ID: 1135618662

View in Genome Browser
Species Human (GRCh38)
Location 16:23934049-23934071
Sequence AAGAAAGTCAAATGGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 380}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135618662_1135618666 5 Left 1135618662 16:23934049-23934071 CCATCCACCCATTTGACTTTCTT 0: 1
1: 0
2: 3
3: 38
4: 380
Right 1135618666 16:23934077-23934099 GAAACTTTCCCTTTGATCAATGG 0: 1
1: 0
2: 2
3: 26
4: 575
1135618662_1135618667 8 Left 1135618662 16:23934049-23934071 CCATCCACCCATTTGACTTTCTT 0: 1
1: 0
2: 3
3: 38
4: 380
Right 1135618667 16:23934080-23934102 ACTTTCCCTTTGATCAATGGAGG 0: 1
1: 0
2: 0
3: 10
4: 141
1135618662_1135618670 21 Left 1135618662 16:23934049-23934071 CCATCCACCCATTTGACTTTCTT 0: 1
1: 0
2: 3
3: 38
4: 380
Right 1135618670 16:23934093-23934115 TCAATGGAGGATTTCCTTCCTGG 0: 1
1: 0
2: 0
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135618662 Original CRISPR AAGAAAGTCAAATGGGTGGA TGG (reversed) Intronic
900721504 1:4178840-4178862 AAGAAGGTGAAATGGTTAGAAGG + Intergenic
901353323 1:8618841-8618863 AAGAAAATAAATTTGGTGGAGGG + Intronic
901700258 1:11041517-11041539 TAGATAGACAAATGGGTGGATGG + Intronic
902436569 1:16401798-16401820 AAGAAAATCAAGTGGGTTGCGGG - Intronic
902527399 1:17068180-17068202 AAGAAAGTCAAGGCAGTGGAAGG + Exonic
902681479 1:18046945-18046967 AAGATAGACAGATGGATGGATGG + Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
906562032 1:46765486-46765508 AACAAAGCTAAGTGGGTGGAGGG - Intronic
907217472 1:52877340-52877362 AAGAAAGAAAAAAGGGTAGAAGG - Intronic
907992555 1:59596894-59596916 AAGAAAGTATGATGGCTGGATGG - Intronic
908231813 1:62112682-62112704 AAAAGAGTCAAATGAGGGGAAGG - Intronic
908677883 1:66626571-66626593 AAGATGGTCAAATAAGTGGAAGG - Intronic
909046341 1:70714535-70714557 AAGAAATTCAAAGGTGGGGAAGG - Intergenic
909237485 1:73172046-73172068 AACAAAGTTAAATGACTGGAAGG - Intergenic
909363166 1:74788793-74788815 AAGAAAAGCAAATGGTAGGAAGG + Intergenic
910107649 1:83648645-83648667 CAGAAAGACAACTAGGTGGAGGG + Intergenic
910357882 1:86380810-86380832 TAGAAAGAAAAATTGGTGGAAGG + Intronic
910440891 1:87250665-87250687 AAGGAAGACAAATGCTTGGAAGG + Intergenic
910738315 1:90487114-90487136 AAGCAAGTCACAAGGCTGGAGGG + Intergenic
911188213 1:94924631-94924653 AAGAAAAAAAAATGGGGGGAAGG + Intronic
911600342 1:99841669-99841691 AAGCAAGTCCAATAGGTTGAGGG + Intergenic
911827736 1:102508706-102508728 AAGAAAGTAAATGGGGTAGAAGG - Intergenic
912272678 1:108226996-108227018 AAGAAAGTCCAAAGGGTGAGGGG + Intronic
913162395 1:116156066-116156088 AACAAATTCTAATGGTTGGAAGG - Intergenic
913599232 1:120406929-120406951 AAGAAAGTCCAACGGGTAAAGGG - Intergenic
914310466 1:146461519-146461541 AAGAAAGTCCAATGGGTAAAGGG - Intergenic
914379270 1:147101775-147101797 AAGAAAGTCCAAGGGGTAAAGGG + Intergenic
914591643 1:149111623-149111645 AAGAAAGTCCAACGGGTAAAGGG + Intergenic
915507200 1:156365450-156365472 AGGAAGGGCAAATGGGTGGCTGG - Intronic
917566266 1:176215344-176215366 AAGTAAGGCAAATGGATGGTGGG - Intergenic
918712716 1:187751012-187751034 AAGAAAGAGAAAGGAGTGGAAGG - Intergenic
919229999 1:194762282-194762304 AAGAAAGTCATATTGTTGGCTGG - Intergenic
919391891 1:196995848-196995870 AAGAAAATACAATGTGTGGATGG + Exonic
920206677 1:204297346-204297368 AAGAAATTCTACTGGGTGTAAGG + Intronic
920586232 1:207164706-207164728 AAGAAAATCATATAGATGGATGG + Intergenic
920726153 1:208437021-208437043 AAGAAAGCAAAATGAATGGAGGG - Intergenic
921066240 1:211624202-211624224 ATGAAAGAAAAATGGGTGGGGGG + Intergenic
922517864 1:226222184-226222206 AAGAAAGGAGAAGGGGTGGAAGG + Intergenic
922635110 1:227160421-227160443 TAGATAGACAAATGGATGGATGG + Intronic
922862265 1:228829664-228829686 AAGAAAGACAGAGGGGAGGAAGG + Intergenic
923302410 1:232653741-232653763 AAGATATTCAAATGGAAGGAAGG - Intergenic
