ID: 1135607287

View in Genome Browser
Species Human (GRCh38)
Location 16:23835864-23835886
Sequence TGTAAAGCAGCTGGCAGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607281_1135607287 1 Left 1135607281 16:23835840-23835862 CCCGCGGTAGCCCGGGCGCCGAT 0: 1
1: 0
2: 0
3: 4
4: 22
Right 1135607287 16:23835864-23835886 TGTAAAGCAGCTGGCAGCGCTGG 0: 1
1: 0
2: 1
3: 13
4: 140
1135607283_1135607287 -9 Left 1135607283 16:23835850-23835872 CCCGGGCGCCGATATGTAAAGCA 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1135607287 16:23835864-23835886 TGTAAAGCAGCTGGCAGCGCTGG 0: 1
1: 0
2: 1
3: 13
4: 140
1135607282_1135607287 0 Left 1135607282 16:23835841-23835863 CCGCGGTAGCCCGGGCGCCGATA 0: 1
1: 0
2: 0
3: 1
4: 14
Right 1135607287 16:23835864-23835886 TGTAAAGCAGCTGGCAGCGCTGG 0: 1
1: 0
2: 1
3: 13
4: 140
1135607284_1135607287 -10 Left 1135607284 16:23835851-23835873 CCGGGCGCCGATATGTAAAGCAG 0: 1
1: 0
2: 0
3: 1
4: 17
Right 1135607287 16:23835864-23835886 TGTAAAGCAGCTGGCAGCGCTGG 0: 1
1: 0
2: 1
3: 13
4: 140
1135607278_1135607287 9 Left 1135607278 16:23835832-23835854 CCGCGAGGCCCGCGGTAGCCCGG 0: 1
1: 0
2: 1
3: 1
4: 94
Right 1135607287 16:23835864-23835886 TGTAAAGCAGCTGGCAGCGCTGG 0: 1
1: 0
2: 1
3: 13
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135607287 Original CRISPR TGTAAAGCAGCTGGCAGCGC TGG Intergenic
901400919 1:9014725-9014747 TGGAGAGGAGCTGCCAGCGCAGG + Exonic
907422807 1:54358528-54358550 TGTCAAGCAGCTGGAAGCCCTGG - Intronic
907489307 1:54799013-54799035 TCTAAAGCACCTGGCAGAGTAGG - Intronic
909931564 1:81504155-81504177 TGTGAAGCAGGTGCCAGGGCTGG - Intronic
909969802 1:81968100-81968122 TGTCAACCAGCTTGCAGCCCTGG - Exonic
910784922 1:90986118-90986140 TTAAAAGCAGTTGGCACCGCTGG + Intronic
911431716 1:97797569-97797591 TGTTAAGCTGTTGGCAGCTCAGG - Intronic
911734277 1:101320422-101320444 TGAAAATTAGCTGGCAGCGTTGG - Intergenic
911956318 1:104240069-104240091 TGTATTTCAGCTGGCAGAGCAGG + Intergenic
912246234 1:107964725-107964747 TGTTAAGCAGCTGGCAGAGCAGG + Exonic
912770418 1:112458902-112458924 TGTAAAACAGCTGGGAGCAGTGG + Exonic
917443289 1:175085381-175085403 TGGAAACAAGCAGGCAGCGCAGG - Intronic
918302671 1:183218406-183218428 TGTGACCCAGCTGGCATCGCAGG + Exonic
918596698 1:186302551-186302573 TCTAAAGAAGCAGGAAGCGCAGG - Intronic
920043218 1:203117258-203117280 AGTAAAGGAGCTGGAAGCCCGGG + Intronic
923066130 1:230518980-230519002 TGTAAAGAAGCTGCCAAGGCCGG + Intergenic
923546729 1:234928769-234928791 TGTAAATCAGCTGCCGGGGCAGG + Intergenic
1066084268 10:31961322-31961344 AGTCAAGGAGCTGGCAGAGCTGG + Intergenic
1067713434 10:48668451-48668473 TGAGAAGCAGCTGGTAGGGCAGG - Intergenic
1072220872 10:93326596-93326618 TTTACAGCAGCTGGCATCACTGG + Intronic
1074076574 10:110132048-110132070 TGCACAGCTGCTGGCAGCCCAGG - Intronic
1077049992 11:562293-562315 TGTAAAGCCACGGGCTGCGCTGG + Exonic
1078364791 11:10697621-10697643 TGTAAAGTGGCTGACAGTGCTGG - Intergenic
1083581920 11:63830493-63830515 TGGAAGGCAGCTGGGAGGGCAGG - Intergenic
1083794076 11:65004503-65004525 TGGAAGGCAGATGGCAGTGCTGG - Intergenic
