ID: 1135619545

View in Genome Browser
Species Human (GRCh38)
Location 16:23943898-23943920
Sequence GATCACATGGGGAAGGCACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135619545 Original CRISPR GATCACATGGGGAAGGCACC AGG Intronic
900147723 1:1165680-1165702 GGTCACGTGGGGAGGGCAGCAGG - Intergenic
900365252 1:2309615-2309637 GGTCACATGGGAAACGCACATGG - Exonic
900695616 1:4008029-4008051 GATGCCATGGGGAAGGAACTGGG + Intergenic
901679339 1:10904128-10904150 GAACAAATGGGGCAGGCAGCTGG - Intergenic
902735903 1:18400626-18400648 GATCACTTGGGGCAGACACTAGG - Intergenic
903005327 1:20294446-20294468 AACCCCATGGGTAAGGCACCAGG - Intronic
903881034 1:26509476-26509498 GATCACAGGTGCGAGGCACCAGG + Intergenic
906086325 1:43137866-43137888 GATCACTTGGGGATGTCAGCTGG - Intergenic
907048460 1:51314189-51314211 CATCACATGGAGAAGGCAACAGG + Intronic
907805460 1:57814781-57814803 GACCACATGGCTCAGGCACCAGG + Intronic
914900837 1:151710293-151710315 GACCCCAGGGGGAAGGCACTCGG + Intronic
915262449 1:154686976-154686998 GACCTCATGGGGGAGGCACAGGG - Intergenic
916560202 1:165928548-165928570 CATGACATGGGGGAGGCAGCAGG - Intergenic
918451768 1:184665364-184665386 GATAACACATGGAAGGCACCTGG - Intergenic
919522017 1:198600462-198600484 CATCAGATTGGGAAGGGACCAGG + Intergenic
924041614 1:239989386-239989408 AATCAGATGGAGAAGGCAACAGG + Intergenic
924511839 1:244734186-244734208 GATGACAGGCGTAAGGCACCAGG + Intergenic
1065294278 10:24259708-24259730 GCTCCCAGGGGGAAGGCACAGGG - Intronic
1067512151 10:46905020-46905042 GGCCACATGGGGAAGACACCAGG - Intergenic
1067650094 10:48146803-48146825 GACCACATGGGGAAGACACCAGG + Intergenic
1070680873 10:78448206-78448228 GCTCACATGGGTCAGGAACCTGG + Intergenic
1070817190 10:79331951-79331973 GCTCATATGGGGAAGTCCCCGGG - Intergenic
1071594204 10:86907089-86907111 GATTAAAAGGGGAAGGCAACTGG - Intronic
1071695720 10:87867869-87867891 AATAACATGGGAAAGGCAACTGG + Intronic
1071883143 10:89921116-89921138 GGTCTCATGGGAAAGGCACCTGG + Intergenic
1074007024 10:109437073-109437095 AATGACAAGGGGAAGGCATCAGG + Intergenic
1074781172 10:116803397-116803419 GATCCCATGGGCAAGGACCCAGG + Intergenic
1074983997 10:118641503-118641525 GGTCATATGGGAAAGACACCTGG + Intergenic
1076864055 10:133158841-133158863 GACCCCAAAGGGAAGGCACCAGG - Intergenic
1077413367 11:2413667-2413689 GCTCACGTGGGCCAGGCACCTGG - Intronic
1078082735 11:8216080-8216102 GATCACATTGGGAAGGCCTTGGG + Intergenic
1080292556 11:30687583-30687605 GAACACAAAGGGAAGGCAACTGG - Intergenic
1083181428 11:60988432-60988454 GAGAACCTGGGGGAGGCACCAGG - Intronic
1083477173 11:62922065-62922087 CCGCACATGGGGCAGGCACCTGG - Intergenic
1084034110 11:66497616-66497638 GATCACAGGCGTGAGGCACCCGG - Intronic
1086466740 11:87061750-87061772 AATCACATGGGGAAAGAAACGGG + Intronic
1087029139 11:93684808-93684830 ACTCAAATGGGGATGGCACCAGG - Intronic
1090428140 11:126624539-126624561 AAGCACACTGGGAAGGCACCGGG - Intronic
1092035787 12:5333304-5333326 GAGCACATTGGGAAGACATCAGG + Intergenic
1093966751 12:25335828-25335850 AATCACAGGGTGAAGGCACAGGG + Intergenic
1101094549 12:101323864-101323886 GATTACATGCGTAAGCCACCAGG - Intronic