923502731 1:234579400-234579422 CAGAAAGTCAGATGGCTGAAAGG - Intergenic
923813394 1:237345974-237345996 AACAAATTCAAGTGGATGGATGG - Intronic
924285332 1:242480242-242480264 AAGAAAATCCAATTGGTGTAGGG + Intronic
1062812572 10:477552-477574 AAGGAAGGTAGATGGGTGGAAGG + Intronic
1063069527 10:2647358-2647380 AAGGATGACAGATGGGTGGATGG - Intergenic
1063636247 10:7785822-7785844 AAAAAAGAAAAAGGGGTGGAGGG + Intronic
1064363877 10:14689988-14690010 AAGAAAGACAAAAGGAAGGAAGG + Intronic
1064926683 10:20577061-20577083 AAGAAAATTAAATAGGTAGATGG + Intergenic
1065023565 10:21520231-21520253 AAGAAAGCCAACTCGCTGGATGG - Intronic
1066271608 10:33829529-33829551 TAGACAGTAAACTGGGTGGATGG - Intergenic
1066277045 10:33879581-33879603 AAGAAAGTCACAGGGGTGGGAGG - Intergenic
1067927164 10:50521303-50521325 AAAAAAGTCAAATGAATGAATGG - Intronic
1068673646 10:59748120-59748142 AAGCAAGTCAAGTTGTTGGAAGG + Intergenic
1069913882 10:71775438-71775460 AAGGAAGTGAAAAGGGGGGAGGG - Intronic
1069958717 10:72067395-72067417 AAGAACTTAACATGGGTGGAGGG - Intronic
1070190760 10:74109930-74109952 AATAAAGGCAAATAGGTGGTGGG - Intronic
1070971986 10:80575059-80575081 AAAAAAATAAAATGTGTGGAGGG - Intronic
1071009525 10:80921487-80921509 AGGAACATCAAAAGGGTGGAAGG - Intergenic
1071467407 10:85954044-85954066 AATCAAGTCAAATGAGAGGAGGG + Intronic
1071978090 10:90975585-90975607 AAGAAAGTCAAAGGTGGGGTTGG + Intergenic
1072715888 10:97752347-97752369 CAGAAAGTCAAATGCCTGCATGG - Intronic
1074758102 10:116642575-116642597 AAGTAAATCAGATGGATGGATGG - Intronic
1075426077 10:122342626-122342648 AAGGAAGACAATTGGGTGTATGG - Intergenic
1075998990 10:126900614-126900636 AATAAAGTCAAAGTGGAGGAAGG - Intergenic
1076992355 11:282100-282122 CAGAAAGTAAAATGGGAAGAAGG - Intronic
1077280523 11:1742999-1743021 ATGAAAGATAAATGGATGGATGG + Intronic
1077311917 11:1892625-1892647 AAAACAGACAAATGGGTGGATGG + Intergenic
1077635401 11:3838581-3838603 AAGAGAGACAAGTGGTTGGAAGG + Intronic
1078932591 11:15923886-15923908 AGGAAAGACCAATGGGAGGAAGG - Intergenic
1079371236 11:19854621-19854643 AAAAACGTCAAATGTGTGCAGGG - Intronic
1079803700 11:24902492-24902514 AAGAAAGTTAAATGGTTCTATGG + Intronic
1081301381 11:41456715-41456737 AAGAAAGGTAAATGGGGGTAGGG - Intronic
1085746618 11:79120372-79120394 CAGACAGACAGATGGGTGGATGG - Intronic
1087008556 11:93492515-93492537 AAGAAAGACAAAAGAGTGTAAGG + Intronic
1088360645 11:108985571-108985593 AAGAAAATCACATGGGTGCCTGG - Intergenic
1088779303 11:113119038-113119060 AAAGAAGGCAAATGGGAGGAAGG + Intronic
1089042698 11:115468577-115468599 AAGAAAGGCAAAAGGGTCTATGG + Intronic
1089417849 11:118307432-118307454 AGGAAAGTCAAAGGGGTAGATGG - Intronic
1089864810 11:121622521-121622543 AAGAAAGACAAATGGGCTGGAGG + Intronic
1090559754 11:127919200-127919222 AAGAAAGCCAAATGGAAGGATGG + Intergenic
1091208235 11:133835072-133835094 AAGGAGCTCAAATGGGTAGAAGG - Intergenic
1091327648 11:134703165-134703187 ATGAAACTGAGATGGGTGGAAGG - Intergenic
1091389953 12:120020-120042 ATAAATGTTAAATGGGTGGATGG - Intronic
1092886533 12:12929316-12929338 AAGAAAGGGAGATGGGGGGAAGG + Intergenic
1093136963 12:15463712-15463734 ATGAAAGTAAAAAGGGAGGAAGG - Intronic
1093138608 12:15480405-15480427 AAGAAATTCACTTGGTTGGATGG + Intronic
1093191803 12:16083286-16083308 AACCAAGATAAATGGGTGGAGGG + Intergenic
1093355273 12:18159341-18159363 AAGAGAGGCTTATGGGTGGACGG - Intronic
1094478018 12:30856637-30856659 CATCAAGTCAAATGGATGGAGGG + Intergenic
1094696047 12:32819889-32819911 AAGAAAATTAAATGGGGGGGGGG - Intronic
1095160520 12:38909003-38909025 AAGAAAGACAAATAGGTAAATGG - Intergenic
1096548899 12:52359477-52359499 AGCAAAGGCAAATGGGAGGAGGG + Intergenic
1096855433 12:54478591-54478613 AAGAAAGGGAAAGGGGAGGAAGG - Intergenic
1097269132 12:57763686-57763708 AAGAGATGCAAATGGGTGGGGGG + Exonic
1097489873 12:60253587-60253609 AAAAAAGTGAAATAGGTGAATGG - Intergenic