1085231579 11:74976026-74976048 AGTAAAGCAGTTGGCATCCCTGG + Intronic
1086810358 11:91302161-91302183 TGAAAAGCAGAGGGCAGGGCAGG + Intergenic
1087777287 11:102268184-102268206 TGGAGAGCAGCTTCCAGCGCAGG + Intergenic
1089282760 11:117385982-117386004 TGGAAAGCAGCGGGCAGGACCGG - Intronic
1092244434 12:6855731-6855753 TGTAAAGAAGCAGGAAGGGCTGG - Intronic
1095704811 12:45225062-45225084 TCCAAAGCAGCTGGCACCACAGG - Intronic
1096403286 12:51324450-51324472 TGCAAAGCAACTGCCACCGCAGG + Intronic
1096756575 12:53804558-53804580 AGTAAAGCAGCTGCCAAAGCTGG + Intergenic
1097802863 12:63934311-63934333 TCAAAAGCAGCTGGCAGTACGGG - Intronic
1098873701 12:75845023-75845045 TGTAAAGAAGCTGGCCCCGCTGG + Intergenic
1102116040 12:110403635-110403657 TGCAAAGCCGCGGGCAGCGGCGG + Exonic
1104388093 12:128368210-128368232 TGCATAGCAGCTTGCAGCTCAGG + Intronic
1108033004 13:46256447-46256469 TGGAAAGCAGGTGGCAGAGCTGG + Intronic
1112381096 13:98891059-98891081 TGTGAAGCAGCTCACACCGCAGG - Intronic
1113075883 13:106467848-106467870 TGTAAAGGAGCTGTCAGGCCGGG - Intergenic
1117814524 14:59583254-59583276 AGGGAAGCAGCTGGCAGCTCCGG - Intergenic
1120712744 14:87809763-87809785 TGTATAGCAACTGGCTGGGCAGG - Intergenic
1121022600 14:90590235-90590257 TACAAAGCAGCTGGCGGCACAGG + Intronic
1122831115 14:104396372-104396394 TGAAAAGCAGCGGGGAGAGCAGG - Intergenic
1124813511 15:32965611-32965633 TTTAAAACAGTTGGCAGCCCTGG + Intronic
1125722666 15:41852666-41852688 AGAAAAGCTGCTGGCAGCCCAGG - Exonic
1126990230 15:54366283-54366305 TGTAAAGAAGCTGGCAGCTTGGG + Intronic
1129108803 15:73325625-73325647 TGCCAAGCAGCTGGGAGCCCGGG - Intronic
1129295227 15:74596461-74596483 TGTGAAGCAGGTGCCAGGGCTGG - Exonic
1129334401 15:74843573-74843595 TGAAAAGCAGCTGGGAGGCCTGG - Intergenic
1133233053 16:4375303-4375325 TGTGGACCAGCTGGCAGGGCTGG - Intronic
1133876618 16:9740859-9740881 AGTAAAGCAGGAGGCAGAGCTGG + Intergenic
1134685341 16:16154656-16154678 TGTACTGCAGCTGGCCGGGCAGG + Exonic
1135254540 16:20930566-20930588 TGTAAAGGAGCTGTCAGTGAGGG - Intergenic
1135607287 16:23835864-23835886 TGTAAAGCAGCTGGCAGCGCTGG + Intergenic
1136504867 16:30696637-30696659 TATAAAGCAGCTGGGGGCGGTGG + Intergenic
1138093129 16:54193005-54193027 TGTGAGGCAGTTGGCAGCCCAGG - Intergenic
1139589856 16:67927612-67927634 TGTATTGCTGCTGGTAGCGCAGG - Exonic
1141227010 16:82127329-82127351 AGTAAAGCAGCTTGCATAGCAGG - Intergenic
1144578500 17:16444624-16444646 TGTAAGACAGCAGGCAGGGCAGG + Intronic
1144949398 17:18985811-18985833 TGGAAGGCAGCTGGCACTGCAGG - Intronic
1145082428 17:19905805-19905827 TGTAAAGCAGGTGCCAGAGGTGG - Exonic
1149825773 17:59826616-59826638 TGTAAAGCATCTGGCACAGTGGG - Intronic
1150452909 17:65284097-65284119 CCTAAAGCATCTGGCAGAGCTGG - Intergenic
1151495298 17:74454802-74454824 CCTGAAGCAGCTGGCAGCGCCGG - Intergenic
1152479208 17:80538664-80538686 GGCAAAGCAGCTGGGAGAGCAGG - Intergenic
1156570287 18:38244757-38244779 TGGGAAGCAGCAGGCAGGGCAGG + Intergenic
1157971436 18:52274117-52274139 TATAAAGCATCTTGCAGCCCTGG - Intergenic