1101452055 12:104788914-104788936 GGTCACATGGGGAAGCCACATGG + Intergenic
1102953807 12:117046722-117046744 GGGCAGAGGGGGAAGGCACCAGG + Intronic
1104650183 12:130525632-130525654 GGACACATGGGGAAGGCATGAGG + Intronic
1105439409 13:20402899-20402921 GGGCACATGGGGCAGGCAGCTGG + Intergenic
1105727984 13:23184777-23184799 GCTCTCAAGAGGAAGGCACCAGG - Intronic
1110730721 13:78876385-78876407 TGTCACATGGGGCAGCCACCTGG + Intergenic
1112808943 13:103195111-103195133 GTTCACATAGGGAAAGCACTTGG - Intergenic
1114769195 14:25409471-25409493 GATCGCACGTGGAAGGCATCAGG - Intergenic
1118350434 14:64969842-64969864 GATTACAAGGGGAAGGGACAAGG + Intronic
1119622750 14:76144988-76145010 AATCCCAAGGAGAAGGCACCAGG + Intergenic
1120038212 14:79722641-79722663 AAACACATGGGAGAGGCACCTGG - Intronic
1122036209 14:98951026-98951048 CATCACATGGGGATGGCCTCAGG - Intergenic
1122409580 14:101518981-101519003 GATCCCAGGGGGTAGGCACGAGG + Intergenic
1122434294 14:101683210-101683232 AAGAAAATGGGGAAGGCACCAGG - Intergenic
1123112731 14:105880743-105880765 GATCCCAGTGGGAAGTCACCAGG + Intergenic
1123880797 15:24676242-24676264 GCTCACGTGGTGAAGGCAGCAGG - Exonic
1123971644 15:25513418-25513440 GGTCACATGGGGAGGCCACATGG - Intergenic
1126339200 15:47620901-47620923 GGTCACAGGTGGAATGCACCAGG - Intronic
1128568448 15:68716367-68716389 GACCACATGTGCAAGGCACCTGG + Intronic
1129268438 15:74407275-74407297 GCTCTCCTGGGGAAGGCAGCAGG - Intergenic
1129677016 15:77637164-77637186 GCCAACATGGGGAAGGCACAGGG + Intronic
1131145589 15:90009557-90009579 GGGCACATGGGGAATGGACCAGG - Intronic
1132360379 15:101207963-101207985 AGTCACATAGGGAAGGCACCGGG + Intronic
1132749481 16:1450852-1450874 GATCCCATGGGGAGGCCACAGGG + Intronic
1134241350 16:12509272-12509294 GATCACAAGGGAAGGGCACCAGG + Intronic
1135108900 16:19675088-19675110 GACCACATGGGCAAGCCACCAGG + Intronic
1135619545 16:23943898-23943920 GATCACATGGGGAAGGCACCAGG + Intronic
1137408546 16:48208704-48208726 GATCACAAGGGAAAGGCAGAGGG + Intronic
1137460348 16:48655698-48655720 GGCCACATGGGAAAGACACCAGG + Intergenic
1138457930 16:57131983-57132005 GATTGCCTGGGGAAGGCACTGGG + Intronic
1138512910 16:57518851-57518873 GCCCAAATGGGGCAGGCACCAGG + Intronic
1140874524 16:79138379-79138401 AGTCAAATGGGGAAGGCACTGGG - Intronic
1143197773 17:5089261-5089283 GATCACAGCTGGAAGGAACCTGG - Intronic
1149146878 17:53504938-53504960 GACCACATGGGAAAGACACTAGG - Intergenic
1149549235 17:57527646-57527668 GAGCAGAAGGGGAAGGCCCCAGG + Intronic
1150157987 17:62870181-62870203 AAGCCCATGGGGAAGGGACCGGG + Intergenic
1151686411 17:75649542-75649564 GATCCCTTGGGGCGGGCACCTGG - Intronic
1152315901 17:79580072-79580094 GATGAGATTGGGAAGGTACCAGG - Intergenic
1154960046 18:21299003-21299025 GATTACAGGCGTAAGGCACCAGG - Intronic
1156090694 18:33465215-33465237 CATCACATGGAAAAGGCACATGG - Intergenic
1157860068 18:51133267-51133289 GAGCAAATGGGGAAAGCAGCTGG + Intergenic
1158328467 18:56335914-56335936 CATCACCACGGGAAGGCACCAGG - Intergenic
1158596538 18:58821599-58821621 GATCACAAGAGGTAGGCACGTGG - Intergenic
1158825155 18:61210025-61210047 AATCACATGGGCAATTCACCCGG + Intergenic
1159699063 18:71601481-71601503 TAACACATGGGGAATGCACATGG - Intergenic
1160628499 18:80229377-80229399 GAGCAGATGGGCAAGGCCCCTGG + Intronic
1160916948 19:1501306-1501328 GATCACACGGGGATGGCAGACGG + Intergenic
1161822276 19:6537184-6537206 GATTACAGGTGTAAGGCACCAGG + Intergenic
1161967359 19:7555832-7555854 GATCCCATGGGGGAGCCTCCGGG + Intronic
1164458526 19:28428263-28428285 CATCACATGGGGAGGGACCCTGG + Intergenic
1166448918 19:42881125-42881147 GGTCACGAGGGGAAAGCACCCGG + Intronic
1166783312 19:45353329-45353351 GATCCCCTGGGGAAGGACCCAGG + Exonic
1166786736 19:45371759-45371781 GATTACAGGGGTGAGGCACCAGG + Intergenic
1166943675 19:46384154-46384176 GATCACATTTGAATGGCACCTGG + Intronic
925421647 2:3717601-3717623 GATCACATGGGAAAGGGACAAGG - Intronic
925818661 2:7777891-7777913 GGTAAGAAGGGGAAGGCACCAGG - Intergenic
926345761 2:11943505-11943527 GTTCATATGTGTAAGGCACCGGG + Intergenic
927494395 2:23542817-23542839 GGACACCTGGGGAAGGAACCAGG + Intronic
928171370 2:29006645-29006667 GTGCACAGAGGGAAGGCACCAGG - Intronic
930489978 2:52057465-52057487 GATCTCATGAGGACGGCACCAGG - Intergenic
932698049 2:73973343-73973365 GACCCCATGGGGTGGGCACCAGG + Intergenic
935153936 2:100465694-100465716 GACCATGTGGGAAAGGCACCAGG + Intergenic
935328851 2:101961877-101961899 GGTCCCATGGGGTAGGAACCTGG - Intergenic
936491178 2:112973443-112973465 GACCCCATGGGAAAGGAACCAGG - Intronic
937288559 2:120768221-120768243 GATCGAATGGGAAAGGCACAGGG - Intronic
937459587 2:122074454-122074476 ACCCACATAGGGAAGGCACCAGG + Intergenic
938365894 2:130733894-130733916 GACCACATGCGGAAGGCCGCAGG + Intergenic
938777575 2:134555378-134555400 GATTACATGGTAGAGGCACCTGG + Intronic
940303340 2:152198886-152198908 AGCCACATGGGGAAGCCACCAGG - Intergenic
940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG + Intergenic
942114878 2:172718669-172718691 GGTCTCATGGGGAAGGCCCTAGG + Intergenic
942310241 2:174649640-174649662 GGCCACATGGGAAAGACACCAGG - Intronic
945911312 2:215652558-215652580 GATCACATGAGGCATGCAGCTGG - Intergenic
947948609 2:234127979-234128001 GGCCACATGGGAAAGACACCAGG - Intergenic
947989490 2:234475483-234475505 GATCACTTGGGGTTGGCAGCAGG - Intergenic
948714691 2:239853376-239853398 GGCAACATGGGGAAGGCACGTGG - Intergenic
949010041 2:241673102-241673124 AAGGACATGGGGAAGGCTCCTGG - Exonic
949037924 2:241826841-241826863 GATCCCATGGGGAAGGGAATAGG + Intergenic
1168973463 20:1946898-1946920 CATCACGTTGGAAAGGCACCGGG - Intergenic
1169334929 20:4748378-4748400 GAGCACATGGGGAAGGGAGAAGG + Intergenic
1169729680 20:8773133-8773155 CATCACATGGGGAAGGGAGTTGG - Intronic
1170768406 20:19311463-19311485 GATCACATGCGGAAGGTAGTGGG + Intronic
1172002325 20:31788848-31788870 GATGACTTGGGGAGGGCAGCAGG + Intronic
1173837886 20:46137713-46137735 GATAATATGGGAAAAGCACCTGG - Intergenic
1174185056 20:48700698-48700720 CATCACCTGGAGAAGGCAGCAGG + Intronic
1174451929 20:50625900-50625922 GCTCACTTGGGGAAGTAACCTGG - Intronic
1174934974 20:54857332-54857354 GACCACATGGGAAAGACACTAGG - Intergenic
1175967736 20:62667966-62667988 GATTACAAGGGGAAGGCACGGGG - Intronic
1176039881 20:63059823-63059845 TACCACGTGGGGAAGGCACTTGG + Intergenic
1178289938 21:31358518-31358540 GCTCAGCTGGGAAAGGCACCTGG - Intronic
