ID: 1135614940

View in Genome Browser
Species Human (GRCh38)
Location 16:23903071-23903093
Sequence TTGGGGAGGCTGAAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8159
Summary {0: 4, 1: 37, 2: 424, 3: 2158, 4: 5536}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135614940_1135614946 -7 Left 1135614940 16:23903071-23903093 CCCTCCTGCTTCAGCCTCCCCAA 0: 4
1: 37
2: 424
3: 2158
4: 5536
Right 1135614946 16:23903087-23903109 TCCCCAAGTTCTGGGATTACAGG 0: 28
1: 7592
2: 310595
3: 266624
4: 153906

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135614940 Original CRISPR TTGGGGAGGCTGAAGCAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr