ID: 1135607360

View in Genome Browser
Species Human (GRCh38)
Location 16:23836110-23836132
Sequence GCCGCGGGACCGCGGGCTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 1, 2: 3, 3: 32, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607360_1135607379 24 Left 1135607360 16:23836110-23836132 CCCGCAGCCCGCGGTCCCGCGGC 0: 1
1: 1
2: 3
3: 32
4: 247
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49
1135607360_1135607375 5 Left 1135607360 16:23836110-23836132 CCCGCAGCCCGCGGTCCCGCGGC 0: 1
1: 1
2: 3
3: 32
4: 247
Right 1135607375 16:23836138-23836160 GGCCGGCACCTCTCGGGCTCCGG 0: 1
1: 0
2: 1
3: 14
4: 256
1135607360_1135607372 -1 Left 1135607360 16:23836110-23836132 CCCGCAGCCCGCGGTCCCGCGGC 0: 1
1: 1
2: 3
3: 32
4: 247
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607360_1135607370 -2 Left 1135607360 16:23836110-23836132 CCCGCAGCCCGCGGTCCCGCGGC 0: 1
1: 1
2: 3
3: 32
4: 247
Right 1135607370 16:23836131-23836153 GCCCCGGGGCCGGCACCTCTCGG 0: 1
1: 0
2: 1
3: 20
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135607360 Original CRISPR GCCGCGGGACCGCGGGCTGC GGG (reversed) Exonic