ID: 1135608440

View in Genome Browser
Species Human (GRCh38)
Location 16:23843378-23843400
Sequence CGGGCTTCTCTGTGAATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 105}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135608435_1135608440 12 Left 1135608435 16:23843343-23843365 CCACTCACCTTTTAGCTTATTCT 0: 1
1: 0
2: 1
3: 32
4: 259
Right 1135608440 16:23843378-23843400 CGGGCTTCTCTGTGAATAAAAGG 0: 1
1: 0
2: 1
3: 7
4: 105
1135608434_1135608440 19 Left 1135608434 16:23843336-23843358 CCAAACTCCACTCACCTTTTAGC 0: 1
1: 0
2: 0
3: 12
4: 163
Right 1135608440 16:23843378-23843400 CGGGCTTCTCTGTGAATAAAAGG 0: 1
1: 0
2: 1
3: 7
4: 105
1135608433_1135608440 27 Left 1135608433 16:23843328-23843350 CCTGTGAGCCAAACTCCACTCAC 0: 1
1: 0
2: 3
3: 33
4: 473
Right 1135608440 16:23843378-23843400 CGGGCTTCTCTGTGAATAAAAGG 0: 1
1: 0
2: 1
3: 7
4: 105
1135608436_1135608440 5 Left 1135608436 16:23843350-23843372 CCTTTTAGCTTATTCTAAATGTG 0: 1
1: 0
2: 2
3: 20
4: 252
Right 1135608440 16:23843378-23843400 CGGGCTTCTCTGTGAATAAAAGG 0: 1
1: 0
2: 1
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135608440 Original CRISPR CGGGCTTCTCTGTGAATAAA AGG Intronic
901850246 1:12010526-12010548 CCAGCTTCTCTGTGGGTAAATGG - Intronic
905314484 1:37073240-37073262 TGGGCTTCTGTTTCAATAAAAGG - Intergenic
906580595 1:46932591-46932613 TGGGCGTCTCTGTGTACAAAAGG - Intronic
906603129 1:47146301-47146323 TGGGCGTCTCTGTGTACAAAAGG + Intronic
908178486 1:61579860-61579882 CAGGCTTCTCTGAGAACAAAAGG - Intergenic
908476167 1:64490839-64490861 CTGACTTCCCTGAGAATAAAAGG - Intronic
915029191 1:152861658-152861680 CTGGCTTCTGTGTGAAGACATGG - Intergenic
916748903 1:167706335-167706357 TAGACTTCTCTGTCAATAAATGG - Intergenic
921545821 1:216473787-216473809 TGTGCTTCTCTGGGAAGAAAAGG - Intergenic
1070285081 10:75077077-75077099 AGGGCTTCCCGGTGAAGAAAGGG + Intergenic
1071128296 10:82361432-82361454 CAAGCTTTGCTGTGAATAAAAGG + Intronic
1071857763 10:89644136-89644158 CTGGCTACTCTGTGATTCAAAGG + Intronic
1072306996 10:94117210-94117232 TGAGCTTCCCAGTGAATAAAAGG + Intronic
1076210862 10:128643836-128643858 CCTGCTTCTCTGTGACTAACAGG + Intergenic
1079798476 11:24838206-24838228 CTGGCTTTACTGTAAATAAATGG + Intronic
1086844205 11:91728321-91728343 TAGGCTTCACAGTGAATAAATGG - Intergenic
1092113831 12:5984617-5984639 CAGGCTGCTCTGTGAATAGTGGG - Intronic
1094174584 12:27528254-27528276 GGGTATTCTTTGTGAATAAAGGG + Intronic
1094354386 12:29562725-29562747 TGACCTTCTCTGTGAATAAATGG + Intronic
1096556412 12:52406681-52406703 CTGGCTTCTCTGGGATTAGAGGG + Intergenic
1097839143 12:64304242-64304264 CTGGCTTCTCTGTGAGGAAAGGG + Intronic
1100764695 12:97850844-97850866 CGTTGTTCTCTGTGTATAAATGG + Intergenic
1101126911 12:101644859-101644881 CTGACTTTTCTGAGAATAAAAGG + Intronic
1102810517 12:115820178-115820200 CAGGCTGCTCTGAGGATAAAAGG + Intergenic
1103729478 12:123017536-123017558 CAGGTTTTTCTGTGAATACATGG - Intronic
1104658571 12:130592379-130592401 CTTGCTTCTCTGTGTAAAAATGG + Intronic