1179611084 21:42550983-42551005 GATCTCAGGCGGAAAGCACCTGG - Intronic
1180069144 21:45427478-45427500 GAGCCCATGGGCACGGCACCCGG - Intronic
1180070634 21:45434363-45434385 GGTCAGATGGGAAAGGTACCTGG - Intronic
1181417239 22:22769388-22769410 GAACACATGTGGCAGGAACCAGG + Intronic
1181449276 22:23007301-23007323 GACCACATGGGAAAGACATCAGG + Intergenic
1182097615 22:27636722-27636744 CAGCAGATGGGGAAGGCATCAGG + Intergenic
1182834515 22:33331075-33331097 GATCACATGGGTCAGGCATTGGG + Intronic
1183511960 22:38241161-38241183 CAGCACAGGGAGAAGGCACCAGG + Intronic
1183998077 22:41651158-41651180 GATCACAGGCGCAAGCCACCAGG - Intronic
1184113778 22:42410207-42410229 GATCACATCGGGCAAGCAGCAGG + Intronic
949981765 3:9506429-9506451 GATCTCATGGGGAAGGGAGAGGG - Intronic
952265113 3:31777909-31777931 GGGCACTTGGGGAAGGCAGCAGG + Intronic
952316953 3:32239447-32239469 GATCAGGTGAGAAAGGCACCAGG - Intronic
953183365 3:40616546-40616568 GAACACTAGGTGAAGGCACCAGG - Intergenic
953908514 3:46880781-46880803 AAATACATGGGGAATGCACCTGG + Intronic
956256894 3:67292661-67292683 AATAACATGGGTAAAGCACCTGG - Intergenic
956464515 3:69505851-69505873 GATCCTGTGGGGAAGGCAGCTGG + Intronic
957290578 3:78272709-78272731 GTTACCATGGGGAAGACACCAGG - Intergenic
958091393 3:88881121-88881143 GAACACACAGGGAAGGCACTGGG + Intergenic
965172355 3:165282405-165282427 GATTACATGTGTAAGCCACCAGG + Intergenic
965309044 3:167105715-167105737 AATAACATAGGGAAAGCACCTGG - Intergenic
965703382 3:171481227-171481249 GAACACATTGGGAATGCAGCTGG + Intergenic
967097838 3:186192279-186192301 GATCACAGGGGTGAGCCACCGGG + Intronic
970216667 4:13765955-13765977 AATCATATGGGTAAAGCACCAGG + Intergenic
973171463 4:47149151-47149173 TATAACATAGGGAAAGCACCCGG + Intronic
973623599 4:52750745-52750767 GGCCACATGGGAAAGACACCAGG + Intronic
973879523 4:55255011-55255033 GATCACAGGTGCAAGCCACCAGG + Intergenic
976894449 4:90091665-90091687 GATCACATGGTGAAAGCAGGGGG + Intergenic
977809999 4:101347219-101347241 GATCACATGGGGAAGGCCGGGGG + Exonic
977923628 4:102673232-102673254 GATTACATGCGTAAGCCACCGGG - Intronic
979168269 4:117564722-117564744 GATCACAGGCGTAAGCCACCAGG - Intergenic
980745437 4:137006527-137006549 GATCACATTTTAAAGGCACCAGG - Intergenic
982505124 4:156207010-156207032 GAGTACATGGGGAAGGCACAGGG + Intergenic
983058047 4:163122775-163122797 CATCACATGGTGAAGGCAGGAGG - Intronic
984400381 4:179256983-179257005 CATCTCATGGGGACGCCACCTGG + Intergenic
985977578 5:3433079-3433101 CATCAGGTGGGCAAGGCACCTGG - Intergenic
986310105 5:6545178-6545200 GATCTCGTGGAGAAGGAACCAGG - Intergenic
990003641 5:50922227-50922249 GATCACCCGGGGAAGGCCCAAGG - Intergenic
991261374 5:64671869-64671891 GGTCACATGGGGATTGCACGTGG + Intergenic
992897042 5:81254537-81254559 GAGCCCAAGGGGAAGGCCCCTGG + Intronic
999083707 5:148868207-148868229 GATCAGATGGGGAAGGCTTGAGG + Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1000210550 5:159103475-159103497 AATCACATGGGGAAGGGTGCAGG + Intergenic
1002277724 5:178114306-178114328 GATCTCATGGGGAAGTCAGAGGG - Intronic
1002603382 5:180368088-180368110 GGGCAGATGGGGGAGGCACCAGG - Intergenic
1003946184 6:11078039-11078061 CATCACAGGGGGAATGCACTGGG + Intergenic
