ID: 1135641642

View in Genome Browser
Species Human (GRCh38)
Location 16:24124826-24124848
Sequence CAGTGGGAATACAGGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 452}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135641642_1135641656 18 Left 1135641642 16:24124826-24124848 CCCTCTTTCCTGTATTCCCACTG 0: 1
1: 0
2: 1
3: 35
4: 452
Right 1135641656 16:24124867-24124889 CACAGCCATGTACAATGCATTGG 0: 1
1: 0
2: 1
3: 14
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135641642 Original CRISPR CAGTGGGAATACAGGAAAGA GGG (reversed) Intronic
901004398 1:6164900-6164922 CAGGGGGAAGAGAGAAAAGACGG + Intronic
901899406 1:12345970-12345992 CACTGGGACTACAGGCAGGAAGG - Intronic
902787986 1:18745441-18745463 CATTGGGACTCCAGCAAAGAGGG + Intronic
903790181 1:25887392-25887414 CAGTGGGTTAACAGGAAAGCCGG + Intronic
903920158 1:26794291-26794313 CAAGGGGAAACCAGGAAAGAAGG - Exonic
905895162 1:41540988-41541010 GGGTGGGAAAACAGGAAGGAAGG + Intronic
905921018 1:41718708-41718730 GAATGGGAAGACAGGAGAGATGG - Intronic
906119408 1:43378589-43378611 CAGTGGGAATAAAGGAATGGAGG + Intergenic
906178560 1:43798154-43798176 CATTGTGAAGACAGGAAAGGGGG - Intronic
907051319 1:51331233-51331255 CACTGGGAATGCAGGGGAGAGGG - Intronic
907379603 1:54075283-54075305 CTGTGGGAATACAGGGGAGACGG + Intronic
907391392 1:54160650-54160672 CAGTGGGAAGAAAGTAAGGAGGG + Intronic
907533124 1:55122260-55122282 CAGTAAGCATACTGGAAAGAGGG + Intronic
907907783 1:58799923-58799945 GGGAGGGAAGACAGGAAAGAAGG - Intergenic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908946116 1:69499531-69499553 CAGTGTGAATACAAGAAGGTAGG + Intergenic
909080598 1:71106808-71106830 GAATGAGAAAACAGGAAAGACGG - Intergenic
910264044 1:85320023-85320045 CACAGGCAATACAGGAAAGGTGG + Exonic
910368208 1:86488712-86488734 CACTGGGGAAACAGCAAAGAAGG - Intronic
912361160 1:109097038-109097060 CAATGGGATAACAGGAATGATGG - Intergenic
912450644 1:109765543-109765565 AAGAGGGAAATCAGGAAAGAGGG + Intronic
912791028 1:112651156-112651178 TGGTGGAAATCCAGGAAAGATGG - Intronic
912942743 1:114059500-114059522 GTCTGGGAAAACAGGAAAGAGGG - Intergenic
913961731 1:143343883-143343905 AAATGGGAATACAGGAAGAATGG + Intergenic
914056086 1:144169455-144169477 AAATGGGAATACAGGAAGAATGG + Intergenic
914123060 1:144796907-144796929 AAATGGGAATACAGGAAGAATGG - Intergenic
915667396 1:157457683-157457705 CAAAGGGAATACAGAATAGATGG - Intergenic
916000695 1:160612436-160612458 GAGAGGGAATACATGAAGGAGGG - Intronic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
918511761 1:185320187-185320209 CAGGGTGAATAAAGAAAAGATGG - Intergenic
918705879 1:187661419-187661441 CAATGTTAAAACAGGAAAGAAGG - Intergenic
919051193 1:192513410-192513432 CAGTGGGAAGGAAGGAAGGAAGG + Intergenic
919534142 1:198765757-198765779 GAGTGGGAATAGAGGCAAGGAGG - Intergenic
920710128 1:208287115-208287137 CAGTGGGAAACCAGGGAAAATGG - Intergenic
920852900 1:209640756-209640778 CACTGGGAATACAGCAGTGAAGG - Intronic
921030451 1:211331405-211331427 CAGTGGGAATACAGACACTATGG - Intronic
921418874 1:214923026-214923048 CTGTGGAAATACAAGAAAAAAGG + Intergenic
921967624 1:221107367-221107389 GAGTGGGAAGAGAGGAAGGAAGG - Intergenic
922358973 1:224803650-224803672 AAGTGGGACTACAGAAAATAGGG - Intergenic
923077089 1:230619429-230619451 TGGTGAGGATACAGGAAAGAGGG - Intergenic
923503890 1:234589319-234589341 CAGTGGCAGCACAGTAAAGAGGG + Intergenic
924027075 1:239844932-239844954 CAGTGTGAACTAAGGAAAGAGGG + Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
1063092998 10:2884748-2884770 AAATGGGAAGACAGGAGAGAGGG - Intergenic
1065239561 10:23692590-23692612 CAGTGGGAAATAAGGAAGGAGGG + Intergenic
1065438589 10:25726554-25726576 AAGTGGGGAGAGAGGAAAGAAGG - Intergenic
1065536561 10:26720874-26720896 CATTGGGAATATGGGAAACAGGG + Intronic
1065645208 10:27826735-27826757 CAGTGAAAATACCGGAAAGAGGG - Intronic
1065785208 10:29206635-29206657 CAGAGGGTACACAGGTAAGAGGG + Intergenic
1065958413 10:30713527-30713549 ATGTGGGAAAACAGGAATGAAGG + Intergenic
1066205826 10:33188423-33188445 CACTGGAAATACAGGTATGAAGG - Intronic
1066310000 10:34186785-34186807 CATTAAGAATACAGGAGAGAGGG - Intronic
1067102032 10:43340792-43340814 CAGTGGGAATGCAGGAAGCACGG + Intergenic
1068130925 10:52894267-52894289 CAGTGACAAGACAGGAAACAGGG + Intergenic
