ID: 1135607363

View in Genome Browser
Species Human (GRCh38)
Location 16:23836116-23836138
Sequence GCCCGCGGTCCCGCGGCCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 329}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607348_1135607363 7 Left 1135607348 16:23836086-23836108 CCGCCGCCTCCCGCGCCTCCCCG 0: 1
1: 0
2: 17
3: 231
4: 1670
Right 1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG 0: 1
1: 0
2: 4
3: 34
4: 329
1135607354_1135607363 -8 Left 1135607354 16:23836101-23836123 CCTCCCCGGCCCGCAGCCCGCGG 0: 1
1: 0
2: 7
3: 106
4: 688
Right 1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG 0: 1
1: 0
2: 4
3: 34
4: 329
1135607345_1135607363 25 Left 1135607345 16:23836068-23836090 CCCCGGGTGCAGCAGCGGCCGCC 0: 1
1: 0
2: 3
3: 47
4: 361
Right 1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG 0: 1
1: 0
2: 4
3: 34
4: 329
1135607353_1135607363 -3 Left 1135607353 16:23836096-23836118 CCGCGCCTCCCCGGCCCGCAGCC 0: 1
1: 0
2: 7
3: 151
4: 1041
Right 1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG 0: 1
1: 0
2: 4
3: 34
4: 329
1135607351_1135607363 1 Left 1135607351 16:23836092-23836114 CCTCCCGCGCCTCCCCGGCCCGC 0: 1
1: 2
2: 18
3: 195
4: 1326
Right 1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG 0: 1
1: 0
2: 4
3: 34
4: 329
1135607346_1135607363 24 Left 1135607346 16:23836069-23836091 CCCGGGTGCAGCAGCGGCCGCCG 0: 1
1: 0
2: 6
3: 60
4: 437
Right 1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG 0: 1
1: 0
2: 4
3: 34
4: 329
1135607352_1135607363 -2 Left 1135607352 16:23836095-23836117 CCCGCGCCTCCCCGGCCCGCAGC 0: 1
1: 0
2: 5
3: 90
4: 824
Right 1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG 0: 1
1: 0
2: 4
3: 34
4: 329
1135607347_1135607363 23 Left 1135607347 16:23836070-23836092 CCGGGTGCAGCAGCGGCCGCCGC 0: 1
1: 0
2: 4
3: 62
4: 572
Right 1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG 0: 1
1: 0
2: 4
3: 34
4: 329
1135607350_1135607363 4 Left 1135607350 16:23836089-23836111 CCGCCTCCCGCGCCTCCCCGGCC 0: 1
1: 0
2: 12
3: 217
4: 1715
Right 1135607363 16:23836116-23836138 GCCCGCGGTCCCGCGGCCCCGGG 0: 1
1: 0
2: 4
3: 34
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135607363 Original CRISPR GCCCGCGGTCCCGCGGCCCC GGG Exonic