
Right 1135606562 16:23831108-23831130 GGTTTATTTTTTCCCTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135606557 Original CRISPR AAGGTGAGCCTACTAGACAA TGG (reversed) Intergenic
No off target data available for this crispr