1166405088 19:42514693-42514715 TGTAAAGCATTTAGCAGCACAGG - Intronic
1167684460 19:50947594-50947616 TGCAAAGCTGCTGGAAGGGCTGG - Intronic
1168646331 19:58061278-58061300 TGTTAAGCAGCTGGGACCACGGG + Intronic
925029489 2:638112-638134 TGTACAGCAGATGGCTGTGCTGG + Intergenic
927680734 2:25137337-25137359 TGTAGAGCTGCTGGGAGTGCTGG - Exonic
932246048 2:70197428-70197450 TGTATACCAGCTGGGAGCGGTGG - Intronic
932948401 2:76264509-76264531 AGCCAAGCAGCTGGCAGCCCAGG - Intergenic
934216831 2:90038828-90038850 TGCAAAGCAGCTGGGGGGGCGGG - Intergenic
935139491 2:100340125-100340147 TGTGCAGCTGCTGGCAGAGCTGG - Intergenic
938551433 2:132385990-132386012 TGTGAAGTAGCTGCCAGGGCAGG + Intergenic
938675102 2:133624733-133624755 TGTAAAGCGGCTGTTAGGGCAGG - Intergenic
939849276 2:147284556-147284578 AGTAAAGCAGGTGGCAGAGCAGG - Intergenic
944907291 2:204275192-204275214 TGTAAATGAGCTGGCATGGCTGG - Intergenic
944959918 2:204860538-204860560 TGTATACAAGCTGGCAGCACTGG - Intronic
948155281 2:235776572-235776594 TGTAAGGCAGTGGGCAGTGCAGG + Intronic
948405548 2:237715688-237715710 CGCAAAGCAGCTGGCTGGGCCGG - Intronic
1170567343 20:17614623-17614645 CGTCAAGCTGCTGGGAGCGCTGG - Intronic
1173713015 20:45176725-45176747 TGAAAAGGAGCTGGCAGCACTGG - Intergenic
1174072055 20:47906167-47906189 TGTCCAGCAGCTGGCAGGGCAGG - Intergenic
1174090291 20:48041575-48041597 TGGGAAGCACGTGGCAGCGCAGG - Intergenic
1174147195 20:48460159-48460181 TGTCCAGCAGCTGGCAGGGCGGG + Intergenic
1174151987 20:48492502-48492524 TGTCCAGCAGCTGGCAGGGCAGG + Intergenic
1176304114 21:5114442-5114464 TGTGGAGCAGCTGGGAGTGCTGG + Intergenic
1179674331 21:42971858-42971880 GGCAAAGCAGCTGGCAGAGAAGG + Intergenic
1179773683 21:43644754-43644776 TGAAAAGCAGAAGGCAGCTCAGG + Intronic
1179852942 21:44147588-44147610 TGTGGAGCAGCTGGGAGTGCTGG - Intergenic
951646658 3:24899390-24899412 TCTGAAGGAGCTGGAAGCGCTGG - Intergenic
953223931 3:40999317-40999339 TGCCCAGCAGCTGGAAGCGCCGG + Intergenic
954381590 3:50221758-50221780 TGCAAGGCAGCTGCCAGCTCGGG + Intergenic
954686338 3:52372214-52372236 TGCACAGCACCTGGCAGAGCGGG - Exonic
961551198 3:127671570-127671592 TCTACAACTGCTGGCAGCGCCGG + Exonic
963688576 3:148470103-148470125 TGTACAGCAGCTTGAAGTGCTGG - Intergenic
964213440 3:154253294-154253316 TGTAAAGCAGAAGGAAGCCCTGG - Intronic
964337508 3:155671644-155671666 AGTAATCCAGCTGGCAGAGCAGG + Intronic
964415490 3:156443581-156443603 TGTAAAGCACCTAGCACCGAAGG + Intronic
964607500 3:158572910-158572932 TGGAAAGCAGCAGGCACCCCGGG - Intronic
965112250 3:164442622-164442644 TGTAAAGTAGCTTTCAGCGTAGG + Intergenic
965192543 3:165549895-165549917 TTCAAAGCAGCTGGCACCACGGG + Intergenic
965511917 3:169577345-169577367 TATAAAGCAGCTTGCAGCACAGG - Intronic
965757765 3:172041746-172041768 TGGATAGCAGCCGGGAGCGCTGG + Intronic
966934453 3:184696762-184696784 TGTGAAAGAGCTGGCAGAGCTGG - Intergenic
967751779 3:193123394-193123416 TGTAACGCAGCTGGGAGCTGAGG + Intergenic
973932114 4:55803562-55803584 TGGAAAGGAGCTGGCAGCCCTGG + Intergenic
974188977 4:58478054-58478076 TGTAAAGCATCAGCCAGGGCTGG - Intergenic