1068555335 10:58452605-58452627 CAGTTGCAATACTGGGAAGAGGG + Intergenic
1068895523 10:62195597-62195619 CAGAGGGAATGAAGGAAGGAAGG + Exonic
1068922244 10:62496884-62496906 CAGTGAGAATAAATAAAAGAAGG - Intronic
1070913831 10:80140065-80140087 CAGAGGGAATGCAGCAAAAATGG - Intronic
1072187233 10:93051717-93051739 CACTGGGAATTCAAGAAAAATGG - Intronic
1074437194 10:113444254-113444276 CAGTGGGAAAGAAGGACAGAGGG - Intergenic
1074753072 10:116605759-116605781 CTGTGGGAATACAGAAGATAAGG + Intronic
1074890547 10:117732760-117732782 TACTGAGAATACAAGAAAGAAGG + Intergenic
1076195824 10:128517136-128517158 CACTGGGGAAACAGGACAGAGGG - Intergenic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1078321016 11:10334656-10334678 CCTTGGGAATAAAGGGAAGATGG + Intronic
1078942203 11:16020121-16020143 CAATGTGAACACAGGAAAGGAGG - Intronic
1079942920 11:26704383-26704405 CTGAGGGAATACAAGAAAGCTGG + Intronic
1081803502 11:45876076-45876098 CAGAGGAAATGGAGGAAAGAGGG - Intronic
1081856508 11:46307685-46307707 CAGGGGGCAGGCAGGAAAGAGGG - Intronic
1082016173 11:47489854-47489876 CAGTGGCAAGATAGGAATGAAGG - Intronic
1083151255 11:60793183-60793205 CAGAGGGCATACAGAATAGAAGG + Intronic
1084229680 11:67742575-67742597 CAGAGGCCATGCAGGAAAGATGG - Intergenic
1084489246 11:69469407-69469429 CAGGGGGAAGACATGAAGGAAGG + Intergenic
1084523343 11:69679527-69679549 CACTTGGAATATAGGAAAAAGGG + Intergenic
1085212495 11:74793846-74793868 CAGTGGGAAGAAAGGTAAAAAGG - Intronic
1085350457 11:75795037-75795059 GAGTGAGAAGAAAGGAAAGAAGG - Intronic
1085568618 11:77539415-77539437 GAGTGAGGATACAAGAAAGAAGG + Intronic
1085930520 11:81077219-81077241 CAGTGGGAAGACAGAGAAGAAGG - Intergenic
1085939234 11:81188337-81188359 AAGTGGGAAAAGAGGAAAAAAGG + Intergenic
1086832751 11:91585697-91585719 GACTTGGAATACAGGAACGATGG - Intergenic
1086849024 11:91786569-91786591 CAGTGGTAATGCAGGGCAGATGG - Intergenic
1087115954 11:94524699-94524721 CACTGAGAATACATGAATGATGG - Intergenic
1087190067 11:95244875-95244897 CAGTGGCATCACAGGTAAGAAGG + Intergenic
1087460747 11:98443541-98443563 AAAAAGGAATACAGGAAAGAAGG - Intergenic
1087629089 11:100629449-100629471 CAATGGGAAAACCTGAAAGAAGG + Intergenic
1087884476 11:103462141-103462163 CAGTGGTAATAAATGAAAGGTGG - Intronic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1089578626 11:119466617-119466639 TAAAGGGAAGACAGGAAAGAAGG - Intergenic
1090078675 11:123595753-123595775 CAGTGGGCAGACAGCAAAGTGGG - Intronic
1090570858 11:128043521-128043543 CAGAGGGCTTATAGGAAAGATGG - Intergenic
1090964462 11:131585869-131585891 CAGGGAGAAGAAAGGAAAGATGG - Intronic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1091536722 12:1417245-1417267 TAGTGAGAATCCAGGACAGAAGG - Intronic
1092258133 12:6938103-6938125 CAGAGGGAAGGAAGGAAAGAGGG - Intronic
1093125058 12:15318518-15318540 CAGTGGAAATACGCTAAAGAAGG - Intronic
1093547856 12:20369251-20369273 CACTGGGAATTCAGTGAAGAGGG + Exonic
1093697060 12:22172572-22172594 AAGTCGGAAAACAGGAAGGAAGG + Intronic
1094650104 12:32367913-32367935 CAGTAGGAATACAAGAGAGCTGG + Intronic
1095572633 12:43700395-43700417 TGCTGGGAATCCAGGAAAGAAGG + Intergenic
1095780942 12:46058967-46058989 CTGTGGGATTACGGGAATGAGGG - Intergenic
1096591660 12:52664026-52664048 CTGGAGGAATACAGGAAGGAGGG - Intergenic
1096715301 12:53487429-53487451 CTGTGGGAATGAAGGAAGGAGGG + Intronic
1097016494 12:55991040-55991062 CAGTGTGAAAACAGGAAGGAGGG + Intronic
1097449760 12:59722098-59722120 GAGTGGAAATACTGAAAAGAGGG - Intronic
1097518539 12:60637997-60638019 CAAAGGGAATACAGAGAAGAAGG + Intergenic
1098293431 12:68980623-68980645 CAATAGGAATACAGCAATGAGGG - Intergenic
1099065991 12:77980000-77980022 GTGTGGGAAAACAGGAATGAGGG + Intronic
1099232678 12:80045262-80045284 CAGAGGGAATTCAGCAAAAAAGG - Intergenic
1100022101 12:90081722-90081744 ATGTGGCAAAACAGGAAAGATGG + Intergenic
1101221662 12:102647612-102647634 AAGTGACCATACAGGAAAGAGGG + Intergenic
1102390344 12:112544477-112544499 CAGTGGGGGTAGGGGAAAGAGGG + Intergenic
1102662471 12:114541667-114541689 CAGTGGGGATTTAGGAATGAGGG + Intergenic
1102665269 12:114566634-114566656 CAGTGGGGATTTAGGAATGAGGG - Intergenic
1102953284 12:117044354-117044376 GAGTGGGAAGACAGGGAGGAAGG - Intronic
1103052357 12:117791158-117791180 TGGTGGGCATAAAGGAAAGAAGG - Intronic
