ID: 1135607349

View in Genome Browser
Species Human (GRCh38)
Location 16:23836087-23836109
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 867
Summary {0: 1, 1: 0, 2: 13, 3: 77, 4: 776}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607342_1135607349 3 Left 1135607342 16:23836061-23836083 CCCGCGGCCCCGGGTGCAGCAGC 0: 1
1: 0
2: 6
3: 33
4: 363
Right 1135607349 16:23836087-23836109 CGCCGCCTCCCGCGCCTCCCCGG 0: 1
1: 0
2: 13
3: 77
4: 776
1135607346_1135607349 -5 Left 1135607346 16:23836069-23836091 CCCGGGTGCAGCAGCGGCCGCCG 0: 1
1: 0
2: 6
3: 60
4: 437
Right 1135607349 16:23836087-23836109 CGCCGCCTCCCGCGCCTCCCCGG 0: 1
1: 0
2: 13
3: 77
4: 776
1135607337_1135607349 26 Left 1135607337 16:23836038-23836060 CCAGAGCCGGCGCAGGGGAAGCG 0: 1
1: 0
2: 0
3: 16
4: 160
Right 1135607349 16:23836087-23836109 CGCCGCCTCCCGCGCCTCCCCGG 0: 1
1: 0
2: 13
3: 77
4: 776
1135607338_1135607349 20 Left 1135607338 16:23836044-23836066 CCGGCGCAGGGGAAGCGCCCGCG 0: 1
1: 1
2: 0
3: 10
4: 106
Right 1135607349 16:23836087-23836109 CGCCGCCTCCCGCGCCTCCCCGG 0: 1
1: 0
2: 13
3: 77
4: 776
1135607343_1135607349 2 Left 1135607343 16:23836062-23836084 CCGCGGCCCCGGGTGCAGCAGCG 0: 1
1: 0
2: 1
3: 23
4: 234
Right 1135607349 16:23836087-23836109 CGCCGCCTCCCGCGCCTCCCCGG 0: 1
1: 0
2: 13
3: 77
4: 776
1135607345_1135607349 -4 Left 1135607345 16:23836068-23836090 CCCCGGGTGCAGCAGCGGCCGCC 0: 1
1: 0
2: 3
3: 47
4: 361
Right 1135607349 16:23836087-23836109 CGCCGCCTCCCGCGCCTCCCCGG 0: 1
1: 0
2: 13
3: 77
4: 776
1135607347_1135607349 -6 Left 1135607347 16:23836070-23836092 CCGGGTGCAGCAGCGGCCGCCGC 0: 1
1: 0
2: 4
3: 62
4: 572
Right 1135607349 16:23836087-23836109 CGCCGCCTCCCGCGCCTCCCCGG 0: 1
1: 0
2: 13
3: 77
4: 776
1135607336_1135607349 29 Left 1135607336 16:23836035-23836057 CCGCCAGAGCCGGCGCAGGGGAA 0: 1
1: 0
2: 1
3: 10
4: 172
Right 1135607349 16:23836087-23836109 CGCCGCCTCCCGCGCCTCCCCGG 0: 1
1: 0
2: 13
3: 77
4: 776

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type