ID: 1135607355

View in Genome Browser
Species Human (GRCh38)
Location 16:23836101-23836123
Sequence CCTCCCCGGCCCGCAGCCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 499}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607345_1135607355 10 Left 1135607345 16:23836068-23836090 CCCCGGGTGCAGCAGCGGCCGCC 0: 1
1: 0
2: 3
3: 47
4: 361
Right 1135607355 16:23836101-23836123 CCTCCCCGGCCCGCAGCCCGCGG 0: 1
1: 0
2: 2
3: 56
4: 499
1135607348_1135607355 -8 Left 1135607348 16:23836086-23836108 CCGCCGCCTCCCGCGCCTCCCCG 0: 1
1: 0
2: 17
3: 231
4: 1670
Right 1135607355 16:23836101-23836123 CCTCCCCGGCCCGCAGCCCGCGG 0: 1
1: 0
2: 2
3: 56
4: 499
1135607346_1135607355 9 Left 1135607346 16:23836069-23836091 CCCGGGTGCAGCAGCGGCCGCCG 0: 1
1: 0
2: 6
3: 60
4: 437
Right 1135607355 16:23836101-23836123 CCTCCCCGGCCCGCAGCCCGCGG 0: 1
1: 0
2: 2
3: 56
4: 499
1135607347_1135607355 8 Left 1135607347 16:23836070-23836092 CCGGGTGCAGCAGCGGCCGCCGC 0: 1
1: 0
2: 4
3: 62
4: 572
Right 1135607355 16:23836101-23836123 CCTCCCCGGCCCGCAGCCCGCGG 0: 1
1: 0
2: 2
3: 56
4: 499
1135607343_1135607355 16 Left 1135607343 16:23836062-23836084 CCGCGGCCCCGGGTGCAGCAGCG 0: 1
1: 0
2: 1
3: 23
4: 234
Right 1135607355 16:23836101-23836123 CCTCCCCGGCCCGCAGCCCGCGG 0: 1
1: 0
2: 2
3: 56
4: 499
1135607342_1135607355 17 Left 1135607342 16:23836061-23836083 CCCGCGGCCCCGGGTGCAGCAGC 0: 1
1: 0
2: 6
3: 33
4: 363
Right 1135607355 16:23836101-23836123 CCTCCCCGGCCCGCAGCCCGCGG 0: 1
1: 0
2: 2
3: 56
4: 499

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135607355 Original CRISPR CCTCCCCGGCCCGCAGCCCG CGG Exonic