1105059630 12:133137039-133137061 CAGGCTTCTGTGTGACTAAATGG - Intronic
1112849129 13:103682728-103682750 CAGTCTTATATGTGAATAAAAGG + Intergenic
1113013841 13:105804980-105805002 CTGGTTTCTCTGTGAATGCAGGG + Intergenic
1113272206 13:108685957-108685979 AGACCTTCTCTTTGAATAAACGG + Intronic
1117791730 14:59348983-59349005 TGGGGTTCTCTGTGTATGAACGG + Intronic
1118495709 14:66306328-66306350 AGGGCTTCTCTGTGTAGGAAGGG + Intergenic
1120835576 14:89035924-89035946 CGGGCAGCTCTGTCAACAAAGGG - Intergenic
1124642894 15:31408283-31408305 CGGTCTTCTCTGTGACTACCTGG - Intronic
1129748496 15:78042520-78042542 TGGGCTTCTCAGTAAAGAAAGGG - Intronic
1130081352 15:80736728-80736750 CGTGCTTCTCTGAAGATAAATGG + Intronic
1131897656 15:97051418-97051440 TTTGCTTCTTTGTGAATAAAGGG + Intergenic
1135608440 16:23843378-23843400 CGGGCTTCTCTGTGAATAAAAGG + Intronic
1139156361 16:64447564-64447586 AGGGCTTCTCTATGAGAAAAGGG + Intergenic
1140078614 16:71723874-71723896 CGGGCGTCTCTGTGAATCCTGGG - Intronic
1140881951 16:79206441-79206463 TAGGCTTCTCTCTAAATAAATGG + Intronic
1143299541 17:5899507-5899529 AGGTTTTCTCTGTAAATAAAAGG + Intronic
1145410422 17:22656164-22656186 GGGGCTTCACTGTAAATAAGAGG - Intergenic
1147480298 17:40755056-40755078 CTGGCTTCACTGTGAATGAGCGG - Exonic
1147556103 17:41480121-41480143 CGGGATTCTCTGGTCATAAATGG + Intronic
1149291674 17:55223941-55223963 CCTTCTTCTCTGGGAATAAAGGG - Intergenic
1151814847 17:76466736-76466758 CGGGCTTCCGTGTGGATTAAAGG + Intronic
1152592114 17:81218812-81218834 AGGGTTCCACTGTGAATAAAAGG - Intronic
1159538527 18:69746038-69746060 AGAGCTGCTCTTTGAATAAAAGG - Intronic
1163356774 19:16817756-16817778 ACTGCTTCTCTGTGAATCAAGGG + Exonic
1165598171 19:37029092-37029114 CGGGCTTCACTGTAACTAAGAGG + Intronic
1165720958 19:38079496-38079518 CGGGCTTCTCTGTCTCTATAGGG + Intronic
928376068 2:30775875-30775897 TGGGGTTCTCTGTGAGTACAGGG - Intronic
933655416 2:84882527-84882549 CGGGCTTCTCTGTGGCCACACGG - Intronic
933846623 2:86332058-86332080 GGGGCTTCCCTGGGAATACAGGG - Intronic
936627055 2:114159387-114159409 TGAGCTTTTCTGTGAAGAAAGGG - Intergenic
940117379 2:150223951-150223973 TAGGCTTATTTGTGAATAAATGG - Intergenic
941147914 2:161875879-161875901 AGGGATTCTCTGGGAAGAAATGG - Intronic
945685310 2:212961758-212961780 CATGCTTCTCTGTGAATCAAGGG + Intergenic
945775680 2:214103741-214103763 CAGTCTTCTCTCTGAGTAAATGG - Intronic
947513900 2:230784514-230784536 CGGGATTCCCTGTGTTTAAATGG + Intronic
1168977147 20:1975357-1975379 GGGGCTTGTCTGTTAATTAAAGG - Intergenic
1171541695 20:25963114-25963136 GGGGCTTCACTGTAAATAAGAGG - Intergenic
1171799370 20:29597195-29597217 GGGGCTTCACTGTAAATAAGAGG + Intergenic
1171844686 20:30259272-30259294 GGGGCTTCACTGTAAATAAGAGG - Intergenic
1173148563 20:40546415-40546437 AGGTCTTCTCTGTGAGTACAAGG + Intergenic
1173406283 20:42768477-42768499 CTGGCTTCTGTGTGAACAACAGG + Intronic
1181635703 22:24173489-24173511 CAGGCTCCTCTGGGAACAAATGG - Intronic
1181727243 22:24820110-24820132 CTGGCTTCTCTGGGGATAGAAGG + Intronic
950050778 3:9987254-9987276 ACGGCTTCTCGGTGAGTAAATGG + Intronic