1004177229 6:13350389-13350411 GATCTCAGAGGGAAGGCAGCAGG + Intergenic
1006013223 6:31059618-31059640 CACCACATGAGGAAGGCAGCTGG + Intergenic
1007621998 6:43221050-43221072 GATCACATTTGGAGGGCTCCAGG - Intronic
1012519676 6:100106149-100106171 GGCCACATGGGGAAGCAACCAGG + Intergenic
1016095525 6:140032099-140032121 GATTACAGGGGTAAGCCACCAGG + Intergenic
1019570605 7:1710219-1710241 GACCACAAGAGGAAGGCATCTGG + Intronic
1019774429 7:2904014-2904036 GATGAAATGGTGAAGGCAGCAGG - Intergenic
1021400048 7:20199389-20199411 TATTACATGGAGAAGGGACCTGG + Intronic
1021734237 7:23627416-23627438 GATCACTTGAGGTAGGCAGCAGG + Intronic
1021816631 7:24453544-24453566 GCTCCCATGGGGATGGCACCAGG + Intergenic
1032219987 7:129987369-129987391 ACTCCCATGGGAAAGGCACCAGG + Intergenic
1033140672 7:138823526-138823548 GATCACAGGTGCAAGCCACCGGG - Intronic
1033857924 7:145587976-145587998 GATCACATGAGGAAGGAAAGAGG - Intergenic
1034334168 7:150309835-150309857 GATCACCTGGGAAAGCCCCCTGG + Intronic
1035758447 8:2051511-2051533 GGTGACATGAGGCAGGCACCTGG - Intronic
1041568018 8:59302832-59302854 GATCACAGGGGTGAGCCACCAGG - Intergenic
1041640058 8:60188644-60188666 GATCACATGGGGTCAGCACCAGG - Exonic
1042511592 8:69617982-69618004 GATTCCATGGGGAAGGCAGGAGG - Intronic
1042595149 8:70439449-70439471 GACAAGATGGGGAAGGCACTCGG + Intergenic
1044042105 8:87383322-87383344 TATCAAATGGGCATGGCACCAGG - Intronic
1044806192 8:96010711-96010733 CCTCAGATGGGGAAGGCAACTGG + Intergenic
1047622290 8:126620275-126620297 CATCACATTGGGAAGGCTCTGGG + Intergenic
1048977492 8:139681129-139681151 GATCACATGTGGAAGGCGCTTGG - Intronic
1050569838 9:6926129-6926151 GCTCACAAAGAGAAGGCACCCGG - Intronic
1052142070 9:24999242-24999264 GTTCACATGCAGAAGGCACGTGG - Intergenic
1053002205 9:34583451-34583473 GCTCACAGGAGGAAGGCACCAGG + Intronic
1053275228 9:36778292-36778314 TATCATATGGGGAAGGGGCCAGG - Intergenic
1054972519 9:71105389-71105411 GGTCACATGGGAAAAACACCAGG + Intronic
1056662704 9:88556248-88556270 TGTCACATGGGGAGGCCACCTGG + Intronic
1057028732 9:91757120-91757142 GGGCACATGGGGAAGGCCCTAGG + Intronic
1057308220 9:93924840-93924862 GAGCACATGGGGCAGGCTCCAGG + Intergenic
1058399317 9:104595347-104595369 GGCCACATGGGGAAGCCACCAGG - Intergenic
1058929802 9:109707963-109707985 GATCTTATGGGAAAGGCACTGGG - Intronic
1060172082 9:121470023-121470045 GACCACATGGGAAAGACACAAGG - Intergenic
1185525560 X:775698-775720 GATGACAGGGGCAAGCCACCGGG - Intergenic
1186517957 X:10180846-10180868 GACCACATGGGGATGCCACATGG + Intronic
1187126887 X:16462372-16462394 GAGCTCATGGGGAAGCCAGCCGG + Intergenic
1189171468 X:38913708-38913730 GAGCACGTTGGGAAGGCTCCTGG + Intergenic
1189543657 X:42019348-42019370 CATCATATGGGGAAGTCACAAGG - Intergenic
1190415741 X:50178741-50178763 GATTACAGGGGTAAGCCACCAGG - Intergenic
1194824412 X:98543741-98543763 GTTCACATATGGAAGGCACATGG - Intergenic
1195040424 X:101008962-101008984 GACTACATGGGAAAGACACCAGG - Intergenic
1199342069 X:146692613-146692635 GAACAAATAGAGAAGGCACCAGG - Intergenic
1200939727 Y:8768984-8769006 GAACACAGGTGGAAGGCACCTGG + Intergenic
1201383543 Y:13413350-13413372 TGTCACATGGGGCAGCCACCCGG - Intronic