ID: 1135607383

View in Genome Browser
Species Human (GRCh38)
Location 16:23836166-23836188
Sequence CGCGCGCAAGATGGCTGACC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135607374_1135607383 9 Left 1135607374 16:23836134-23836156 CCGGGGCCGGCACCTCTCGGGCT 0: 1
1: 0
2: 3
3: 16
4: 164
Right 1135607383 16:23836166-23836188 CGCGCGCAAGATGGCTGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 50
1135607366_1135607383 25 Left 1135607366 16:23836118-23836140 CCGCGGTCCCGCGGCCCCGGGGC 0: 1
1: 0
2: 5
3: 56
4: 376
Right 1135607383 16:23836166-23836188 CGCGCGCAAGATGGCTGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 50
1135607371_1135607383 11 Left 1135607371 16:23836132-23836154 CCCCGGGGCCGGCACCTCTCGGG 0: 1
1: 0
2: 0
3: 12
4: 142
Right 1135607383 16:23836166-23836188 CGCGCGCAAGATGGCTGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 50
1135607377_1135607383 -3 Left 1135607377 16:23836146-23836168 CCTCTCGGGCTCCGGCTCCCCGC 0: 1
1: 0
2: 2
3: 37
4: 292
Right 1135607383 16:23836166-23836188 CGCGCGCAAGATGGCTGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 50
1135607364_1135607383 26 Left 1135607364 16:23836117-23836139 CCCGCGGTCCCGCGGCCCCGGGG 0: 1
1: 0
2: 2
3: 35
4: 285
Right 1135607383 16:23836166-23836188 CGCGCGCAAGATGGCTGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 50
1135607376_1135607383 3 Left 1135607376 16:23836140-23836162 CCGGCACCTCTCGGGCTCCGGCT 0: 1
1: 1
2: 1
3: 19
4: 375
Right 1135607383 16:23836166-23836188 CGCGCGCAAGATGGCTGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 50
1135607373_1135607383 10 Left 1135607373 16:23836133-23836155 CCCGGGGCCGGCACCTCTCGGGC 0: 1
1: 0
2: 0
3: 21
4: 182
Right 1135607383 16:23836166-23836188 CGCGCGCAAGATGGCTGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 50
1135607369_1135607383 17 Left 1135607369 16:23836126-23836148 CCGCGGCCCCGGGGCCGGCACCT 0: 1
1: 0
2: 2
3: 48
4: 466
Right 1135607383 16:23836166-23836188 CGCGCGCAAGATGGCTGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 50
1135607368_1135607383 18 Left 1135607368 16:23836125-23836147 CCCGCGGCCCCGGGGCCGGCACC 0: 1
1: 0
2: 2
3: 54
4: 481
Right 1135607383 16:23836166-23836188 CGCGCGCAAGATGGCTGACCCGG 0: 1
1: 0
2: 0
3: 4
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135607383 Original CRISPR CGCGCGCAAGATGGCTGACC CGG Exonic