1098372304 12:69773379-69773401 AAGAAAGACAAATGGGTAGAAGG - Intronic
1098760764 12:74422394-74422416 AAGAAAGTCCAATGGGCCAATGG - Intergenic
1099473420 12:83077923-83077945 AAGAACCTAAGATGGGTGGAAGG + Intronic
1100099844 12:91090473-91090495 ATGAAAGTCTCATGGGTGGGGGG + Intergenic
1101249530 12:102918117-102918139 AAGAAAGTAAAGTAGGGGGATGG + Intronic
1102918973 12:116777597-116777619 CAGAAAGGCAAATATGTGGAAGG - Intronic
1104060352 12:125262832-125262854 CAGAAAGTCAAATGCCTGCAGGG - Intronic
1104092329 12:125527054-125527076 TAGAAGGGTAAATGGGTGGATGG - Intronic
1104092349 12:125527122-125527144 TAGAAGGGTAAATGGGTGGATGG - Intronic
1104092468 12:125527496-125527518 TGGAAAGGTAAATGGGTGGATGG - Intronic
1104188105 12:126451839-126451861 AAGAAAAACAAATGGGAGAAAGG - Intergenic
1104291934 12:127477737-127477759 AGAAAAGACAAATGGGTGGATGG + Intergenic
1104536088 12:129619561-129619583 TAAAAAATCAAATGGGTGGTGGG - Intronic
1105267166 13:18830920-18830942 AAGAATCTCAAATGGGAAGAAGG - Intergenic
1105412545 13:20183341-20183363 AAGAAAGAAAAATGGGGGGAAGG + Intergenic
1105650318 13:22370287-22370309 TAAACATTCAAATGGGTGGAAGG + Intergenic
1105862890 13:24432517-24432539 AACAAAGCAAAAGGGGTGGAAGG - Intronic
1106655110 13:31734840-31734862 AAGTAAGTCTAAAGGGTAGAAGG - Intergenic
1107209311 13:37833788-37833810 TGGAAAGCCAAATGGGTGGATGG - Intronic
1108761615 13:53573239-53573261 AAGAAAGGCATATGGATTGAGGG + Intergenic
1110622823 13:77618169-77618191 AAGAAAGAAAAAAGGGAGGAAGG - Intronic
1111886990 13:94034058-94034080 AAGAAAGACAGAGGGTTGGATGG - Intronic
1112167255 13:96932636-96932658 AAGAAAGTCAAACTGGTCTATGG - Intergenic
1112680100 13:101754256-101754278 AGGAAACACACATGGGTGGATGG - Intronic
1113329334 13:109313308-109313330 CAGATAGACAAATGGATGGATGG - Intergenic
1113636501 13:111922593-111922615 TAGACAGACAGATGGGTGGATGG + Intergenic
1116187147 14:41611034-41611056 AAGAAAGTGAAATAGGTGGGAGG - Intronic
1117969827 14:61240744-61240766 AAAAAGGACAAATGGGTGGAGGG - Intronic
1119061928 14:71483648-71483670 CAGAAAATGAAATGGGTGCAGGG - Intronic
1119135739 14:72217282-72217304 ATGAAAGTAGAATGGGAGGATGG + Intronic
1120025255 14:79576551-79576573 AGGAAAGACAAATGGGAAGACGG + Intronic
1120195960 14:81482388-81482410 AATAAAGTCAGCTGGGTGCAGGG + Intronic
1121558988 14:94860533-94860555 CAGAATGTGAAATGGGAGGATGG - Intergenic
1121583941 14:95050110-95050132 AAGGAAGAAAAATGGATGGATGG + Intergenic
1121583956 14:95050203-95050225 AAAACAGATAAATGGGTGGAAGG + Intergenic
1123634310 15:22288339-22288361 AAGAAAATAAATTTGGTGGAGGG - Intergenic
1124810734 15:32935606-32935628 AAGAAAGTCTAAGGGATGTATGG - Intronic
1124864338 15:33474215-33474237 AACAAAGTCAACTGGATGCATGG + Intronic
1125618768 15:41040370-41040392 AGGATAGTCAAATGGGTTCATGG + Intronic
1125743360 15:41982856-41982878 AACAAAGCCAAATAGGTGGCCGG - Exonic
1126560317 15:50035989-50036011 AATAAAGTAAAATGGCTGGAGGG - Intronic
1126871713 15:52996438-52996460 ATGAATGTCAGGTGGGTGGAAGG - Intergenic
1126897316 15:53272883-53272905 AAAAAACTCAGATGGGAGGAAGG - Intergenic
1127151062 15:56075929-56075951 AAGAAAGAGAAATGTGTGGAGGG + Intergenic
1128704084 15:69825897-69825919 AACAAAATCAAATGGGCAGATGG - Intergenic
1131791437 15:95970117-95970139 AAGAAAGAAAAATGGAAGGAAGG + Intergenic
1131836610 15:96397351-96397373 AACAAAGTGAAATGGTTAGAAGG + Intergenic
1132337305 15:101056600-101056622 AAGACAAGCAAATGGATGGATGG + Intronic
1133454352 16:5930192-5930214 AAGAAAGAAGAATGGATGGATGG + Intergenic
1133544227 16:6789420-6789442 AAGAAAGTGAAGCGTGTGGAAGG + Intronic
1133820779 16:9234690-9234712 AAAAAAGACAAATAGCTGGAAGG + Intergenic
1135618662 16:23934049-23934071 AAGAAAGTCAAATGGGTGGATGG - Intronic
1137560805 16:49500907-49500929 AAAAAAGGCTATTGGGTGGACGG + Intronic
1138676745 16:58656811-58656833 AAGAAAGACACATGGATGAATGG + Intergenic
