ID: 1135611748

View in Genome Browser
Species Human (GRCh38)
Location 16:23873596-23873618
Sequence AAATGCTATCTGTCCCAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135611748_1135611751 3 Left 1135611748 16:23873596-23873618 CCCAACTGGGACAGATAGCATTT 0: 1
1: 0
2: 0
3: 18
4: 144
Right 1135611751 16:23873622-23873644 AAGTCTAATTCCAAACTTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 292
1135611748_1135611750 2 Left 1135611748 16:23873596-23873618 CCCAACTGGGACAGATAGCATTT 0: 1
1: 0
2: 0
3: 18
4: 144
Right 1135611750 16:23873621-23873643 TAAGTCTAATTCCAAACTTCTGG 0: 1
1: 0
2: 1
3: 10
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135611748 Original CRISPR AAATGCTATCTGTCCCAGTT GGG (reversed) Intronic
901388328 1:8925820-8925842 AAATGTTATCTGATCCTGTTTGG - Intergenic
902665153 1:17932307-17932329 AAATGCTTTCTGATACAGTTTGG - Intergenic
903255904 1:22099462-22099484 AAATCCTATCTGTCTGATTTTGG + Intergenic
905855687 1:41310675-41310697 AAATGATATCAGTCCCAGAATGG - Intergenic
908765804 1:67553770-67553792 AAAGGCTATCAGGCACAGTTGGG + Intergenic
908922565 1:69213057-69213079 AAATTCTCTCTGTTACAGTTTGG + Intergenic
917611335 1:176691963-176691985 AAATGCAATCTGTTCCAGAAAGG - Intronic
918789401 1:188807076-188807098 AGATGCTATCTGTACCTTTTTGG + Intergenic
919210145 1:194471828-194471850 CAATGCTATGTTTCCAAGTTAGG + Intergenic
920223928 1:204424443-204424465 CAAGGCTTCCTGTCCCAGTTAGG + Exonic
924296052 1:242587432-242587454 AAATGGCAGCAGTCCCAGTTAGG + Intergenic
1063265375 10:4443135-4443157 AAATTTTACCTGTCCCATTTAGG + Intergenic
1066521090 10:36220337-36220359 TAATTCTATATGTCCAAGTTTGG - Intergenic
1067927197 10:50521821-50521843 AAAGTCTATCTGCCCCAGCTTGG + Intronic
1069215602 10:65815147-65815169 GAATGCTATCTGCCCCATGTAGG - Intergenic
1071083161 10:81837234-81837256 AATTGGTATCTGTGGCAGTTAGG - Intergenic
1072072785 10:91935992-91936014 AATTTGAATCTGTCCCAGTTTGG + Intronic
1072276249 10:93826313-93826335 AAATGATATGTGCCCTAGTTTGG + Intergenic
1072489239 10:95887517-95887539 AACTTCTAGCTGTACCAGTTTGG - Intronic
1073805087 10:107088694-107088716 ACATGCTAACTGTCCCACTTTGG - Intronic
1077811570 11:5643207-5643229 AAGTGATATCTGTGCCAATTTGG + Exonic
1086368108 11:86128931-86128953 AAATGCTATCTTTCCCTCTGAGG - Intergenic
1087227323 11:95615645-95615667 AAATGCTATGTGGCAGAGTTTGG - Intergenic
1091870697 12:3888506-3888528 AAATGCTTTCTTTCACAGATGGG - Intergenic
1092618449 12:10236913-10236935 AAATTCTTTCTGTCTCAGTCAGG + Intergenic
1094224411 12:28029133-28029155 AAATGCATTCAGTCCCTGTTAGG - Intergenic
1094793513 12:33942506-33942528 AAACTCTATCTCTCCCAGGTTGG + Intergenic
1097964678 12:65566148-65566170 AAATGCTATCTCTTCCATTCTGG - Intergenic
1100945571 12:99779084-99779106 AAATGCTTTCTCTTCCTGTTTGG - Intronic
1105080881 13:16115608-16115630 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105081103 13:16119036-16119058 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105081308 13:16122460-16122482 ACATGCTATGTGGGCCAGTTTGG + Intergenic