1106333067 13:28756945-28756967 CAGTGAGAGTAGAGGAGAGAAGG - Intergenic
1106499965 13:30318465-30318487 CAGTGGCAGTTCAGGAAAAAGGG - Intergenic
1106598575 13:31168121-31168143 CAATGGGAAAACAGCAAAAAGGG + Intergenic
1106843803 13:33715173-33715195 AAATGGAAATACAGGAAGGAAGG + Intergenic
1106881907 13:34140769-34140791 CAGTGGAAGTGCTGGAAAGAGGG + Intergenic
1107355965 13:39567184-39567206 AAGTGGGAATATAAGAAACAAGG - Intronic
1107577419 13:41741891-41741913 CAGTGGGGACACAGAAGAGAAGG + Intronic
1107809804 13:44189414-44189436 CAATGGGAATTCAGCAGAGAAGG - Intergenic
1110598018 13:77340316-77340338 CAGTTGGTATAGAGAAAAGAGGG + Intergenic
1111726018 13:92010174-92010196 CAGATGTAAAACAGGAAAGAAGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112167454 13:96934908-96934930 CAGTGGGAAGAAACAAAAGAAGG - Intergenic
1114635400 14:24184240-24184262 CAGTGGGAAGACAGGAGGGGAGG + Intronic
1114647591 14:24264187-24264209 TAGTGGGAAGGAAGGAAAGAAGG - Intronic
1117447551 14:55819096-55819118 CAGTGGGAATGCACGAAAGAAGG + Intergenic
1119484820 14:74980518-74980540 CAGTGGGAATGTGGGAAAGAAGG + Intergenic
1119955669 14:78796274-78796296 AAGTGGGAATTTGGGAAAGATGG - Intronic
1120085765 14:80270830-80270852 GAGTGAGAAAACAGAAAAGAGGG + Intronic
1120715666 14:87838427-87838449 CAGCGGAAAGACAGGCAAGAGGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1122390048 14:101373905-101373927 AGGTGGGAATACAGGTAACAGGG - Intergenic
1122451046 14:101807884-101807906 GAGTGGGAATACAGAAATAAGGG - Intronic
1126077606 15:44927536-44927558 CAGAAGGAAGAAAGGAAAGAAGG - Intergenic
1126081102 15:44962975-44962997 CAGAAGGAAGAAAGGAAAGAAGG + Intronic
1126221542 15:46220003-46220025 AGGTGAGAATACAGGAAAGCTGG + Intergenic
1127011874 15:54640132-54640154 TAGTGGGAATACAGATTAGATGG - Intergenic
1127144017 15:56006710-56006732 AACTTGGAATACAGGAAAAAGGG - Intergenic
1128348100 15:66867492-66867514 CAGTTGGAGCACAGGAAAGATGG + Intergenic
1128594730 15:68933494-68933516 CAGTGCAAATACATTAAAGAGGG - Intronic
1130010733 15:80151766-80151788 AAGAAGGAAGACAGGAAAGAAGG - Intergenic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130275058 15:82472182-82472204 GAGTGGGCAAACAGGGAAGAAGG - Intergenic
1130467407 15:84199551-84199573 GAGTGGGCAAACAGGGAAGAAGG - Intergenic
1130486213 15:84399689-84399711 GAGTGGACAAACAGGAAAGAAGG + Intergenic
1130496853 15:84473984-84474006 GAGTGGGCAAACAGGGAAGAAGG + Intergenic
1130589702 15:85204149-85204171 GAGTGGGCAAACAGGGAAGAAGG - Intergenic
1131045721 15:89313556-89313578 CAGCGGGGGTACAGGAAAGGAGG + Intronic
1131985720 15:98041549-98041571 ATGAGGGAATTCAGGAAAGAGGG - Intergenic
1132192503 15:99879331-99879353 AAGAGGGAATAAAGGAAAAAAGG - Intergenic
1132817520 16:1839287-1839309 CTGTGAGACTACAGGAATGAAGG + Exonic
1133052696 16:3126264-3126286 AAGTGGCATGACAGGAAAGAAGG - Intergenic
1133371811 16:5251031-5251053 TAGTGTGAATAAAAGAAAGAGGG - Intergenic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1135267486 16:21040050-21040072 CAGTGACAATAAAGGCAAGAAGG + Intronic
1135641642 16:24124826-24124848 CAGTGGGAATACAGGAAAGAGGG - Intronic
1135945396 16:26860546-26860568 GTGTGGGAAAACAGGAATGAGGG + Intergenic
1137582058 16:49639583-49639605 CAGTGGGAACAAAGAAAACAAGG - Intronic
1137683424 16:50369904-50369926 CAGAGGGAAGACAGGAACCAAGG + Intergenic
1137947993 16:52752591-52752613 AAGAGGGAAGAAAGGAAAGAGGG + Intergenic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1138336748 16:56259413-56259435 CAGTTGGAAACCAGGAAGGATGG - Intronic
1140578632 16:76202501-76202523 TAATGGGAAGAAAGGAAAGACGG - Intergenic
1140822815 16:78679004-78679026 CAGTGGAGAGACAGGAAAGCAGG + Intronic
1141360365 16:83390107-83390129 CAGTGGTAATACAAGAAACATGG + Intronic
1141725129 16:85782881-85782903 CAGGGAGAATGCAGGAAAGGAGG - Intronic
1142945548 17:3423395-3423417 CAGGTGGAACACAGGAAAGGAGG - Intergenic
1144059994 17:11574760-11574782 CAGTGGGATTGGAGGGAAGATGG + Intergenic
1144352010 17:14405605-14405627 CAGTGGGAAGAGAGGAAGGCTGG + Intergenic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146835733 17:36109013-36109035 CAGTGGGAACCCAAGAGAGAAGG - Intergenic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147568392 17:41551773-41551795 CAGTGGCAATGAAGGAACGAGGG - Intergenic
