ID: 1135607364

View in Genome Browser
Species Human (GRCh38)
Location 16:23836117-23836139
Sequence CCCCGGGGCCGCGGGACCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 285}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607364_1135607383 26 Left 1135607364 16:23836117-23836139 CCCGCGGTCCCGCGGCCCCGGGG 0: 1
1: 0
2: 2
3: 35
4: 285
Right 1135607383 16:23836166-23836188 CGCGCGCAAGATGGCTGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 50
1135607364_1135607379 17 Left 1135607364 16:23836117-23836139 CCCGCGGTCCCGCGGCCCCGGGG 0: 1
1: 0
2: 2
3: 35
4: 285
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49
1135607364_1135607375 -2 Left 1135607364 16:23836117-23836139 CCCGCGGTCCCGCGGCCCCGGGG 0: 1
1: 0
2: 2
3: 35
4: 285
Right 1135607375 16:23836138-23836160 GGCCGGCACCTCTCGGGCTCCGG 0: 1
1: 0
2: 1
3: 14
4: 256
1135607364_1135607370 -9 Left 1135607364 16:23836117-23836139 CCCGCGGTCCCGCGGCCCCGGGG 0: 1
1: 0
2: 2
3: 35
4: 285
Right 1135607370 16:23836131-23836153 GCCCCGGGGCCGGCACCTCTCGG 0: 1
1: 0
2: 1
3: 20
4: 243
1135607364_1135607372 -8 Left 1135607364 16:23836117-23836139 CCCGCGGTCCCGCGGCCCCGGGG 0: 1
1: 0
2: 2
3: 35
4: 285
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135607364 Original CRISPR CCCCGGGGCCGCGGGACCGC GGG (reversed) Exonic