1105081770 13:16129313-16129335 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105081988 13:16132741-16132763 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105082214 13:16136166-16136188 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105082452 13:16139592-16139614 ACATGCTATGTGGGCCAGTTTGG + Intergenic
1105082901 13:16146443-16146465 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105083129 13:16149870-16149892 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105083357 13:16153296-16153318 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105083811 13:16160147-16160169 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105084032 13:16163573-16163595 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105084147 13:16165732-16165754 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105084539 13:16172584-16172606 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105085109 13:16182858-16182880 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105085299 13:16186283-16186305 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105085494 13:16189708-16189730 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105085689 13:16193131-16193153 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105085887 13:16196560-16196582 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105086077 13:16199984-16200006 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105086277 13:16203409-16203431 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105086671 13:16210260-16210282 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105086865 13:16213685-16213707 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105087059 13:16217111-16217133 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105087253 13:16220533-16220555 ACATGCTATATGGGCCAGTTTGG + Intergenic
1105087450 13:16223959-16223981 AAATGCTATATGGGCCAGTTTGG + Intergenic
1106701737 13:32236052-32236074 AAATGCTATCTTTGCATGTTTGG + Intronic
1108143227 13:47448562-47448584 CAATCCTATCTGTTCCAGCTAGG + Intergenic
1110079596 13:71293485-71293507 AAATGCTGTCTGCCACACTTTGG + Intergenic
1110283663 13:73724584-73724606 AAATATTATCTGTCTCAGGTGGG - Intronic
1111662055 13:91223918-91223940 AATTGATATAGGTCCCAGTTAGG - Intergenic
1111812710 13:93111558-93111580 AAATGATATCTGTCTATGTTCGG - Intergenic
1121399851 14:93664628-93664650 GAATGGTATCTGTCTCAGTTTGG + Intronic
1126262272 15:46707364-46707386 AAATGCTATCTGTACAATATCGG - Intergenic
1127023567 15:54778164-54778186 AGATGTCATCTTTCCCAGTTAGG - Intergenic
1135378053 16:21967475-21967497 AAATGCTATCCTTTCCAGATGGG - Intronic
1135611748 16:23873596-23873618 AAATGCTATCTGTCCCAGTTGGG - Intronic
1139557841 16:67723950-67723972 AGGGGCTCTCTGTCCCAGTTGGG - Exonic
1139974308 16:70796717-70796739 AAGTGCTGTCTGCCCCATTTTGG - Intronic
1143943966 17:10573053-10573075 AAATGCTTTCTGTCTCTGGTGGG - Intergenic
1144285196 17:13767531-13767553 AAATTGAATCTGGCCCAGTTAGG + Intergenic
1151093502 17:71469869-71469891 AAAAGCTAACTGTCCCATTTTGG + Intergenic
1153348120 18:4050273-4050295 AAATGCTATCATTCCAAGTCAGG + Intronic
1156971212 18:43158870-43158892 AAATACAATCTGCCTCAGTTTGG + Intergenic
