ID: 1135607379

View in Genome Browser
Species Human (GRCh38)
Location 16:23836157-23836179
Sequence CCGGCTCCCCGCGCGCAAGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 49}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607376_1135607379 -6 Left 1135607376 16:23836140-23836162 CCGGCACCTCTCGGGCTCCGGCT 0: 1
1: 1
2: 1
3: 19
4: 375
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49
1135607371_1135607379 2 Left 1135607371 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49
1135607356_1135607379 30 Left 1135607356 16:23836104-23836126 CCCCGGCCCGCAGCCCGCGGTCC 0: 1
1: 0
2: 5
3: 49
4: 452
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49
1135607373_1135607379 1 Left 1135607373 16:23836133-23836155 CCCGGGGCCGGCACCTCTCGGGC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49
1135607357_1135607379 29 Left 1135607357 16:23836105-23836127 CCCGGCCCGCAGCCCGCGGTCCC 0: 1
1: 0
2: 5
3: 67
4: 478
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49
1135607364_1135607379 17 Left 1135607364 16:23836117-23836139 CCCGCGGTCCCGCGGCCCCGGGG 0: 1
1: 0
2: 2
3: 35
4: 285
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49
1135607366_1135607379 16 Left 1135607366 16:23836118-23836140 CCGCGGTCCCGCGGCCCCGGGGC 0: 1
1: 0
2: 5
3: 56
4: 376
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49
1135607369_1135607379 8 Left 1135607369 16:23836126-23836148 CCGCGGCCCCGGGGCCGGCACCT 0: 1
1: 0
2: 2
3: 48
4: 466
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49
1135607361_1135607379 23 Left 1135607361 16:23836111-23836133 CCGCAGCCCGCGGTCCCGCGGCC 0: 1
1: 0
2: 4
3: 24
4: 359
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49
1135607358_1135607379 28 Left 1135607358 16:23836106-23836128 CCGGCCCGCAGCCCGCGGTCCCG 0: 1
1: 1
2: 4
3: 33
4: 431
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49
1135607374_1135607379 0 Left 1135607374 16:23836134-23836156 CCGGGGCCGGCACCTCTCGGGCT 0: 1
1: 0
2: 3
3: 16
4: 164
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49
1135607360_1135607379 24 Left 1135607360 16:23836110-23836132 CCCGCAGCCCGCGGTCCCGCGGC 0: 1
1: 1
2: 3
3: 32
4: 247
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49
1135607368_1135607379 9 Left 1135607368 16:23836125-23836147 CCCGCGGCCCCGGGGCCGGCACC 0: 1
1: 0
2: 2
3: 54
4: 481
Right 1135607379 16:23836157-23836179 CCGGCTCCCCGCGCGCAAGATGG 0: 1
1: 0
2: 0
3: 7
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135607379 Original CRISPR CCGGCTCCCCGCGCGCAAGA TGG Exonic