1139252280 16:65507887-65507909 TAGAAATGCAAATTGGTGGATGG - Intergenic
1140117539 16:72055860-72055882 TAGAAAGGCACATAGGTGGAGGG - Intronic
1141230322 16:82161238-82161260 ATGAACTTCAAATGGGTGGAAGG + Intronic
1141619041 16:85227025-85227047 ATGAAAGGAAAATGGGTGGGTGG - Intergenic
1143186499 17:5013468-5013490 AAGAACGTCATCGGGGTGGAGGG + Intronic
1143393486 17:6574425-6574447 GAGAGAGTGCAATGGGTGGAAGG + Intergenic
1143624161 17:8099301-8099323 ACTAAAGTCATATGGGTGGTAGG + Intronic
1143666561 17:8365417-8365439 AAGAAAGACAATGGGTTGGAAGG + Intergenic
1143941816 17:10550251-10550273 AGGCAAGTCAAATGGGTAGGGGG - Intergenic
1144724324 17:17494151-17494173 AAGAAAATTAAGCGGGTGGATGG + Intergenic
1145180568 17:20747225-20747247 AAAAATGTCAAATGGATTGAAGG + Intergenic
1146483672 17:33225903-33225925 AAGAAAGTCTAATGTGATGATGG - Intronic
1146499938 17:33355542-33355564 AAGAAATTCAAAAGGGAGGAAGG - Intronic
1146700989 17:34960152-34960174 TAGAAAGAAAAATGTGTGGAGGG - Intronic
1147438296 17:40431387-40431409 TAGGCAGACAAATGGGTGGATGG - Intergenic
1147771778 17:42872820-42872842 AACAAAGCCTAATGGGTGGGTGG + Intergenic
1149437512 17:56645514-56645536 AATAAAGATAAATGGGTGAATGG + Intergenic
1150710474 17:67526742-67526764 AAAAAAGTTAAATGACTGGATGG + Intronic
1150714909 17:67563874-67563896 GAGAGAGAGAAATGGGTGGATGG + Intronic
1151184805 17:72355945-72355967 AGGAAAGTGAGATGGGTGGTGGG + Intergenic
1151538294 17:74750702-74750724 AAGAATGTCAAATCGATCGATGG - Intronic
1152916276 17:83037873-83037895 AAGAAAGTCAAATGTTTGCGTGG + Intronic
1153824074 18:8858713-8858735 AAAAAAGTTAAATGGATTGATGG + Intergenic
1154421248 18:14230503-14230525 AAGAATCTCAAATGGGAAGAAGG + Intergenic
1155329860 18:24704149-24704171 AAGAAAGGAAAATGGCTGGCAGG + Intergenic
1155489678 18:26387991-26388013 AAGAAACCCAAAAAGGTGGAAGG + Intronic
1155558029 18:27043333-27043355 AAGAATGTCAAATAAGTGGTAGG - Intronic
1157358308 18:46955106-46955128 AAGAAAGACAAAAGGAAGGAAGG - Intronic
1157963378 18:52181583-52181605 AAGAAAGGAAAATGGAAGGAAGG - Intergenic
1157991710 18:52504396-52504418 AAGAAACTCAGAGGGGTAGAAGG - Intronic
1158116401 18:54000935-54000957 AAGAAAGTGAAATCGCTGTAGGG + Intergenic
1158311963 18:56168708-56168730 AAGAATGTGAAAGGGGTGGTGGG + Intergenic
1158557078 18:58484230-58484252 AATATAGTCACATGGGAGGAAGG + Intronic
1159308819 18:66681208-66681230 AAGAAATACAATTGGCTGGATGG - Intergenic
1159936681 18:74374050-74374072 AAGAAAGACAAATGGATGCTGGG + Intergenic
1161656782 19:5521146-5521168 CAGAAAGTAGGATGGGTGGAGGG + Intergenic
1161766108 19:6209860-6209882 AGGAAGGGCAGATGGGTGGATGG - Intergenic
1163774341 19:19209048-19209070 AATAAAATAAAATGGGGGGAGGG - Intergenic
1163794434 19:19328715-19328737 AAGAAAGTTAAAGGGGTGGCTGG - Intronic
1167424256 19:49421992-49422014 CAGAAAGCCAAAAGGGTGAAAGG + Intergenic
1167669961 19:50845335-50845357 AGAAAAGTCAAGTGGGGGGAGGG - Intergenic
1167799145 19:51729144-51729166 TAGAAAGTCAGATTGGTAGATGG + Intergenic
1167829152 19:52004363-52004385 AAAAAAGTCAAAGATGTGGATGG - Intronic
925312562 2:2896203-2896225 GAGAAGGTCAAATGGGCGGTGGG + Intergenic
926242578 2:11099944-11099966 CAGGAAGACAAATGGGAGGACGG - Intergenic
928148060 2:28799379-28799401 AAGGGTGTCAAATGGCTGGATGG - Exonic
929664128 2:43820639-43820661 ACGAAGGTCAAATCAGTGGAAGG - Intronic
929731784 2:44502425-44502447 AAGAAAGTTAAAAGGGTACAAGG - Intronic
929835252 2:45390641-45390663 AAGGAAATGGAATGGGTGGAGGG - Intronic
930950423 2:57136686-57136708 AAGAAAATCAAATAGGTGCCTGG - Intergenic
931730257 2:65147080-65147102 TGGAAAGTATAATGGGTGGAGGG - Intergenic
933363373 2:81316084-81316106 AAGAAAGACAAATAGGTGTGAGG - Intergenic
934546546 2:95221963-95221985 AAGAAAGAGAAAGGGGTGAAAGG - Intronic
935404309 2:102692412-102692434 ATGAAAGTCAAATGCATGGCAGG + Intronic
