ID: 1135640739

View in Genome Browser
Species Human (GRCh38)
Location 16:24117885-24117907
Sequence TGCAACGGAAGGGGAGCCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135640739_1135640747 -3 Left 1135640739 16:24117885-24117907 CCGTCGGCTCCCCTTCCGTTGCA 0: 1
1: 0
2: 0
3: 5
4: 128
Right 1135640747 16:24117905-24117927 GCAGGCTAAGGGCTGCTCCCAGG 0: 1
1: 0
2: 4
3: 35
4: 273
1135640739_1135640748 -2 Left 1135640739 16:24117885-24117907 CCGTCGGCTCCCCTTCCGTTGCA 0: 1
1: 0
2: 0
3: 5
4: 128
Right 1135640748 16:24117906-24117928 CAGGCTAAGGGCTGCTCCCAGGG 0: 1
1: 0
2: 1
3: 44
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135640739 Original CRISPR TGCAACGGAAGGGGAGCCGA CGG (reversed) Intronic