1148444189 17:47727699-47727721 CAGTGTGAACACAGAACAGAGGG - Intergenic
1149012392 17:51871025-51871047 AAGTGGGAAGAAAGTAAAGAAGG - Intronic
1150440179 17:65184837-65184859 CAGTGAGAAGGAAGGAAAGAAGG - Intronic
1150544336 17:66138205-66138227 CTGTGGGAAAACAGGAATTAGGG + Intronic
1151304137 17:73252103-73252125 GAGTGGGAATAAAGGGATGAGGG + Intronic
1151633368 17:75326445-75326467 CAGTGGGACTAAGGGAAAGTGGG + Intronic
1152645579 17:81467114-81467136 CTGTGGCAAGAAAGGAAAGACGG + Intergenic
1153693492 18:7616771-7616793 AAGTGGGAAGACAGGCAGGATGG - Intronic
1155867627 18:30985226-30985248 CAGTGGGCATGCAGCAAAAATGG - Intergenic
1156233648 18:35180016-35180038 CCATGGGAAGACAGGAGAGAGGG - Intergenic
1156750198 18:40443987-40444009 GAGTGGAAAAACAGGAAAGAGGG + Intergenic
1156806716 18:41191787-41191809 CAGTGTGAACACAGGCAAGATGG - Intergenic
1157126502 18:44961119-44961141 CAGAGGGAATGAAGGAAGGAGGG + Intronic
1157449717 18:47776277-47776299 CAGTTGGGACACAGGCAAGAAGG + Intergenic
1157627369 18:49061683-49061705 CAGTGGGAACAGAGGAGAGCTGG + Intronic
1158001143 18:52620693-52620715 CAGAGGGAAAACTGCAAAGAGGG - Intronic
1158293522 18:55968882-55968904 CAGTGGTAATAAAGGAAGCAAGG - Intergenic
1158411795 18:57212051-57212073 CAGAGGGAATGAAGAAAAGAAGG + Intergenic
1158636887 18:59166758-59166780 CAGGAGGAATCCAGGACAGAGGG + Intergenic
1159554230 18:69928498-69928520 CCGGGGGAATGCAGGAAACATGG + Intronic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161897720 19:7095094-7095116 GTGTGGGAATACAGGAATTAGGG - Intergenic
1161954171 19:7483550-7483572 CAGAGGGCATAGAGGAACGAGGG + Intronic
1161970853 19:7579283-7579305 GTGTGGGAAGGCAGGAAAGAGGG - Intergenic
1163039579 19:14592384-14592406 CTGGGGGAATACAGGGAACAGGG + Intronic
1163311394 19:16517044-16517066 CTGTGGGAACACAGGGTAGAGGG - Intronic
1164275831 19:23717085-23717107 CAGAGGGATTACTGGAAACATGG + Intergenic
1164286231 19:23820142-23820164 CCCTGGGAATGCAGGAAATAGGG - Intronic
1164401553 19:27905515-27905537 CAGTGGGGAGGCAGGAGAGAAGG - Intergenic
1164484704 19:28645003-28645025 TAGTGGGAAAAGAGGAAACAAGG + Intergenic
1164578874 19:29422103-29422125 CAGTGGGAGGACAGGACAGCAGG + Intergenic
1164744478 19:30601073-30601095 CTGTGGGAACACAGGGAATATGG - Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1167660535 19:50793661-50793683 CTGTGGGGAGACAGGACAGATGG - Intronic
1202695569 1_KI270712v1_random:122140-122162 AAATGGGAATACAGGAAGAATGG + Intergenic
925786510 2:7436370-7436392 CCGTGGGAACATGGGAAAGAAGG - Intergenic
926176621 2:10598453-10598475 CTGTGGGAATACAGGGAATGTGG + Intronic
926534378 2:14092648-14092670 CAGAAGGAAGAAAGGAAAGAAGG + Intergenic
926792503 2:16588611-16588633 CAGTGGAAAGACAACAAAGACGG + Intronic
926913707 2:17874230-17874252 CAGTGAGCATAGAGGAGAGATGG + Intergenic
927050570 2:19324222-19324244 CAGAAGGGATAAAGGAAAGAAGG + Intergenic
927295853 2:21452384-21452406 CAGGGTGAATACAGGGAAGTGGG - Intergenic
927418321 2:22903028-22903050 GAGGGGGAAGGCAGGAAAGAAGG + Intergenic
927527492 2:23759414-23759436 CAGTGTGAATATAAGAAACAAGG - Intronic
928419171 2:31124207-31124229 CAGTTGGCAAGCAGGAAAGATGG - Intronic
929909110 2:46073828-46073850 CACTTGGAATACTGGAAGGACGG - Intronic
930195499 2:48505926-48505948 CAGTGGGCAGCCAGGAAAGCAGG + Intronic
932745777 2:74332395-74332417 CAGTTGAAAAGCAGGAAAGAAGG - Intronic
933846621 2:86332051-86332073 CCCTGGGAATACAGGGAAAAAGG - Intronic
933971315 2:87472135-87472157 CAGAGGGAATAAAGGAGGGAGGG - Intergenic
934276734 2:91579181-91579203 AAATGGGAATACAGGAAGAATGG + Intergenic
934583727 2:95469484-95469506 TCGTGGAAATACAGGGAAGAAGG + Intergenic
934595725 2:95607230-95607252 TCGTGGAAATACAGGGAAGAAGG - Intergenic
935487838 2:103679813-103679835 CAATGGGAATATTGGAAAGGAGG + Intergenic
936271891 2:111055339-111055361 CAGTTAGAATGCAGGAAAGAGGG - Intronic
936322415 2:111478064-111478086 CAGAGGGAATAAAGGAGGGAGGG + Intergenic
937469337 2:122161932-122161954 CAGTGGGAATAAAGGAAGTAAGG - Intergenic
937783259 2:125864720-125864742 GTGTGGGAAAACAGGAATGAGGG + Intergenic
939421756 2:141980538-141980560 CAGTGGAGAAACTGGAAAGATGG + Intronic
940183224 2:150956991-150957013 CAGGGTGAGAACAGGAAAGAAGG - Intergenic
940769291 2:157823560-157823582 AAGTGGAAATACAGTGAAGATGG + Intronic
