ID: 1135607348

View in Genome Browser
Species Human (GRCh38)
Location 16:23836086-23836108
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1919
Summary {0: 1, 1: 0, 2: 17, 3: 231, 4: 1670}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607348_1135607363 7 Left 1135607348 16:23836086-23836108 CCGCCGCCTCCCGCGCCTCCCCG 0: 1
1: 0
2: 17
3: 231
4: 1670
Right 1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG 0: 1
1: 0
2: 4
3: 34
4: 329
1135607348_1135607375 29 Left 1135607348 16:23836086-23836108 CCGCCGCCTCCCGCGCCTCCCCG 0: 1
1: 0
2: 17
3: 231
4: 1670
Right 1135607375 16:23836138-23836160 GGCCGGCACCTCTCGGGCTCCGG 0: 1
1: 0
2: 1
3: 14
4: 256
1135607348_1135607359 0 Left 1135607348 16:23836086-23836108 CCGCCGCCTCCCGCGCCTCCCCG 0: 1
1: 0
2: 17
3: 231
4: 1670
Right 1135607359 16:23836109-23836131 GCCCGCAGCCCGCGGTCCCGCGG 0: 1
1: 0
2: 4
3: 22
4: 174
1135607348_1135607365 8 Left 1135607348 16:23836086-23836108 CCGCCGCCTCCCGCGCCTCCCCG 0: 1
1: 0
2: 17
3: 231
4: 1670
Right 1135607365 16:23836117-23836139 CCCGCGGTCCCGCGGCCCCGGGG 0: 1
1: 1
2: 4
3: 40
4: 263
1135607348_1135607362 6 Left 1135607348 16:23836086-23836108 CCGCCGCCTCCCGCGCCTCCCCG 0: 1
1: 0
2: 17
3: 231
4: 1670
Right 1135607362 16:23836115-23836137 AGCCCGCGGTCCCGCGGCCCCGG 0: 1
1: 0
2: 0
3: 22
4: 177
1135607348_1135607372 23 Left 1135607348 16:23836086-23836108 CCGCCGCCTCCCGCGCCTCCCCG 0: 1
1: 0
2: 17
3: 231
4: 1670
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607348_1135607355 -8 Left 1135607348 16:23836086-23836108 CCGCCGCCTCCCGCGCCTCCCCG 0: 1
1: 0
2: 17
3: 231
4: 1670
Right 1135607355 16:23836101-23836123 CCTCCCCGGCCCGCAGCCCGCGG 0: 1
1: 0
2: 2
3: 56
4: 499
1135607348_1135607367 12 Left 1135607348 16:23836086-23836108 CCGCCGCCTCCCGCGCCTCCCCG 0: 1
1: 0
2: 17
3: 231
4: 1670
Right 1135607367 16:23836121-23836143 CGGTCCCGCGGCCCCGGGGCCGG 0: 1
1: 0
2: 6
3: 47
4: 344
1135607348_1135607370 22 Left 1135607348 16:23836086-23836108 CCGCCGCCTCCCGCGCCTCCCCG 0: 1
1: 0
2: 17
3: 231
4: 1670
Right 1135607370 16:23836131-23836153 GCCCCGGGGCCGGCACCTCTCGG 0: 1
1: 0
2: 1
3: 20
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135607348 Original CRISPR CGGGGAGGCGCGGGAGGCGG CGG (reversed) Exonic