935524173 2:104145334-104145356 AAGAAAGACATACGGGTGGGTGG - Intergenic
936799376 2:116248813-116248835 AGGATAGAAAAATGGGTGGAAGG - Intergenic
937483471 2:122288813-122288835 AAGAAAGGCAGCTAGGTGGAGGG - Intergenic
938016986 2:127875379-127875401 AAGAAGGGCAAGTGGGGGGAGGG + Intronic
938040212 2:128069520-128069542 AAAAAAATCAACTGGGTGGCTGG + Intergenic
938184968 2:129223367-129223389 AAGAAAGTCAAACTAGAGGAAGG - Intergenic
940794906 2:158067441-158067463 AAGAAAGACAAATGAGATGAAGG + Intronic
942476762 2:176334641-176334663 ATGAATGTCAAAAGAGTGGAAGG + Intronic
943487644 2:188507047-188507069 AAGAATGCAAAGTGGGTGGATGG - Intronic
944081722 2:195795867-195795889 AACAAAGCCAGATGGGTGGATGG + Intronic
946564854 2:220953206-220953228 AAGAAAGAAAAATAGATGGATGG + Intergenic
947578437 2:231295131-231295153 AAGGAAGTCAAATGGGAAGTAGG - Intronic
1168910070 20:1440501-1440523 AAGCAGGTCAAAGGGATGGAGGG + Intergenic
1169177847 20:3534183-3534205 GAGAAAATGAAATGTGTGGATGG + Intronic
1169371466 20:5031378-5031400 ATGAAAGTAAAAAAGGTGGAGGG - Intergenic
1169401074 20:5281265-5281287 AAAAAAATCAAATGGGAGAAAGG - Intergenic
1170729284 20:18959079-18959101 AAGGAAATTATATGGGTGGAGGG + Intergenic
1170868810 20:20185562-20185584 AGGAAAGACAGCTGGGTGGAGGG + Intronic
1171416865 20:24987857-24987879 AAGAAAATCACTTGGGTTGAAGG - Intronic
1172956232 20:38761420-38761442 AAGGAAGCCAAAAGGGTTGATGG + Intronic
1173968382 20:47131200-47131222 ATGAAAGTCACATGGGTTGTGGG + Intronic
1176665916 21:9687641-9687663 AGGAAAGACAAAGGGGTGGAAGG - Intergenic
1176852227 21:13929450-13929472 AAGAATCTCAAATGGGAAGAAGG - Intergenic
1177901786 21:26926021-26926043 AAGAAAGTCAAAAGGGATGTTGG + Intronic
1178788764 21:35678554-35678576 ATGAATGATAAATGGGTGGATGG + Intronic
1178817691 21:35946572-35946594 CAGCAAGTCAGATGGGAGGAAGG - Intronic
1179360546 21:40704254-40704276 CAGAATGTCAAGTAGGTGGAAGG + Intronic
1179393932 21:41020867-41020889 AAGAAAGAAAAATGGAAGGAAGG + Intergenic
1181537237 22:23552784-23552806 ATGAAAGATGAATGGGTGGATGG - Intergenic
1181930735 22:26399335-26399357 AAGAAAGTCAGATGGGTAGGGGG - Intergenic
1183277377 22:36907665-36907687 AAGAAAGTCATGTGACTGGAGGG - Intergenic
1184535183 22:45081993-45082015 AAGAAACTCAAATAGGTGTCAGG + Intergenic
1184835255 22:47017250-47017272 ATGAAAGTCACATGGGCGCATGG + Intronic
1185383596 22:50521603-50521625 AAGAAAGGTAATTGGGTGGAAGG + Exonic
949526200 3:4906855-4906877 AAGAGACTGAAATGGGAGGATGG - Intergenic
949528624 3:4931318-4931340 AAGAGAGACAAATGGGAGAAGGG + Intergenic
950839265 3:15951098-15951120 AAGAGACTGAAATGGGAGGATGG - Intergenic
951093559 3:18602001-18602023 AAAACAGTTAAATGTGTGGAAGG + Intergenic
951643285 3:24859966-24859988 AACAAAAAAAAATGGGTGGAAGG + Intergenic
956044931 3:65185565-65185587 AAGAAAGATAAAAGGGAGGAAGG + Intergenic
956544404 3:70384326-70384348 AAGAAAATCAAATGATAGGAAGG + Intergenic
956819265 3:72938265-72938287 AAGACGGACAAATGGATGGATGG + Intronic
957942592 3:87023562-87023584 AAGAGAGTCCAAGGGGTGGTTGG - Intergenic
958791728 3:98658788-98658810 AAGACAGCCAGATGGGTGTATGG + Intergenic
959149688 3:102593273-102593295 AAGAAAGTAAAATAAGTGAAAGG - Intergenic
960264069 3:115599962-115599984 AAGGCAGTCAGATGGGTGGGTGG - Intergenic
960674974 3:120184858-120184880 GAGAAAGTCAGGTGGGTGAAAGG + Intronic
960983607 3:123255895-123255917 AAGAAAGTAAAATGGTAGGTAGG - Intronic
963186079 3:142418949-142418971 TAGAAAAGCAAATGGGTGCATGG - Intronic
965005296 3:163014603-163014625 AAGAAAGTAAAATTTATGGATGG - Intergenic
967416274 3:189222186-189222208 AAAAAAGTCAAATGCCTGTAAGG + Intronic
969070295 4:4531649-4531671 GAGCAAGTCAAGTGGATGGATGG - Intronic
969076146 4:4579271-4579293 AAGAAAATCAAAGGGCTGCATGG - Intergenic
972418430 4:38865019-38865041 AAGAAAGAAATATGGGTGGGAGG + Intergenic
973295789 4:48519256-48519278 CAGAGAGTAAAATGGGAGGAGGG - Intronic
973557553 4:52100085-52100107 CTGAAAGTCATATGGGTAGAGGG + Intergenic
973961466 4:56114324-56114346 AAGAAAGGCACAGGGGTTGAAGG + Intergenic
977206944 4:94173795-94173817 AAGAAAAAAAAAAGGGTGGAAGG - Intergenic
978708760 4:111751020-111751042 AAGAAAAACAAATTGGTGAAAGG + Intergenic
979936448 4:126703229-126703251 CACAAAGTCAAAGGTGTGGAAGG - Intergenic
979981431 4:127260800-127260822 TAGAAAGTCAAATAGGGAGATGG + Intergenic
980385142 4:132079356-132079378 AAGAAAATGATTTGGGTGGAAGG - Intergenic
981043012 4:140240483-140240505 AAGAAAGACAAATTGGAGCAGGG - Intergenic
981046107 4:140266801-140266823 AAGAAAATAAAAAGGGAGGAAGG + Intronic
981314074 4:143324560-143324582 AAGATAGACAAATGGATTGATGG - Intergenic
981776202 4:148370639-148370661 AAGAAATTAAAATGGATGAATGG + Intronic
983248408 4:165316165-165316187 AAGATATTCAAATGGATGTATGG + Intronic
983781316 4:171673967-171673989 AAGAGGGTCAAGTGGGTGAAGGG + Intergenic
984433302 4:179676282-179676304 AAGAAAGTCTTTTAGGTGGATGG + Intergenic
984580954 4:181509554-181509576 AAGAAGGTCAATTCTGTGGATGG - Intergenic
985411646 4:189691900-189691922 AGGAAAGACAAAGGGGTGGAAGG - Intergenic
985874570 5:2585249-2585271 CAGATAGGTAAATGGGTGGATGG + Intergenic
985993742 5:3584789-3584811 AAGGAAGAGAAATGGGAGGAAGG + Intergenic
985993836 5:3585153-3585175 AAGGAAGAGAAATGGGAGGAAGG + Intergenic
986532553 5:8754284-8754306 AAGAAAGCCAATTGGGAAGAAGG + Intergenic
987439757 5:17941657-17941679 AGTAAAGAGAAATGGGTGGAAGG + Intergenic
987853330 5:23385523-23385545 AAGAAAGTCATATTGGAGTAGGG - Intergenic
989700887 5:44263386-44263408 AAGAAATTGAAATTGCTGGATGG + Intergenic
990320164 5:54621907-54621929 AAGTAATTGAAATGGGAGGAAGG - Intergenic
990967743 5:61467952-61467974 AAGAAAGTGTTATGGGTGAAAGG + Intronic
991230377 5:64325891-64325913 AAAAAAGTCAAATTGGAGCAAGG + Intronic
994840264 5:104915113-104915135 AAGAAAGAGAAATGGGTGCTGGG - Intergenic
996429269 5:123353957-123353979 AAGAAAGTAAAATGGGAGCAAGG - Intronic
996776171 5:127134973-127134995 AAGAAAGTGAAATCTGTAGAGGG + Intergenic
998481940 5:142470080-142470102 AAGCAAGACAAATGGGGCGACGG - Intergenic
998852977 5:146368208-146368230 AAGAAAGTAAAATGGAAGGAGGG - Intergenic
1000499281 5:162028730-162028752 AGGAAAGAAAAATGGGAGGAAGG + Intergenic
1001030661 5:168260187-168260209 AACAAAATAAAATGGGTGGTTGG - Intronic
1001569110 5:172718604-172718626 ATGAATGACGAATGGGTGGAAGG + Intergenic
1001865687 5:175103188-175103210 AAGAAAGTGAATCAGGTGGAGGG + Intergenic
1002095612 5:176829147-176829169 AAGAAAGAAAGATGGATGGATGG + Intronic
1003178378 6:3771311-3771333 AAGAAAGCCAAAAGGGATGAAGG - Intergenic
1003604271 6:7544640-7544662 AAGAAATTTGAATGTGTGGAGGG + Intronic
1003693687 6:8380196-8380218 AGGAAAATAAAAGGGGTGGAGGG + Intergenic
1003744209 6:8981304-8981326 AAAAAAATCAAATGGCTGAAAGG + Intergenic
1005041083 6:21601131-21601153 GAGAAATCCAAATGGGTAGATGG - Intergenic
1005237444 6:23781366-23781388 AAGAACTTAAAATGGGTAGATGG + Intergenic
1005362163 6:25041179-25041201 AGCAAATTCAAATGGGTGGAGGG - Intronic
1009663805 6:66650152-66650174 AAGAAAGAAAAATGGATGGAAGG - Intergenic
1009828174 6:68895133-68895155 AAGAAAGTTAAATCTGGGGAAGG - Intronic
1010467994 6:76191385-76191407 AACAAAATCAATTGGATGGATGG - Intergenic
1010515903 6:76772282-76772304 AAGAAAGGCAACTAAGTGGATGG + Intergenic
1011226172 6:85109833-85109855 AAGAAAGTGATTTGGGTGGATGG - Intergenic
1011315611 6:86027508-86027530 AGGAAAGTTAATTGGGGGGAAGG - Intergenic
1012348497 6:98222036-98222058 AACAAAGACAAAAGGATGGAAGG + Intergenic
1012354125 6:98291932-98291954 CAGAAAGGCGATTGGGTGGAAGG - Intergenic
1012371637 6:98514206-98514228 AAGAAAGCCTAATGGCTGGAGGG + Intergenic
1013962377 6:115915798-115915820 AAGAAACTCAAGTGAGTGCAGGG - Intergenic
1014008710 6:116451454-116451476 AAGAAAGGTGAAGGGGTGGATGG + Intergenic