941235922 2:162973807-162973829 CACTGGGAAGGAAGGAAAGAAGG + Intergenic
941447760 2:165623762-165623784 AAGTAGGAATTCAGGAAGGAGGG - Intronic
945581553 2:211601783-211601805 AGATGGGAAGACAGGAAAGAAGG + Intronic
946151270 2:217773091-217773113 CAGGAGGAAGACAGCAAAGAGGG - Intergenic
946343368 2:219087069-219087091 GAGTGGGAGTAGAGAAAAGAAGG - Intronic
946450888 2:219778124-219778146 CAGGAGGAAAACAGGAAAGAAGG - Intergenic
947351014 2:229245196-229245218 CAAAGGGAACACAGGAAAAAGGG - Intronic
947371811 2:229454295-229454317 ATGTGGGAATACAGGCCAGAGGG + Intronic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
948189978 2:236051074-236051096 CAGTGTGACTAAAGAAAAGATGG - Intronic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171070634 20:22065043-22065065 CAGTGGAAATAGTGGAAAGATGG - Intergenic
1172080588 20:32337760-32337782 CAGGGGAAATACAGGACAGACGG + Intergenic
1172795659 20:37535421-37535443 CAGTGGTGATACAGGAAAGTAGG + Intergenic
1172926531 20:38542032-38542054 AAGTGAGCATACTGGAAAGAGGG + Intronic
1173124954 20:40328112-40328134 CAGTGTGAAGAAAGGAAAAAAGG - Intergenic
1173456062 20:43202477-43202499 CAGTGGCAAGACAAGAAAGGAGG - Intergenic
1173722240 20:45269467-45269489 CCATGGGAATACAGTAAAGAGGG + Intergenic
1173926536 20:46785238-46785260 CAGTGGGGTTGCAGCAAAGAGGG - Intergenic
1176184234 20:63769382-63769404 CCCTGGGAACACAGGAAAGGAGG + Intronic
1177661915 21:24095766-24095788 AAATGGGGATTCAGGAAAGAAGG - Intergenic
1178798449 21:35767748-35767770 CAGTGTGGCTACAGGAGAGAAGG - Intronic
1180123672 21:45770997-45771019 CAGTGGAAATTTGGGAAAGATGG + Intronic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1182323755 22:29495886-29495908 CTCTGGGAATACAGAAAACAGGG + Intergenic
1183919489 22:41153482-41153504 CGGTGGGATTACAGGCATGAGGG - Intronic
1184359627 22:44007219-44007241 CAGGGGGTACCCAGGAAAGATGG + Intronic
1184450759 22:44581204-44581226 CCGTGTGAATAGAGGAGAGATGG + Intergenic
1185336495 22:50272922-50272944 CACTGGGCAGTCAGGAAAGAAGG - Intergenic
949243169 3:1894910-1894932 CACTGGGAATAAAGGGAAGTTGG + Intergenic
949243484 3:1898016-1898038 TAGTGAGAATGTAGGAAAGAGGG + Intergenic
950175936 3:10874444-10874466 CAGAGGGGGTAAAGGAAAGAAGG - Intronic
950427770 3:12933934-12933956 CAGTGGGGAGACAGGAAACCAGG - Intronic
950528158 3:13536619-13536641 CAGTGGAAGGACAGGAAGGAGGG - Intergenic
950541962 3:13618235-13618257 CAGTGAGAAGCCAGGAAAGCAGG - Exonic
951255230 3:20441050-20441072 CAAAAGGAATACAGGAAGGAAGG + Intergenic
951642823 3:24855128-24855150 GACTGGGAAGATAGGAAAGAAGG + Intergenic
952001432 3:28789796-28789818 CAGTGAGGAGCCAGGAAAGAAGG - Intergenic
953495397 3:43382065-43382087 CAGTGCGGATACAGCAAAGGTGG + Intronic
953970144 3:47340942-47340964 TAATGGAAATACAGGCAAGAGGG + Intronic
954554747 3:51508998-51509020 CAGAGGGAAGACGGGCAAGATGG + Intergenic
954710002 3:52500955-52500977 CAGTGGGAATGCAGTGCAGATGG - Intronic
955393385 3:58537126-58537148 CAGTGCGGACACAGGACAGAGGG - Exonic
955804965 3:62724220-62724242 AGGAGGGAATACAGGAAAGGTGG - Intronic
955995250 3:64673992-64674014 AAGTGGGAACAAATGAAAGAAGG + Intronic
956329309 3:68087630-68087652 CAAAGGGAAGAAAGGAAAGAAGG - Intronic
956783700 3:72624788-72624810 AAGGGGGAAAACAGGAAGGAGGG + Intergenic
958144551 3:89606985-89607007 CAGGTGTAATACAGGAATGAGGG - Intergenic
958816573 3:98923350-98923372 CAGTGAGAATATAGGTAAAATGG - Intergenic
959118272 3:102203775-102203797 CAGAGGAAAAAAAGGAAAGAAGG - Intronic
959391763 3:105783667-105783689 CAGTGGGAATAAAGCTGAGATGG + Intronic
959902899 3:111679930-111679952 CAGTGGAAAGAAAGCAAAGAGGG - Intronic
961160709 3:124722335-124722357 AAGTGAGAAGACAGGAAAGGAGG + Intronic
961168620 3:124780309-124780331 CAGTGGGGCTGCAGGAAGGAAGG + Intronic
961222063 3:125208989-125209011 CAGTGGGAAGACAGGCTAGTGGG - Intronic
961396837 3:126599387-126599409 TAGAGGGAAGATAGGAAAGAGGG - Intronic
961427037 3:126856507-126856529 CAGTGGGAGCACAGCTAAGATGG - Intronic
961449773 3:126997437-126997459 CAGTGGGGGCACAGCAAAGACGG - Intronic
961878315 3:130041696-130041718 CAGAGGCCATGCAGGAAAGATGG - Intergenic
963065879 3:141264169-141264191 CAGTGGGAAAAGAGGAAAAGAGG + Intronic
963923642 3:150929020-150929042 CTGTGGAAAAACAAGAAAGAGGG + Intronic
964213988 3:154258939-154258961 GAGTGAAAATCCAGGAAAGAAGG - Intergenic
