ID: 1135607353

View in Genome Browser
Species Human (GRCh38)
Location 16:23836096-23836118
Sequence GGCTGCGGGCCGGGGAGGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1200
Summary {0: 1, 1: 0, 2: 7, 3: 151, 4: 1041}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607353_1135607370 12 Left 1135607353 16:23836096-23836118 CCGCGCCTCCCCGGCCCGCAGCC 0: 1
1: 0
2: 7
3: 151
4: 1041
Right 1135607370 16:23836131-23836153 GCCCCGGGGCCGGCACCTCTCGG 0: 1
1: 0
2: 1
3: 20
4: 243
1135607353_1135607375 19 Left 1135607353 16:23836096-23836118 CCGCGCCTCCCCGGCCCGCAGCC 0: 1
1: 0
2: 7
3: 151
4: 1041
Right 1135607375 16:23836138-23836160 GGCCGGCACCTCTCGGGCTCCGG 0: 1
1: 0
2: 1
3: 14
4: 256
1135607353_1135607365 -2 Left 1135607353 16:23836096-23836118 CCGCGCCTCCCCGGCCCGCAGCC 0: 1
1: 0
2: 7
3: 151
4: 1041
Right 1135607365 16:23836117-23836139 CCCGCGGTCCCGCGGCCCCGGGG 0: 1
1: 1
2: 4
3: 40
4: 263
1135607353_1135607362 -4 Left 1135607353 16:23836096-23836118 CCGCGCCTCCCCGGCCCGCAGCC 0: 1
1: 0
2: 7
3: 151
4: 1041
Right 1135607362 16:23836115-23836137 AGCCCGCGGTCCCGCGGCCCCGG 0: 1
1: 0
2: 0
3: 22
4: 177
1135607353_1135607363 -3 Left 1135607353 16:23836096-23836118 CCGCGCCTCCCCGGCCCGCAGCC 0: 1
1: 0
2: 7
3: 151
4: 1041
Right 1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG 0: 1
1: 0
2: 4
3: 34
4: 329
1135607353_1135607359 -10 Left 1135607353 16:23836096-23836118 CCGCGCCTCCCCGGCCCGCAGCC 0: 1
1: 0
2: 7
3: 151
4: 1041
Right 1135607359 16:23836109-23836131 GCCCGCAGCCCGCGGTCCCGCGG 0: 1
1: 0
2: 4
3: 22
4: 174
1135607353_1135607372 13 Left 1135607353 16:23836096-23836118 CCGCGCCTCCCCGGCCCGCAGCC 0: 1
1: 0
2: 7
3: 151
4: 1041
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607353_1135607367 2 Left 1135607353 16:23836096-23836118 CCGCGCCTCCCCGGCCCGCAGCC 0: 1
1: 0
2: 7
3: 151
4: 1041
Right 1135607367 16:23836121-23836143 CGGTCCCGCGGCCCCGGGGCCGG 0: 1
1: 0
2: 6
3: 47
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135607353 Original CRISPR GGCTGCGGGCCGGGGAGGCG CGG (reversed) Exonic