1163690684 19:18736727-18736749 AAGTGCTGTCTGTGCCAGTCAGG - Intronic
1164106605 19:22112260-22112282 ATATGCTATCAATCACAGTTAGG - Intergenic
1164180905 19:22817739-22817761 AAATGCTATCTCTCACAGAAAGG + Intergenic
1167196397 19:48031909-48031931 ATATGCTGTATGTCCCAGTATGG - Intronic
937383718 2:121406408-121406430 AAATGTTATCAGTCTTAGTTTGG - Intronic
937430347 2:121832687-121832709 AGCCGCTAACTGTCCCAGTTTGG - Intergenic
940065612 2:149624697-149624719 AACTGCTACCTGACCCAGGTTGG - Intergenic
940536094 2:154946512-154946534 AAATTCTAATTTTCCCAGTTAGG + Intergenic
941650010 2:168082400-168082422 AAATGGTATCTGTCCCTACTAGG + Intronic
944082815 2:195808169-195808191 AATTGCTATATATCCCAGATGGG + Intronic
946086466 2:217178428-217178450 AAATTCTCAGTGTCCCAGTTGGG - Intergenic
946594017 2:221285825-221285847 GACTGCTCTCAGTCCCAGTTTGG - Intergenic
948266637 2:236639930-236639952 AAATCCTATCTGTTCAAGTGTGG + Intergenic
1173311082 20:41896512-41896534 AAAGCCTTTCTGTCACAGTTTGG + Intergenic
1173360764 20:42342442-42342464 GAATGCTATGGGTCCCACTTTGG - Intronic
1175417129 20:58809166-58809188 AAATGCTATCTTTGCAAGGTGGG + Intergenic
1176877803 21:14150505-14150527 AAATACTGTCTGTGTCAGTTTGG + Intronic
1180023786 21:45146933-45146955 AAATTGTTTCTGTCCCTGTTAGG + Intronic
949501213 3:4681659-4681681 AAATCCTTTCTGTCCTAGGTGGG - Intronic
951271812 3:20634348-20634370 AAATGCTATCTTATTCAGTTTGG - Intergenic
952285418 3:31963691-31963713 AAATGTGATTTGTTCCAGTTAGG - Intronic
952719008 3:36513095-36513117 AACTGCTGTCTTTGCCAGTTGGG - Intronic
952824721 3:37515326-37515348 AGATGCTAGGTATCCCAGTTGGG + Intronic
953094568 3:39762244-39762266 AAATGCTATGTTTCCCAGGCTGG + Intergenic
953273055 3:41464947-41464969 AAATACTTTCTGTCCCAGCAGGG - Intronic
955159016 3:56446451-56446473 GAAGGCTATATGTCCTAGTTGGG + Intronic
956559479 3:70558633-70558655 AAAAACTATCTGACCCATTTTGG + Intergenic
959809678 3:110601909-110601931 AAATGCAGTATGTCCCAGTGGGG + Intergenic
960499807 3:118423259-118423281 GAATGCTATCTGTCCCATATGGG - Intergenic
961523542 3:127482453-127482475 AATTGCTATCTGTCCCTTTTCGG + Intergenic
962943388 3:140145849-140145871 TAATGCCATCTGTCCCACATGGG - Intronic
963412283 3:144945553-144945575 AATTTCTCTCTGTCCCAGTTTGG + Intergenic
963945750 3:151144280-151144302 ACATGCTAACTGTCGCATTTAGG - Intronic
965792728 3:172406830-172406852 AAATGCTTTCTGTCCTAGGTGGG - Intergenic
966145826 3:176810950-176810972 AAATGCTAATTGGCCCAGTTTGG + Intergenic
968247394 3:197166123-197166145 AGATGCTATCTGTCTCACTTGGG - Intronic
970998685 4:22297564-22297586 GAATGATATATGTCTCAGTTAGG - Intergenic
971163318 4:24156516-24156538 AAATGCTAGGTGTCCCATTATGG + Intergenic
971471187 4:27028732-27028754 AAATGGTATCTCACCCAGGTTGG - Intergenic
971566404 4:28147995-28148017 TAATTGTATCTGTGCCAGTTAGG + Intergenic
978343119 4:107738418-107738440 AAATGCTACCTGCCCCAGGAGGG + Intergenic
978689973 4:111496335-111496357 ACATGCTATCTGACTCAGTTAGG + Intergenic
978690609 4:111504890-111504912 GGATGCTATCTGTCTCACTTTGG + Intergenic
978971308 4:114809802-114809824 TGATTCTTTCTGTCCCAGTTTGG - Intergenic
981163530 4:141528662-141528684 AAATTCTATGTGTCTCTGTTAGG - Intergenic