964295556 3:155229087-155229109 AAGTGGGAATACATGATTGATGG + Intergenic
966130586 3:176633687-176633709 CTGTGGGAATGCAGGAAGGTGGG + Intergenic
967381792 3:188867136-188867158 CAGCTGTAATACAGGAAAGAAGG - Intronic
967542052 3:190679506-190679528 CAGGGGGAATCCAGGAACGATGG + Intergenic
967664874 3:192158964-192158986 CATTGGGATCACAGGAGAGAGGG - Intronic
968334136 3:197898910-197898932 CAGTAAGAAAAAAGGAAAGAAGG + Intronic
968743808 4:2346865-2346887 GAATGGGAATAAAGAAAAGATGG + Intronic
968990534 4:3908531-3908553 CAGAGGCCATGCAGGAAAGATGG - Intergenic
970227169 4:13871177-13871199 AAGAAGGAAGACAGGAAAGATGG - Intergenic
970451534 4:16171222-16171244 CACAGGGAACACAGGAAAAATGG + Intronic
970989470 4:22195713-22195735 CAAAGGGAACCCAGGAAAGAAGG - Intergenic
971825738 4:31620190-31620212 CAGAAGGAAAAAAGGAAAGAAGG - Intergenic
972072654 4:35039748-35039770 AGCTGGGAATACAGGAGAGATGG - Intergenic
972119911 4:35687881-35687903 AAGGGAGAATTCAGGAAAGAAGG - Intergenic
972280922 4:37601554-37601576 CTGTGCCAATCCAGGAAAGATGG + Intronic
972944237 4:44234481-44234503 CAGGAAGAATACAGGAAAGTAGG + Intronic
973016284 4:45142821-45142843 CAGTTGGAAGGAAGGAAAGAAGG - Intergenic
973016298 4:45142884-45142906 CAGTTGGAAGGAAGGAAAGAAGG - Intergenic
973095811 4:46197914-46197936 CAGTGGGGGTAATGGAAAGAAGG - Intergenic
973100260 4:46258952-46258974 AAGTTTGAATACAGAAAAGAGGG + Intronic
973608752 4:52613211-52613233 CACTGGAAAGAAAGGAAAGAGGG + Intronic
973981156 4:56309403-56309425 AAATGGCAATACAGGATAGATGG + Intronic
974429769 4:61780640-61780662 CAGTGGGAATGGATGGAAGAAGG - Intronic
974471200 4:62320077-62320099 CAGAGGACATAGAGGAAAGAAGG + Intergenic
974578540 4:63762422-63762444 CAGTGTGGATAAAGGAAAAAGGG + Intergenic
975057636 4:69954515-69954537 CACTGGAAATATAAGAAAGATGG + Intergenic
975772650 4:77744767-77744789 AACTGGGAATACAGGAAAAAGGG - Exonic
976838870 4:89407798-89407820 CAGAGAGAGGACAGGAAAGAAGG + Intergenic
977183846 4:93911614-93911636 CAGGAGGAATAGAGGAAAGAGGG - Intergenic
977662233 4:99603231-99603253 CAGTGGAGACACAGGAAAGATGG + Intronic
977963399 4:103111590-103111612 CACTGGGAATTCACAAAAGAGGG + Intronic
978592883 4:110345199-110345221 AAGGGGGAAGAAAGGAAAGAAGG - Intergenic
978974997 4:114858706-114858728 CATTGGGAATACTGGTAAGGGGG - Intronic
979518928 4:121643648-121643670 CAGTGTAAATAAAGGGAAGAGGG - Intergenic
980203289 4:129684233-129684255 GAGAGGGAAGAAAGGAAAGAAGG - Intergenic
980401054 4:132286498-132286520 CAGTGGGGTTATAGGAAACAAGG - Intergenic
981122848 4:141072456-141072478 CAGTGGGACAAAAGGAAAAAAGG + Intronic
981667621 4:147247199-147247221 GAGAGGGAATACAGGAAGAAAGG + Intergenic
982087126 4:151846982-151847004 CAGTGGGGATAAAGGAGTGAGGG - Intergenic
982907093 4:161088290-161088312 TAGTGGGATTACAGGATTGAAGG - Intergenic
983279887 4:165667039-165667061 CAGGAGGAAGACAGGAAGGAAGG + Intergenic
984002419 4:174266331-174266353 CAGTAGGAATACAGAAAATAAGG - Intronic
984837748 4:184038272-184038294 CTGTGTGTATACGGGAAAGATGG - Intergenic
984874733 4:184357020-184357042 CTGTGGGGATGCAGCAAAGATGG + Intergenic
985358886 4:189151141-189151163 AAGGGGGAACAAAGGAAAGAAGG - Intergenic
985751163 5:1676553-1676575 TAGTGAGAATACAAGAAAAAGGG + Intergenic
986285522 5:6355657-6355679 CATGGGGCAGACAGGAAAGAAGG - Intergenic
986587762 5:9336287-9336309 AAGTGGGAATGCAGGGCAGAAGG + Intronic
986763240 5:10899055-10899077 CAGTAGGAATGCTGGAGAGAGGG + Intergenic
986974181 5:13376698-13376720 CATAGTGAGTACAGGAAAGATGG + Intergenic
987937284 5:24482363-24482385 CAGTGTGAACACAGGAAGGCAGG + Intergenic
987941945 5:24550295-24550317 AAGTGGAAAGACATGAAAGATGG - Intronic
988786572 5:34570727-34570749 CAGTGGGAAGAGAGGAAGGGCGG + Intergenic
989275260 5:39581526-39581548 CAGTGGGGATACATGAAGGTAGG - Intergenic
989289123 5:39741136-39741158 CAGGGAGAAGGCAGGAAAGAGGG - Intergenic
990261371 5:54026672-54026694 AAGTGGGACTACAGGAGACATGG + Intronic
990406896 5:55500713-55500735 CAGTGTGAAGACAGAATAGACGG + Intronic
991511001 5:67376221-67376243 CAGTGGGAACAGATGACAGATGG - Intergenic
991956685 5:72001754-72001776 AACTGGGAATTCAGGCAAGATGG - Intergenic
992116242 5:73540890-73540912 AAGAGGGAAGAAAGGAAAGAGGG + Intergenic
993918906 5:93775680-93775702 CTGTGGGAAAACATGCAAGATGG - Intronic
995234147 5:109807122-109807144 CCTTGTGAATACAGGAGAGAGGG + Intronic