975909059 4:79247129-79247151 TGAAAAACAGATGGCAGGGCTGG + Intronic
977071033 4:92388080-92388102 TTTTAAGCAGCAGGCAGTGCTGG - Intronic
978496885 4:109368863-109368885 TGAAGAGCAGCTGGCAGCCTGGG - Intergenic
989102840 5:37837273-37837295 CGTAAAGCAGTTTGCACCGCGGG - Intronic
991777313 5:70097741-70097763 TTTAAAACAGCTGGGAGCGGTGG - Intergenic
991856601 5:70973185-70973207 TTTAAAACAGCTGGGAGCGGTGG - Intronic
993278810 5:85898401-85898423 TGGAAAGCAGATGGAAGAGCGGG - Intergenic
999228853 5:150049627-150049649 TGAGAAGCAGCTGACAGCACGGG + Intronic
1000245081 5:159442391-159442413 TGTTAAGCCGCTGAGAGCGCAGG - Intergenic
1002952576 6:1829560-1829582 TGTAAAGTAGCTGGGAACACAGG + Intronic
1004607486 6:17207424-17207446 TGAAAGTCAGCTGGCAGGGCTGG - Intergenic
1006734902 6:36266623-36266645 TGTAAAGCAGCTGAAAGGCCTGG - Intronic
1010854129 6:80815644-80815666 GGCAGAGCAGCTGGCAGAGCAGG + Intergenic
1011047531 6:83102049-83102071 TTTAAAGCTGCTGCCAGCACTGG - Intronic
1013200892 6:107894883-107894905 TAAAAAGCAGGTGGCAGGGCAGG - Intronic
1013401391 6:109800204-109800226 TGGAAAGCAGCTGGCAACAACGG - Intronic
1017996341 6:159534600-159534622 TGCAGAGGAGCTGGCAGGGCTGG + Intergenic
1018035591 6:159878592-159878614 GGTAAAGCAGCTGCCAGGGAGGG + Intergenic
1018172431 6:161153090-161153112 TGCACAGCAGAGGGCAGCGCTGG + Intronic
1021168717 7:17372230-17372252 TGTCAAGGTGCTGGCAGGGCTGG + Intergenic
1025922299 7:65924924-65924946 TGGAAAACAGCTGGAAGCGGGGG - Intronic
1032136815 7:129286746-129286768 TGTAAAGGAGCTGGAAGTGGTGG - Intronic
1033472775 7:141664621-141664643 TGGAGAGCAGCTGGCAGCTAAGG + Intronic
1033902180 7:146156887-146156909 TGTAAAGCAGCTGGGCGCAGTGG - Intronic
1034327800 7:150253136-150253158 TGTAAAGATGGTGGCAGAGCGGG + Intronic
1034489317 7:151384920-151384942 TGCAAAACAGCTGGAAGCACGGG + Intronic
1036906482 8:12712080-12712102 TGTAAAGGAGCTGCCAGGGGAGG + Intergenic
1038008668 8:23457182-23457204 TTTAAAGCGGCAGGCAGGGCCGG + Intronic
1040014524 8:42689835-42689857 TGTGGAGCAGGGGGCAGCGCTGG - Intergenic
1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG + Exonic
1043964071 8:86451881-86451903 TATAAAGCAGCTGTAAGAGCAGG - Intronic
1044115492 8:88328616-88328638 AGTAAAGCAGCTGGCAAGGGCGG + Intergenic
1049538916 8:143197284-143197306 AGCAAAGCAGCTGACAGCGAGGG + Intergenic
1061682474 9:132249887-132249909 TGTAAGGCAGGTGGCAGCGAGGG - Intergenic
1062190627 9:135246119-135246141 TGGCAAGCTGCTGGCAGAGCTGG + Intergenic
1062472257 9:136711832-136711854 TGCGGAGCAGCTGGAAGCGCCGG + Intergenic
1187603027 X:20853098-20853120 TCTAAAGCAGCAGGGAGTGCTGG + Intergenic
1193603804 X:83541552-83541574 TGCAAAGCAGCAAGCAGAGCAGG + Intergenic
1194000301 X:88420415-88420437 TGTAAAGCAGCTTCCACTGCTGG + Intergenic
1195707154 X:107745579-107745601 TGTAAAGCAACTTGCAAAGCAGG - Intronic
1196740616 X:119022118-119022140 TAAAAAGCAGCTGGCAGCATGGG + Intergenic
1199875654 X:151925859-151925881 GGAAAAGCAGCTGGGAGCGAGGG + Intergenic
1202090260 Y:21181219-21181241 TGTAAAGCAGCCTCCACCGCGGG + Intergenic