1014919930 6:127202117-127202139 AAGGAAGTCAAAAGGATGGACGG - Intergenic
1015146962 6:129997756-129997778 AAGAAAGACAACTGGGTGGATGG + Intergenic
1015327879 6:131944857-131944879 AAGAAAATCCAATATGTGGAGGG - Intergenic
1015940648 6:138448260-138448282 AAGAAGGCCAAATGAGTGCAGGG + Intronic
1016697981 6:147020397-147020419 AAGAAATATAAATGGGTGGCCGG + Intergenic
1017597664 6:156046653-156046675 AAGAAAGGCAAATGGGAGTTAGG - Intergenic
1018448737 6:163884869-163884891 AAGAAAGTGAATAAGGTGGATGG + Intergenic
1018841484 6:167520534-167520556 AAGAAACTGAAATGGGTGCATGG - Intergenic
1019567204 7:1690236-1690258 AAGAAAGATGAGTGGGTGGATGG + Intronic
1020742932 7:12044730-12044752 AACAATGTCAAATGAGTGGTTGG + Intergenic
1021439143 7:20658531-20658553 AAGGAGCTCAAATGAGTGGAGGG + Exonic
1021458069 7:20851262-20851284 AAGAATGACAAATGGGTGGATGG + Intergenic
1023331259 7:39119470-39119492 GAGAGAGTCAAATGGAAGGATGG + Intronic
1023360849 7:39414064-39414086 AAGAAAGTTAAAGGGGTTGCTGG - Intronic
1024750745 7:52462281-52462303 AAGGAAGTCAAATGGGTCCAAGG - Intergenic
1025625734 7:63219644-63219666 AAGATAATCAAAGGGGTTGAGGG + Intergenic
1025656385 7:63523529-63523551 AAGATAATCAAAGGGGTTGAGGG - Intergenic
1025998680 7:66544513-66544535 AAGAAAGAAAAATGGATGGATGG + Intergenic
1026189611 7:68112885-68112907 AAGAGAATCAAAGGGGTTGAGGG + Intergenic
1026991639 7:74589360-74589382 AAAAAAGAAAAATGGATGGAGGG + Intronic
1028391046 7:90317421-90317443 CAGAAAATCAACTGGTTGGAGGG - Intergenic
1028702316 7:93794143-93794165 CAGAATGTCATATGGCTGGAAGG + Intronic
1029786702 7:102799089-102799111 CAGAAAAGCAAATGGGTGCAAGG + Intronic
1030971639 7:116064535-116064557 AAGCAACTCAAGGGGGTGGAGGG + Intronic
1031995195 7:128226189-128226211 AACATAGACAGATGGGTGGATGG - Intergenic
1032381324 7:131485309-131485331 AAATAAGTAAAATGGGAGGAGGG + Intronic
1032720285 7:134546054-134546076 TAGAAAGACAAATGGAAGGAGGG + Intergenic
1033438401 7:141355276-141355298 AAGGGAGTCAAAGGGGTGGATGG + Intronic
1033969170 7:147017199-147017221 AAGGAAGACAACTGGGAGGATGG - Intronic
1034250936 7:149690202-149690224 ATGAAGGGGAAATGGGTGGAGGG + Intergenic
1034535956 7:151725884-151725906 AAGAAAATCAAAGTGGGGGAGGG - Intronic
1034564003 7:151899179-151899201 AAGAAAGTCCTATTGGAGGAGGG - Intergenic
1034696720 7:153060351-153060373 AAGAATGTGAACTGGGTGGTAGG - Intergenic
1035979489 8:4353758-4353780 AAGTAAATCAAATGTGTGAAGGG - Intronic
1035981198 8:4374388-4374410 AAGAAAGTCATAGGGGCTGAAGG + Intronic
1036028135 8:4933680-4933702 AGGAAAGATAAATGGATGGATGG + Intronic
1036540592 8:9704452-9704474 AAGTAAGTGAAATAGGTGGATGG + Intronic
1036602529 8:10274895-10274917 AAGATAGACGAATGGTTGGATGG - Intronic
1037211831 8:16398404-16398426 AAGAATGACATTTGGGTGGATGG - Intronic
1038388028 8:27167911-27167933 GTGAAATTCTAATGGGTGGAGGG + Intergenic
1040081268 8:43288742-43288764 AAGAAAATCAAGTAGATGGAGGG - Intergenic
1040595898 8:48837322-48837344 GAGAAAGACAGATGTGTGGAGGG + Intergenic
1041746110 8:61211020-61211042 AGGAAAGCCAAAGGGATGGAGGG + Intronic
1042512361 8:69625341-69625363 CAAAATGTCACATGGGTGGATGG - Intronic
1042914361 8:73860713-73860735 AAGAAAGTTCAAAGAGTGGAGGG + Intronic
1043170266 8:76957520-76957542 AGGAAAGTCAAATAGGTTTAGGG + Intergenic
1043378609 8:79678554-79678576 AAGAAAGAAGGATGGGTGGAGGG + Intergenic
1043876799 8:85494570-85494592 AATAATGTCAGATGGGTGCAGGG - Intergenic
1043960438 8:86411800-86411822 AAGACAGCCAGATGGGTGTATGG + Exonic
1044489693 8:92798864-92798886 AATCAAGTGAAATGGTTGGAGGG - Intergenic
1044786862 8:95803464-95803486 AAGAAAGTCTAATGGGATGAGGG + Intergenic
1045608695 8:103809492-103809514 AAGAAAGAAAAAGGAGTGGAGGG - Intronic
1046813699 8:118560430-118560452 AGTAAATCCAAATGGGTGGAAGG - Intronic
1047561534 8:125992138-125992160 AAGGAAGAGAAATGGGTGAATGG + Intergenic
1049447790 8:142639359-142639381 CAGACAGGCAGATGGGTGGATGG + Intergenic
