ID: 1135607357

View in Genome Browser
Species Human (GRCh38)
Location 16:23836105-23836127
Sequence GGGACCGCGGGCTGCGGGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 0, 2: 5, 3: 67, 4: 478}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607357_1135607379 29 Left 1135607357 16:23836105-23836127 CCCGGCCCGCAGCCCGCGGTCCC 0: 1
1: 0
2: 5
3: 67
4: 478
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49
1135607357_1135607370 3 Left 1135607357 16:23836105-23836127 CCCGGCCCGCAGCCCGCGGTCCC 0: 1
1: 0
2: 5
3: 67
4: 478
Right 1135607370 16:23836131-23836153 GCCCCGGGGCCGGCACCTCTCGG 0: 1
1: 0
2: 1
3: 20
4: 243
1135607357_1135607372 4 Left 1135607357 16:23836105-23836127 CCCGGCCCGCAGCCCGCGGTCCC 0: 1
1: 0
2: 5
3: 67
4: 478
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607357_1135607375 10 Left 1135607357 16:23836105-23836127 CCCGGCCCGCAGCCCGCGGTCCC 0: 1
1: 0
2: 5
3: 67
4: 478
Right 1135607375 16:23836138-23836160 GGCCGGCACCTCTCGGGCTCCGG 0: 1
1: 0
2: 1
3: 14
4: 256
1135607357_1135607367 -7 Left 1135607357 16:23836105-23836127 CCCGGCCCGCAGCCCGCGGTCCC 0: 1
1: 0
2: 5
3: 67
4: 478
Right 1135607367 16:23836121-23836143 CGGTCCCGCGGCCCCGGGGCCGG 0: 1
1: 0
2: 6
3: 47
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135607357 Original CRISPR GGGACCGCGGGCTGCGGGCC GGG (reversed) Exonic