ID: 1135607347

View in Genome Browser
Species Human (GRCh38)
Location 16:23836070-23836092
Sequence GCGGCGGCCGCTGCTGCACC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 639
Summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 572}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607347_1135607359 16 Left 1135607347 16:23836070-23836092 CCGGGTGCAGCAGCGGCCGCCGC 0: 1
1: 0
2: 4
3: 62
4: 572
Right 1135607359 16:23836109-23836131 GCCCGCAGCCCGCGGTCCCGCGG 0: 1
1: 0
2: 4
3: 22
4: 174
1135607347_1135607363 23 Left 1135607347 16:23836070-23836092 CCGGGTGCAGCAGCGGCCGCCGC 0: 1
1: 0
2: 4
3: 62
4: 572
Right 1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG 0: 1
1: 0
2: 4
3: 34
4: 329
1135607347_1135607349 -6 Left 1135607347 16:23836070-23836092 CCGGGTGCAGCAGCGGCCGCCGC 0: 1
1: 0
2: 4
3: 62
4: 572
Right 1135607349 16:23836087-23836109 CGCCGCCTCCCGCGCCTCCCCGG 0: 1
1: 0
2: 13
3: 77
4: 776
1135607347_1135607365 24 Left 1135607347 16:23836070-23836092 CCGGGTGCAGCAGCGGCCGCCGC 0: 1
1: 0
2: 4
3: 62
4: 572
Right 1135607365 16:23836117-23836139 CCCGCGGTCCCGCGGCCCCGGGG 0: 1
1: 1
2: 4
3: 40
4: 263
1135607347_1135607362 22 Left 1135607347 16:23836070-23836092 CCGGGTGCAGCAGCGGCCGCCGC 0: 1
1: 0
2: 4
3: 62
4: 572
Right 1135607362 16:23836115-23836137 AGCCCGCGGTCCCGCGGCCCCGG 0: 1
1: 0
2: 0
3: 22
4: 177
1135607347_1135607355 8 Left 1135607347 16:23836070-23836092 CCGGGTGCAGCAGCGGCCGCCGC 0: 1
1: 0
2: 4
3: 62
4: 572
Right 1135607355 16:23836101-23836123 CCTCCCCGGCCCGCAGCCCGCGG 0: 1
1: 0
2: 2
3: 56
4: 499
1135607347_1135607367 28 Left 1135607347 16:23836070-23836092 CCGGGTGCAGCAGCGGCCGCCGC 0: 1
1: 0
2: 4
3: 62
4: 572
Right 1135607367 16:23836121-23836143 CGGTCCCGCGGCCCCGGGGCCGG 0: 1
1: 0
2: 6
3: 47
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135607347 Original CRISPR GCGGCGGCCGCTGCTGCACC CGG (reversed) Exonic