ID: 1135607343

View in Genome Browser
Species Human (GRCh38)
Location 16:23836062-23836084
Sequence CGCTGCTGCACCCGGGGCCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 234}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607343_1135607359 24 Left 1135607343 16:23836062-23836084 CCGCGGCCCCGGGTGCAGCAGCG 0: 1
1: 0
2: 1
3: 23
4: 234
Right 1135607359 16:23836109-23836131 GCCCGCAGCCCGCGGTCCCGCGG 0: 1
1: 0
2: 4
3: 22
4: 174
1135607343_1135607349 2 Left 1135607343 16:23836062-23836084 CCGCGGCCCCGGGTGCAGCAGCG 0: 1
1: 0
2: 1
3: 23
4: 234
Right 1135607349 16:23836087-23836109 CGCCGCCTCCCGCGCCTCCCCGG 0: 1
1: 0
2: 13
3: 77
4: 776
1135607343_1135607355 16 Left 1135607343 16:23836062-23836084 CCGCGGCCCCGGGTGCAGCAGCG 0: 1
1: 0
2: 1
3: 23
4: 234
Right 1135607355 16:23836101-23836123 CCTCCCCGGCCCGCAGCCCGCGG 0: 1
1: 0
2: 2
3: 56
4: 499
1135607343_1135607362 30 Left 1135607343 16:23836062-23836084 CCGCGGCCCCGGGTGCAGCAGCG 0: 1
1: 0
2: 1
3: 23
4: 234
Right 1135607362 16:23836115-23836137 AGCCCGCGGTCCCGCGGCCCCGG 0: 1
1: 0
2: 0
3: 22
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135607343 Original CRISPR CGCTGCTGCACCCGGGGCCG CGG (reversed) Exonic