984032094 4:174617025-174617047 AAATTCTATCTCTGCCATTTGGG + Intergenic
984344396 4:178504046-178504068 AAATGAAATGTGTCACAGTTGGG + Intergenic
984644801 4:182208402-182208424 AAATACTATCTGTCCCTTTACGG - Intronic
985316440 4:188663179-188663201 AAATGTTTTCTTTCACAGTTCGG + Intergenic
987628879 5:20441555-20441577 AAATGCTAGCTGTAACAATTTGG - Intronic
987908633 5:24112768-24112790 AAATGCTAACTGTTCCAGGTTGG + Intronic
989792417 5:45421682-45421704 GAATGCTATCTTAACCAGTTTGG + Intronic
993798152 5:92296357-92296379 AAATGCTACCTTTCCAAGATTGG + Intergenic
996353641 5:122573548-122573570 TAAAGCTATTTGTCCCAGTTTGG - Intergenic
997250614 5:132386039-132386061 AAATGCTCTCTGCTCCACTTGGG - Intronic
1001141763 5:169150452-169150474 AAATGGTCTCTGTCCCAGACTGG + Intronic
1005601079 6:27426521-27426543 AAATGGTATCTCTGGCAGTTGGG - Intergenic
1007345354 6:41224659-41224681 ATATGCTATCTGTCAGAGTGAGG - Intergenic
1008604835 6:53130338-53130360 AAATGATAGCTGTCCCAGGGTGG - Intronic
1009492749 6:64312362-64312384 AAATGGTATCAGCCCCAGTCAGG + Intronic
1014993835 6:128116491-128116513 AAATCTTATCTGTCCCTCTTTGG - Intronic
1015776460 6:136819896-136819918 AAATGGTTTCTGTCTCAGTTGGG + Intergenic
1026057380 7:66996532-66996554 AAATGCTATGTGGGCCTGTTTGG - Intronic
1026720729 7:72828500-72828522 AAATGCTATGTGGGCCTGTTTGG + Intergenic
1028069850 7:86437692-86437714 AAGTGGTATCTATCACAGTTTGG - Intergenic
1028510344 7:91618584-91618606 AAATGCTATTTATAACAGTTTGG + Intergenic
1028958877 7:96726299-96726321 AATTGCTATCAGTCCCAATTAGG - Intergenic
1030796667 7:113797124-113797146 AAATGCCATATGCCCCAGTTTGG + Intergenic
1031031728 7:116742884-116742906 GAATGCTAACTGTCACAGTCTGG - Intronic
1037468208 8:19181794-19181816 TACTGCTAGCTGTCCCAGTATGG - Intergenic
1039172817 8:34767544-34767566 AAATGCTAGCAGCCTCAGTTAGG - Intergenic
1043725815 8:83610107-83610129 AAATTTTTTCTGTCACAGTTCGG + Intergenic
1048619067 8:136111633-136111655 ATATTCTATCTGCCACAGTTGGG + Intergenic
1054915963 9:70495509-70495531 AAATGCTAATTGTTCCAGGTTGG + Intergenic
1055598644 9:77892191-77892213 AAACGTTATCTGTCACAGTGGGG + Intronic
1057923482 9:99120191-99120213 AAATCCTATCTTTGCCAGTCAGG - Intronic
1058616816 9:106838360-106838382 AAATCCTATCTTTCCCTTTTTGG - Intergenic
1059934010 9:119289659-119289681 AAATGCTATCTGTGGTAGCTGGG - Intronic
1060769224 9:126318887-126318909 AAATGCTCTCAAACCCAGTTAGG - Intergenic
1061141123 9:128767538-128767560 AAATGTTATCTGTGGCAGCTGGG - Intronic
1186789337 X:12981792-12981814 AAATGCTATCTATCCAGGTTGGG - Intergenic
1189905597 X:45755826-45755848 AACTGCTATGTCTCCCTGTTGGG + Intergenic
1192125995 X:68501267-68501289 AAATGCTATCATGTCCAGTTGGG + Intronic
1194159194 X:90430061-90430083 AACTGCTATGTGTCAGAGTTTGG - Intergenic
1198253920 X:134908503-134908525 AAATGCTTGCTGGCACAGTTAGG - Intronic
1198722672 X:139640161-139640183 AAATGTTATTTGTCCCATTTTGG - Intronic
1199556769 X:149117750-149117772 TAATGGTATGCGTCCCAGTTAGG - Intergenic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic
1201859427 Y:18579754-18579776 AAATGCTATATGTAACTGTTGGG + Intronic
1201873894 Y:18740627-18740649 AAATGCTATATGTAACTGTTGGG - Intronic