ID: 1135607352

View in Genome Browser
Species Human (GRCh38)
Location 16:23836095-23836117
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 920
Summary {0: 1, 1: 0, 2: 5, 3: 90, 4: 824}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607352_1135607367 3 Left 1135607352 16:23836095-23836117 CCCGCGCCTCCCCGGCCCGCAGC 0: 1
1: 0
2: 5
3: 90
4: 824
Right 1135607367 16:23836121-23836143 CGGTCCCGCGGCCCCGGGGCCGG 0: 1
1: 0
2: 6
3: 47
4: 344
1135607352_1135607359 -9 Left 1135607352 16:23836095-23836117 CCCGCGCCTCCCCGGCCCGCAGC 0: 1
1: 0
2: 5
3: 90
4: 824
Right 1135607359 16:23836109-23836131 GCCCGCAGCCCGCGGTCCCGCGG 0: 1
1: 0
2: 4
3: 22
4: 174
1135607352_1135607375 20 Left 1135607352 16:23836095-23836117 CCCGCGCCTCCCCGGCCCGCAGC 0: 1
1: 0
2: 5
3: 90
4: 824
Right 1135607375 16:23836138-23836160 GGCCGGCACCTCTCGGGCTCCGG 0: 1
1: 0
2: 1
3: 14
4: 256
1135607352_1135607372 14 Left 1135607352 16:23836095-23836117 CCCGCGCCTCCCCGGCCCGCAGC 0: 1
1: 0
2: 5
3: 90
4: 824
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607352_1135607365 -1 Left 1135607352 16:23836095-23836117 CCCGCGCCTCCCCGGCCCGCAGC 0: 1
1: 0
2: 5
3: 90
4: 824
Right 1135607365 16:23836117-23836139 CCCGCGGTCCCGCGGCCCCGGGG 0: 1
1: 1
2: 4
3: 40
4: 263
1135607352_1135607370 13 Left 1135607352 16:23836095-23836117 CCCGCGCCTCCCCGGCCCGCAGC 0: 1
1: 0
2: 5
3: 90
4: 824
Right 1135607370 16:23836131-23836153 GCCCCGGGGCCGGCACCTCTCGG 0: 1
1: 0
2: 1
3: 20
4: 243
1135607352_1135607363 -2 Left 1135607352 16:23836095-23836117 CCCGCGCCTCCCCGGCCCGCAGC 0: 1
1: 0
2: 5
3: 90
4: 824
Right 1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG 0: 1
1: 0
2: 4
3: 34
4: 329
1135607352_1135607362 -3 Left 1135607352 16:23836095-23836117 CCCGCGCCTCCCCGGCCCGCAGC 0: 1
1: 0
2: 5
3: 90
4: 824
Right 1135607362 16:23836115-23836137 AGCCCGCGGTCCCGCGGCCCCGG 0: 1
1: 0
2: 0
3: 22
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135607352 Original CRISPR GCTGCGGGCCGGGGAGGCGC GGG (reversed) Exonic