950083323 3:10239164-10239186 CAGGTTTCTCTGTGAAAAACTGG - Intronic
950618527 3:14182557-14182579 CAGGGTTCTCTATGAACAAATGG - Intronic
951643343 3:24860450-24860472 ATTGCTTCTCTGTGATTAAAGGG + Intergenic
956174065 3:66456895-66456917 CAGGCTCCTCTATTAATAAAAGG - Intronic
967371364 3:188750169-188750191 CGGGCTTCTCTGTCATGAATGGG - Intronic
969950458 4:10830184-10830206 CTGGCTTCACTGTGAAGATATGG - Intergenic
969955727 4:10888877-10888899 AGGGCTTCTCTCTGAAAAGATGG - Intergenic
971539627 4:27800052-27800074 CGGGCTCCTGAGTGAAGAAAAGG - Intergenic
972449931 4:39186799-39186821 AAGGCTTCTCTGTGAGTATATGG - Intronic
974266669 4:59594829-59594851 GTGGCTTCTCTGTGAAGAATCGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
978510251 4:109509146-109509168 ATGACTTCTCTGGGAATAAAAGG + Intronic
979382902 4:120029570-120029592 AAGGCTTCTCTTTGATTAAAAGG + Intergenic
979668660 4:123339924-123339946 CCGGCTTCTCTGTGAAGCACAGG - Intergenic
999245918 5:150154727-150154749 GGGGCTCCTCTGTGAAGAAGGGG - Intronic
1002425150 5:179170583-179170605 TGTGCTTCTCTGTGAGCAAAAGG + Intronic
1003975560 6:11340291-11340313 TGATCTACTCTGTGAATAAAGGG - Intronic
1004215072 6:13694797-13694819 AGGGCTACTCAGTGACTAAAGGG - Intronic
1010144650 6:72653000-72653022 TGTGATTGTCTGTGAATAAATGG - Intronic
1017242220 6:152183205-152183227 CTTGCTGCTCTGTGAATGAAAGG - Intronic
1017868376 6:158464737-158464759 CAGGCTTCAGGGTGAATAAATGG + Intronic
1020962906 7:14828306-14828328 CTTGCTTCTCTTTGAATTAATGG - Intronic
1022517325 7:30984246-30984268 CGGGCTCCTCTGTGAGAAAGAGG + Intronic
1025293141 7:57749444-57749466 GGGGCTTCACTGTAAATAAGAGG - Intergenic
1026522551 7:71130132-71130154 AAGGCTCCTCTGTGAATACAGGG + Intergenic
1032080611 7:128856731-128856753 TGTGCTTGTCTGTGGATAAAGGG - Exonic
1038424947 8:27458915-27458937 CCAGCTTCTCTGTGCATCAAGGG - Exonic
1038938312 8:32276777-32276799 CTGGCTGCTCTGTGAAAATAGGG + Intronic
1039283811 8:36016958-36016980 TGGGCTTATGTGTGAAAAAAGGG + Intergenic
1044094993 8:88052503-88052525 CTGGCTTCTATGTGAAGAATGGG - Intronic
1046538752 8:115551029-115551051 CAGCCTTCACTCTGAATAAAAGG + Intronic
1046815287 8:118576615-118576637 CTGACTGCTCTGTGAGTAAAGGG + Intronic
1048044369 8:130759362-130759384 CTGGCTTCTCTGTGACTCAGAGG - Intergenic
1048917724 8:139200667-139200689 CAGGCTTCTCTGTGAAGTAATGG + Intergenic
1052978242 9:34427983-34428005 CAGCCTTCTTTGTGACTAAAGGG + Intronic
1054163400 9:61696540-61696562 GGGGCTTCACTGTAAATAAGAGG + Intergenic
1057404050 9:94751661-94751683 TGGGCTTCTGTGATAATAAAAGG + Intronic
1057522116 9:95768457-95768479 CAGGCTTCTCTGAGATTAATTGG - Intergenic
1058699311 9:107587740-107587762 CGGGCTTCTGTGTGTATAAAGGG + Intergenic
1061968996 9:134033697-134033719 CGGGCTTCTCTGTGGAGACATGG + Exonic
1187803688 X:23094657-23094679 CTTGCTCCTCTGTGAATCAAGGG - Intergenic
1189093122 X:38108517-38108539 AAGACTTCGCTGTGAATAAAAGG - Intronic
1191858631 X:65647934-65647956 CTGGCTTCTTTGTGGACAAATGG + Intronic
1193021204 X:76795838-76795860 TCGGCTTCACTGTGAATTAATGG - Intergenic