1050814561 9:9793473-9793495 TAGATAGACAAATGGATGGATGG + Intronic
1052480150 9:29013963-29013985 AAGAATGTCAAATGTGCAGAAGG - Intergenic
1052726266 9:32231237-32231259 AAGAAGGTCATTTGGGAGGATGG + Intergenic
1052764039 9:32622284-32622306 AAGCAAGTCAAATGGAAGGGAGG + Intergenic
1053371892 9:37568499-37568521 AACAAAGTAAATTGGGTGGGTGG - Intronic
1053562045 9:39206636-39206658 AAGAAATTCAGATCGGTGAACGG + Intronic
1053827858 9:42044639-42044661 AAGAAATTCAGATCGGTGAATGG + Intronic
1054135073 9:61412322-61412344 AAGAAATTCAGATCGGTGAACGG - Intergenic
1054602701 9:67142807-67142829 AAGAAATTCAGATCGGTGAATGG - Intergenic
1054809230 9:69421756-69421778 AAGAAACTCCAATTAGTGGAGGG + Intergenic
1055066814 9:72127252-72127274 AAAAAAATTAAATGGGTTGATGG + Intronic
1055360823 9:75488583-75488605 CAGAGAGTTCAATGGGTGGAAGG + Intergenic
1056011235 9:82333046-82333068 AAGGGAGTCAAATAGGTGCATGG + Intergenic
1056465292 9:86847942-86847964 AAGCAATTCAACTGAGTGGATGG + Intergenic
1056643763 9:88392465-88392487 AAGAAAGACATCTGGATGGAGGG + Intronic
1058376060 9:104322796-104322818 AACAAAGTCACAGGGCTGGAAGG + Intergenic
1058429548 9:104906088-104906110 AAGAAAGATAAATGGGGAGAAGG - Intronic
1058580399 9:106450149-106450171 AAGAAGGGCATATGGCTGGAAGG - Intergenic
1058690133 9:107513015-107513037 AAGAAATTCAAACGGTTGGCTGG + Intergenic
1059376062 9:113882614-113882636 AAGAAAGTCTCATGGATGGCAGG - Intronic
1059624994 9:116054076-116054098 AAGAAAGAAAACTAGGTGGATGG - Intergenic
1059645384 9:116261416-116261438 AAAAAAGTCATATAGGAGGAAGG - Intronic
1060370988 9:123070841-123070863 AAGAAAATAAAAAAGGTGGAGGG - Intronic
1060834578 9:126745486-126745508 AAGAAAGGCAAGTGGAAGGAAGG - Intergenic
1061154371 9:128848520-128848542 AAGAAACTCAAATGGGGGCCAGG + Intronic
1061560895 9:131402274-131402296 AAGAAAGTAAAATGGTTGGCAGG - Intronic
1061928105 9:133816842-133816864 AAGATAGACAAATAGATGGATGG - Intronic
1061979618 9:134094079-134094101 AAGACAGCAAAATGGGAGGATGG + Intergenic
1062011017 9:134266874-134266896 TAGATATACAAATGGGTGGATGG + Intergenic
1062210609 9:135361796-135361818 AAGAAAGGAAGATGGATGGATGG + Intergenic
1203660182 Un_KI270753v1:34120-34142 AGGAAAGACAAAGGGGTGGAAGG + Intergenic
1203670950 Un_KI270755v1:11082-11104 AGGAAAGACAAAGGGGTGGAAGG + Intergenic
1185501722 X:601863-601885 AAGAAAGAAAAATGGAAGGAAGG - Intergenic
1186012968 X:5157738-5157760 AAGAAAGTAAAATAGGAGAATGG + Intergenic
1186506018 X:10092854-10092876 AAGCAAGGCAAATGAGTGGCTGG - Intronic
1187010614 X:15274698-15274720 ATGAAAGTCAAAAGCGGGGACGG + Intergenic
1187250550 X:17594341-17594363 AAGAAAGTCCAATGGAAGAAAGG + Intronic
1188142894 X:26574114-26574136 AAGAAAGTAAAAAGGAAGGAAGG + Intergenic
1189057356 X:37711996-37712018 AAGCAAGTCAGATGGATAGAAGG + Intronic
1189908336 X:45784450-45784472 CAGAAAGTCAAATGTGAGGTTGG + Intergenic
1190774628 X:53542895-53542917 AAAAAATTCAGATGGGTGGAAGG + Intronic
1192184954 X:68940576-68940598 AAGACAGGAAGATGGGTGGAAGG - Intergenic
1193630279 X:83877106-83877128 AAAAAAATCAACTGGCTGGATGG - Intronic
1194850735 X:98865371-98865393 AAGAAAGTCTCAAGGGTGTAGGG + Intergenic
1194898365 X:99473767-99473789 AAAGAATTCAAATGGGTAGATGG - Intergenic
1196042537 X:111220526-111220548 AAGACAGTCAAATGGGGTGGGGG + Exonic
1196763887 X:119225588-119225610 AAGAAAGTCAAGGAAGTGGAAGG + Intergenic
1197219373 X:123896876-123896898 AAGAAAGTGAAAAAGGTGGCCGG - Intronic
1197816330 X:130502372-130502394 AAGAAAGTAAAAGGGAGGGAAGG - Intergenic
1198052250 X:132960524-132960546 AAGAAAGTGCCTTGGGTGGAGGG + Intronic
1198236041 X:134736699-134736721 AAGAGATACAAATGGGTTGAAGG - Intronic
1198656284 X:138916927-138916949 AACAAAACCAAATGGATGGAGGG + Intronic
1199467709 X:148158016-148158038 AGGAAAGTGAAATTGGTAGAAGG - Intergenic
1202054504 Y:20815311-20815333 AAGCAAGTCCACTGGTTGGAAGG - Intergenic