ID: 1135607358

View in Genome Browser
Species Human (GRCh38)
Location 16:23836106-23836128
Sequence CGGGACCGCGGGCTGCGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 1, 2: 4, 3: 33, 4: 431}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607358_1135607375 9 Left 1135607358 16:23836106-23836128 CCGGCCCGCAGCCCGCGGTCCCG 0: 1
1: 1
2: 4
3: 33
4: 431
Right 1135607375 16:23836138-23836160 GGCCGGCACCTCTCGGGCTCCGG 0: 1
1: 0
2: 1
3: 14
4: 256
1135607358_1135607372 3 Left 1135607358 16:23836106-23836128 CCGGCCCGCAGCCCGCGGTCCCG 0: 1
1: 1
2: 4
3: 33
4: 431
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607358_1135607379 28 Left 1135607358 16:23836106-23836128 CCGGCCCGCAGCCCGCGGTCCCG 0: 1
1: 1
2: 4
3: 33
4: 431
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49
1135607358_1135607370 2 Left 1135607358 16:23836106-23836128 CCGGCCCGCAGCCCGCGGTCCCG 0: 1
1: 1
2: 4
3: 33
4: 431
Right 1135607370 16:23836131-23836153 GCCCCGGGGCCGGCACCTCTCGG 0: 1
1: 0
2: 1
3: 20
4: 243
1135607358_1135607367 -8 Left 1135607358 16:23836106-23836128 CCGGCCCGCAGCCCGCGGTCCCG 0: 1
1: 1
2: 4
3: 33
4: 431
Right 1135607367 16:23836121-23836143 CGGTCCCGCGGCCCCGGGGCCGG 0: 1
1: 0
2: 6
3: 47
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135607358 Original CRISPR CGGGACCGCGGGCTGCGGGC CGG (reversed) Exonic