995295251 5:110513091-110513113 CAATGGAAAGACAGGAAAGGAGG + Intronic
996637637 5:125713367-125713389 CACTGGGAATCCAGGATGGAGGG - Intergenic
999509742 5:152236901-152236923 CAGAGAAAATTCAGGAAAGAGGG - Intergenic
999979657 5:156945600-156945622 CAGTGGGAAGAGAGGAAGTAGGG + Intronic
999979728 5:156946327-156946349 CAGTGGGAAAACAGAAAATCTGG - Intronic
1000763483 5:165255708-165255730 CAGTGAGAATATAGGCAAGCAGG + Intergenic
1001304556 5:170562241-170562263 CAGAGGGAATACTGGACAGAGGG + Intronic
1003366002 6:5475651-5475673 CAGTGTGACTACAGGAGTGAGGG - Intronic
1004566434 6:16802369-16802391 GAGAAGGAAGACAGGAAAGATGG - Intergenic
1005203186 6:23370288-23370310 TAGTGGGAATCAAGGACAGAAGG - Intergenic
1005594441 6:27365879-27365901 CAATGTGAATAGAGCAAAGAAGG + Intergenic
1005613605 6:27551047-27551069 CAGTAGGAAAACATCAAAGATGG - Intergenic
1005770960 6:29070721-29070743 CAGTGGAAATACATGAAGGATGG + Intronic
1007425753 6:41744841-41744863 GAGTGGGAAGAGAGGAAGGAGGG - Intronic
1008390062 6:50940056-50940078 TAGTGGGTAAACAGGAAATAAGG - Intergenic
1012505575 6:99942653-99942675 CAGTGGGAATGCAGCAATCAAGG - Intronic
1012766890 6:103378095-103378117 GAGTGTGAATAAAGGAAGGACGG + Intergenic
1013068378 6:106705452-106705474 GTGTGGGAAAACAGGAATGAGGG + Intergenic
1013079416 6:106799456-106799478 CAGGGGGACTCCAGGCAAGACGG + Intergenic
1014235845 6:118953628-118953650 CTCTGGAAATACAGCAAAGAGGG + Intergenic
1016343750 6:143088759-143088781 CAAAGTGAATACAGGAAACATGG + Intronic
1016361456 6:143272180-143272202 CAGTGGGAACACGAAAAAGAGGG + Intronic
1017588644 6:155954119-155954141 CACTGAGGATAAAGGAAAGAAGG + Intergenic
1018345912 6:162899289-162899311 CAGTGTGAAGACAGGAGAGCTGG + Intronic
1018437943 6:163779965-163779987 CAGTGGGAATAAAAGAAAGCTGG + Intergenic
1018595195 6:165471645-165471667 CAGAGGGAAGAAAGGAAAGGAGG - Intronic
1018783581 6:167091052-167091074 AAGTGGAATTACAGGAAAAATGG - Intergenic
1019257652 7:62142-62164 AAGTGGGAACACAGAAAGGAAGG - Intergenic
1019605678 7:1909050-1909072 CAGTGGGAACACAGGGCAGGAGG + Intronic
1020255472 7:6500810-6500832 AGATGGGAAGACAGGAAAGAAGG - Intronic
1020313370 7:6886651-6886673 CAGAGGCCATGCAGGAAAGATGG - Intergenic
1020391721 7:7665671-7665693 CAGAGGGAACAAAGGAAGGAGGG - Intronic
1021354921 7:19642464-19642486 CACTTGGAATCCAAGAAAGAAGG - Intergenic
1021655734 7:22871932-22871954 TAGTGGGAATAAAGGGAAGGGGG - Intergenic
1022322446 7:29299720-29299742 CAATGGAAATACAGGAATTATGG - Intronic
1024020470 7:45363645-45363667 CAGTGGACAGACAGGAAAGCAGG - Intergenic
1024362230 7:48480181-48480203 AAATGGGAAAACAGGAAAGAAGG - Intronic
1024471352 7:49770964-49770986 GGGAGGGAATAAAGGAAAGAAGG + Intergenic
1027542966 7:79491731-79491753 CAGTGTGAAGACAAGGAAGATGG - Intergenic
1028988399 7:97025210-97025232 TAGTGGGAAGCAAGGAAAGATGG - Intergenic
1029317483 7:99727585-99727607 CAGGTGAAAAACAGGAAAGAAGG - Intronic
1029328613 7:99832147-99832169 CTCTGAGAAAACAGGAAAGAAGG + Intronic
1030006336 7:105124273-105124295 CAGCGGGAAGGAAGGAAAGAGGG - Intronic
1031184589 7:118460482-118460504 CTGTGGGAAGGCAGGAAATAAGG - Intergenic
1031310885 7:120195624-120195646 CAGTAGGAAAAGAGTAAAGAGGG - Intergenic
1032276410 7:130460055-130460077 CAATGGGAAAACTGGAAAAATGG - Intergenic
1033653896 7:143361267-143361289 CTGGGGGAAAAGAGGAAAGATGG + Intronic
1034260054 7:149749653-149749675 CAGGGGGATGACAGGAAGGAGGG - Intergenic
1034433920 7:151054149-151054171 CAGTGGGACTACAGGAAGGCAGG - Intronic
1034459619 7:151191303-151191325 CCTTGGGAATGCAGGAGAGAGGG - Intronic
1035386869 7:158478865-158478887 CAGTGGGAATGGGGCAAAGATGG + Intronic
1037821593 8:22137726-22137748 CAGTGGGAGCACAGGCAGGAGGG - Intergenic
1037838560 8:22228642-22228664 CAGTGGGAATGCTGCAAAGCCGG + Intronic
1038095074 8:24299888-24299910 CATTGGGAATGCAGTAAGGATGG + Intronic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039855263 8:41406650-41406672 AAGTGGGAATTTGGGAAAGAAGG - Intergenic
1040064454 8:43133765-43133787 CAGGGGGCAAAGAGGAAAGAGGG + Intergenic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1040747277 8:50660476-50660498 CAGAGGGGAGAAAGGAAAGAAGG + Intronic
1040809550 8:51436491-51436513 CAGTGGGATCACATGGAAGAAGG - Intronic
1040938378 8:52805753-52805775 CAGTGAGAATAATGGATAGAAGG + Intergenic
