ID: 1135607372

View in Genome Browser
Species Human (GRCh38)
Location 16:23836132-23836154
Sequence CCCCGGGGCCGGCACCTCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 211}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607348_1135607372 23 Left 1135607348 16:23836086-23836108 CCGCCGCCTCCCGCGCCTCCCCG 0: 1
1: 0
2: 17
3: 231
4: 1670
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607364_1135607372 -8 Left 1135607364 16:23836117-23836139 CCCGCGGTCCCGCGGCCCCGGGG 0: 1
1: 0
2: 2
3: 35
4: 285
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607351_1135607372 17 Left 1135607351 16:23836092-23836114 CCTCCCGCGCCTCCCCGGCCCGC 0: 1
1: 2
2: 18
3: 195
4: 1326
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607360_1135607372 -1 Left 1135607360 16:23836110-23836132 CCCGCAGCCCGCGGTCCCGCGGC 0: 1
1: 1
2: 3
3: 32
4: 247
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607356_1135607372 5 Left 1135607356 16:23836104-23836126 CCCCGGCCCGCAGCCCGCGGTCC 0: 1
1: 0
2: 5
3: 49
4: 452
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607366_1135607372 -9 Left 1135607366 16:23836118-23836140 CCGCGGTCCCGCGGCCCCGGGGC 0: 1
1: 0
2: 5
3: 56
4: 376
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607357_1135607372 4 Left 1135607357 16:23836105-23836127 CCCGGCCCGCAGCCCGCGGTCCC 0: 1
1: 0
2: 5
3: 67
4: 478
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607358_1135607372 3 Left 1135607358 16:23836106-23836128 CCGGCCCGCAGCCCGCGGTCCCG 0: 1
1: 1
2: 4
3: 33
4: 431
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607353_1135607372 13 Left 1135607353 16:23836096-23836118 CCGCGCCTCCCCGGCCCGCAGCC 0: 1
1: 0
2: 7
3: 151
4: 1041
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607361_1135607372 -2 Left 1135607361 16:23836111-23836133 CCGCAGCCCGCGGTCCCGCGGCC 0: 1
1: 0
2: 4
3: 24
4: 359
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607354_1135607372 8 Left 1135607354 16:23836101-23836123 CCTCCCCGGCCCGCAGCCCGCGG 0: 1
1: 0
2: 7
3: 106
4: 688
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607350_1135607372 20 Left 1135607350 16:23836089-23836111 CCGCCTCCCGCGCCTCCCCGGCC 0: 1
1: 0
2: 12
3: 217
4: 1715
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211
1135607352_1135607372 14 Left 1135607352 16:23836095-23836117 CCCGCGCCTCCCCGGCCCGCAGC 0: 1
1: 0
2: 5
3: 90
4: 824
Right 1135607372 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 1
3: 17
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135607372 Original CRISPR CCCCGGGGCCGGCACCTCTC GGG Exonic