ID: 1135607361

View in Genome Browser
Species Human (GRCh38)
Location 16:23836111-23836133
Sequence GGCCGCGGGACCGCGGGCTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 359}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607361_1135607370 -3 Left 1135607361 16:23836111-23836133 CCGCAGCCCGCGGTCCCGCGGCC 0: 1
1: 0
2: 4
3: 24
4: 359
Right 1135607370 16:23836131-23836153 GCCCCGGGGCCGGCACCTCTCGG 0: 1
1: 0
2: 1
3: 20
4: 243
1135607361_1135607379 23 Left 1135607361 16:23836111-23836133 CCGCAGCCCGCGGTCCCGCGGCC 0: 1
1: 0
2: 4
3: 24
4: 359
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49
1135607361_1135607372 -2 Left 1135607361 16:23836111-23836133 CCGCAGCCCGCGGTCCCGCGGCC 0: 1
1: 0
2: 4
3: 24
4: 359
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607361_1135607375 4 Left 1135607361 16:23836111-23836133 CCGCAGCCCGCGGTCCCGCGGCC 0: 1
1: 0
2: 4
3: 24
4: 359
Right 1135607375 16:23836138-23836160 GGCCGGCACCTCTCGGGCTCCGG 0: 1
1: 0
2: 1
3: 14
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135607361 Original CRISPR GGCCGCGGGACCGCGGGCTG CGG (reversed) Exonic