1041241983 8:55855991-55856013 CAGTGGCAAAAGAAGAAAGAGGG + Intergenic
1041551953 8:59113157-59113179 CAGTTGGAATACAGTAAATTAGG - Intronic
1041575728 8:59392718-59392740 CAGTGAGAATGCTGGAAAGAGGG - Intergenic
1042497860 8:69475447-69475469 CAGTGGGAATAAGGAAAGGATGG + Intronic
1043378163 8:79673077-79673099 AAGTGTGGATACAGAAAAGAAGG - Intergenic
1043733496 8:83715337-83715359 CACTGAGAATACATGAGAGAGGG - Intergenic
1044479617 8:92670183-92670205 AAATAGAAATACAGGAAAGATGG - Intergenic
1044893995 8:96868707-96868729 CACAGGGAATAGAGGAAATATGG - Intronic
1046002426 8:108437131-108437153 CAGTGGGGATAGAGGTATGATGG - Intergenic
1047722832 8:127657676-127657698 CAGAGGGAAGGCAGGGAAGAAGG + Intergenic
1048566099 8:135599630-135599652 CACTGGGAATACAAGAGAAAGGG + Intronic
1048673908 8:136754918-136754940 CAGTTGAAAGAAAGGAAAGAGGG - Intergenic
1049001819 8:139831106-139831128 CAGTGGGCAAACAGGAGAGAGGG + Intronic
1049955468 9:688916-688938 CAGTGGGAAAGAAGGAAAGCAGG - Intronic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1051518714 9:17960095-17960117 CAATGGAAACACAGGAAAGAAGG - Intergenic
1052609388 9:30752273-30752295 AAGTGGGTATACAGTAAAGCTGG - Intergenic
1052760465 9:32585413-32585435 CGGTGGGAAAAGAGAAAAGAAGG - Intergenic
1053527885 9:38847935-38847957 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1053595026 9:39551818-39551840 TAGTGAGAAAAGAGGAAAGAGGG - Intergenic
1053852808 9:42306846-42306868 TAGTGAGAAAAGAGGAAAGAGGG - Intergenic
1054200106 9:62072371-62072393 CAGTGCTAAAACAGGGAAGAGGG - Intergenic
1054207545 9:62144370-62144392 CGGTGGGGAAACAGGAAGGAAGG + Intergenic
1054638249 9:67515989-67516011 CAGTGCTAAAACAGGGAAGAGGG + Intergenic
1054810844 9:69432735-69432757 CAGGGGGCTTTCAGGAAAGACGG - Intronic
1054884256 9:70178698-70178720 TAGTGGGTATTCAGGAAATATGG - Intronic
1055128792 9:72750828-72750850 CAGTTGGAGTACATGAATGAGGG - Intronic
1055637659 9:78294811-78294833 CAGTGGAGACACAGCAAAGAGGG - Intergenic
1055884430 9:81043820-81043842 CAAAGGGAGTAAAGGAAAGATGG + Intergenic
1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG + Intergenic
1057543109 9:95994381-95994403 CAGTGAGAAAACTGGAAACAAGG - Intronic
1057794064 9:98143205-98143227 GAGGGGGAAGACAGGACAGAAGG + Intronic
1058170657 9:101677272-101677294 CAGTGAGAATACTGGAGGGAAGG - Intronic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059672225 9:116502665-116502687 CAGAAGGAAGAAAGGAAAGAAGG + Intronic
1060510037 9:124224994-124225016 CAGGAGGAAGAAAGGAAAGAAGG - Intergenic
1061008848 9:127943574-127943596 CAGTGGGAAGTCAGGAAACCTGG + Intronic
1061284332 9:129613590-129613612 CTGTTGGACTGCAGGAAAGAGGG + Exonic
1061633802 9:131892179-131892201 AAGGGGGAAGACAAGAAAGAAGG + Intronic
1062006181 9:134239622-134239644 CAGTGGGAACACAGGCGGGATGG - Intergenic
1062702180 9:137913052-137913074 CAGTGGGGACACAGGAATGAAGG + Intronic
1185492537 X:528790-528812 CAGAGGGAAGGAAGGAAAGAAGG - Intergenic
1186020078 X:5245230-5245252 AAGGGGGGAGACAGGAAAGAAGG - Intergenic
1186240394 X:7559296-7559318 CAGAGGGAAAAAAAGAAAGAAGG - Intergenic
1189634932 X:42997073-42997095 ATGTGGGAAAACAGGAAATAGGG - Intergenic
1189700636 X:43714485-43714507 CAAAGGGAAGGCAGGAAAGATGG + Intronic
1190416718 X:50187422-50187444 AAGTAGAAATATAGGAAAGAGGG - Intergenic
1193266058 X:79471100-79471122 TGGTGGAAATAAAGGAAAGAAGG - Intergenic
1194912339 X:99661817-99661839 GAATGGGAATACAGCAAAGCTGG - Intergenic
1195119559 X:101736617-101736639 CTGTAGGGATCCAGGAAAGATGG + Intergenic
1195199722 X:102536040-102536062 AAATGGGAACAAAGGAAAGAAGG + Intergenic
1195499130 X:105573664-105573686 GAGGGGGAATATAGGAAAGGGGG + Intronic
1195631980 X:107066398-107066420 TAATGGGAGTACAGGAAAAAAGG - Intronic
1197972350 X:132128589-132128611 TATTGGGAACACAGAAAAGAGGG - Intergenic
1198204360 X:134452200-134452222 GAGAGGGAAGAAAGGAAAGAGGG + Intergenic
1198659741 X:138955311-138955333 CGGAGGGAACACAGGAAACATGG - Intronic
1199184313 X:144897416-144897438 CTGTGGGAAAACAGGAATTAGGG - Intergenic
1199226263 X:145378288-145378310 CAGAGGAAATACAGTAATGAGGG + Intergenic
1200096366 X:153665991-153666013 ATGTGGGACTACTGGAAAGATGG - Intergenic
1201369932 Y:13252643-13252665 CTGTGGGTTTACAGGAATGAGGG + Intronic
1201625630 Y:16011858-16011880 GAGTGGGAAGAGAGGAAGGAAGG + Intergenic