ID: 1135607345

View in Genome Browser
Species Human (GRCh38)
Location 16:23836068-23836090
Sequence GGCGGCCGCTGCTGCACCCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 412
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 361}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607345_1135607355 10 Left 1135607345 16:23836068-23836090 CCCCGGGTGCAGCAGCGGCCGCC 0: 1
1: 0
2: 3
3: 47
4: 361
Right 1135607355 16:23836101-23836123 CCTCCCCGGCCCGCAGCCCGCGG 0: 1
1: 0
2: 2
3: 56
4: 499
1135607345_1135607359 18 Left 1135607345 16:23836068-23836090 CCCCGGGTGCAGCAGCGGCCGCC 0: 1
1: 0
2: 3
3: 47
4: 361
Right 1135607359 16:23836109-23836131 GCCCGCAGCCCGCGGTCCCGCGG 0: 1
1: 0
2: 4
3: 22
4: 174
1135607345_1135607349 -4 Left 1135607345 16:23836068-23836090 CCCCGGGTGCAGCAGCGGCCGCC 0: 1
1: 0
2: 3
3: 47
4: 361
Right 1135607349 16:23836087-23836109 CGCCGCCTCCCGCGCCTCCCCGG 0: 1
1: 0
2: 13
3: 77
4: 776
1135607345_1135607365 26 Left 1135607345 16:23836068-23836090 CCCCGGGTGCAGCAGCGGCCGCC 0: 1
1: 0
2: 3
3: 47
4: 361
Right 1135607365 16:23836117-23836139 CCCGCGGTCCCGCGGCCCCGGGG 0: 1
1: 1
2: 4
3: 40
4: 263
1135607345_1135607362 24 Left 1135607345 16:23836068-23836090 CCCCGGGTGCAGCAGCGGCCGCC 0: 1
1: 0
2: 3
3: 47
4: 361
Right 1135607362 16:23836115-23836137 AGCCCGCGGTCCCGCGGCCCCGG 0: 1
1: 0
2: 0
3: 22
4: 177
1135607345_1135607367 30 Left 1135607345 16:23836068-23836090 CCCCGGGTGCAGCAGCGGCCGCC 0: 1
1: 0
2: 3
3: 47
4: 361
Right 1135607367 16:23836121-23836143 CGGTCCCGCGGCCCCGGGGCCGG 0: 1
1: 0
2: 6
3: 47
4: 344
1135607345_1135607363 25 Left 1135607345 16:23836068-23836090 CCCCGGGTGCAGCAGCGGCCGCC 0: 1
1: 0
2: 3
3: 47
4: 361
Right 1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG 0: 1
1: 0
2: 4
3: 34
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135607345 Original CRISPR GGCGGCCGCTGCTGCACCCG GGG (reversed) Exonic