ID: 1135643667

View in Genome Browser
Species Human (GRCh38)
Location 16:24142836-24142858
Sequence TGGGATCTTAAGATAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 181}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135643659_1135643667 7 Left 1135643659 16:24142806-24142828 CCCCAGAGATCAAGGGGATCCTC 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1135643667 16:24142836-24142858 TGGGATCTTAAGATAGAGGGAGG 0: 1
1: 0
2: 1
3: 7
4: 181
1135643655_1135643667 22 Left 1135643655 16:24142791-24142813 CCATGCAGGAGATAGCCCCAGAG 0: 1
1: 0
2: 0
3: 10
4: 157
Right 1135643667 16:24142836-24142858 TGGGATCTTAAGATAGAGGGAGG 0: 1
1: 0
2: 1
3: 7
4: 181
1135643660_1135643667 6 Left 1135643660 16:24142807-24142829 CCCAGAGATCAAGGGGATCCTCA 0: 1
1: 0
2: 0
3: 7
4: 132
Right 1135643667 16:24142836-24142858 TGGGATCTTAAGATAGAGGGAGG 0: 1
1: 0
2: 1
3: 7
4: 181
1135643661_1135643667 5 Left 1135643661 16:24142808-24142830 CCAGAGATCAAGGGGATCCTCAA 0: 1
1: 0
2: 1
3: 8
4: 138
Right 1135643667 16:24142836-24142858 TGGGATCTTAAGATAGAGGGAGG 0: 1
1: 0
2: 1
3: 7
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135643667 Original CRISPR TGGGATCTTAAGATAGAGGG AGG Intronic
901692738 1:10984187-10984209 TGGGATCTTTAGAGAGATCGTGG - Intergenic
902373667 1:16020019-16020041 TGTGATCTGAAGGTAGAGGCAGG - Intronic
902544412 1:17179927-17179949 TGGGGACTTAAGGGAGAGGGTGG - Intergenic
906161631 1:43653512-43653534 TGGAATCTTCAGAAAGGGGGAGG + Intronic
908470175 1:64436555-64436577 TGGCATCATAAGAAAGAAGGAGG + Intergenic
910295244 1:85637606-85637628 TGGGCTCTTATGATTGAGTGGGG - Intergenic
911665152 1:100543470-100543492 TGAGATGTTAAAATGGAGGGGGG - Intergenic
912340883 1:108913876-108913898 TGAGATCTTAAAATAGAAAGGGG + Intronic
914427754 1:147594055-147594077 TGAGATCTTAAGGTAGATAGAGG + Intronic
914892468 1:151638643-151638665 TGGGATATTAGTATAGAGGAAGG + Intronic
918035182 1:180863788-180863810 TGGGATCTCAAGATGGACTGGGG + Exonic
918311722 1:183289882-183289904 TGGGAGGTCAAGACAGAGGGTGG + Intronic
918385885 1:184006840-184006862 AGAGATGTTAAGATAGAGGAGGG - Intronic
918522114 1:185426155-185426177 TGGGAGTTTAAGAGAGAAGGAGG - Intergenic
922535246 1:226374948-226374970 TGGGTTCTTCAGACAGTGGGGGG - Intronic
923408494 1:233686170-233686192 TGGGATCTTGACATTGAGTGGGG + Intergenic
924265383 1:242276529-242276551 TTGGAGCTTAAGAGAGAGAGGGG + Intronic
1063437570 10:6046913-6046935 TGGGAACTTAAGATGCAGGCAGG + Intronic
1064392592 10:14954477-14954499 TGGGAACAGAAGAGAGAGGGCGG - Intergenic
1066719441 10:38321947-38321969 TTGGAGCTTAAGAGAGAGAGGGG - Intergenic
1068525722 10:58127334-58127356 TGGGATGTAGAGATAGAGGTGGG - Intergenic
1068551596 10:58413786-58413808 TGGGATCTTTGGATGGAGGAAGG - Intergenic
1068735529 10:60409748-60409770 TGGGATCAGAAGCTAGAGGAGGG - Intronic
1075248834 10:120847814-120847836 TGGGATCTTGACATTGAGCGGGG - Intergenic
1077627183 11:3782961-3782983 TGGGATTTAGAGATAGAAGGCGG - Intronic
1079978839 11:27127417-27127439 TCGTATCTTAAGGCAGAGGGTGG + Exonic
1080139430 11:28898274-28898296 TGGGATGACAAAATAGAGGGAGG + Intergenic
1081303161 11:41478221-41478243 TGGGATCTTATAATTTAGGGTGG - Intergenic
1084410563 11:69003961-69003983 AGGGATCTCAAGACAGAGAGGGG + Intergenic
1087698912 11:101413405-101413427 TTGGAAATTAAGATAGAAGGAGG - Intergenic
1088011148 11:105002331-105002353 TGGGCTCTTGAGAGAGAGGAAGG - Intronic
1088012920 11:105024841-105024863 AGGGATGTTAAGATTTAGGGAGG - Intergenic
1088016094 11:105062020-105062042 AGGGATGTTAAGATTTAGGGAGG - Intronic
1088018605 11:105091143-105091165 AGGGATGTTAAGATTTAGGGAGG - Intronic
1088021159 11:105121342-105121364 AGGGATGTTAAGATTTAGGGAGG - Intergenic
1088984569 11:114894167-114894189 GGGGCTTTTAAGATAGAGGAGGG - Intergenic
1091342103 11:134823858-134823880 GGGGATCATTACATAGAGGGTGG - Intergenic
1091540311 12:1454456-1454478 TGGCATCTGAAGCTGGAGGGTGG + Intronic
1092100775 12:5882234-5882256 TGGGAGCTTGAGTTAGAGGGAGG - Intronic
1093023459 12:14223418-14223440 TGTGTTATTAAGATAGAGGAAGG - Intergenic
1094168983 12:27471453-27471475 TGGGATTTGAACCTAGAGGGTGG - Intronic
1096686638 12:53292484-53292506 AGGGATCATTAGATAGAAGGTGG - Intronic
1096762205 12:53851333-53851355 TTAGATCTTAAGTTGGAGGGAGG - Intergenic
1100360145 12:93870412-93870434 TGGGAACTTAAGGGAGAGGAAGG - Intronic
1101937186 12:109067925-109067947 TGGGTTCTTTAGAAAGAGGCAGG + Intronic
1104071153 12:125346704-125346726 TTGGATCAAAAGATAGAGGAGGG - Intronic
1104925437 12:132311651-132311673 TGGGATCTGAGGGTGGAGGGAGG - Intronic
1106166713 13:27253446-27253468 TGGGTTCTACAGATAGAGTGTGG + Intronic
1107663021 13:42658822-42658844 TGGGATCTTAGGTTAGATGCAGG - Intergenic
1109590228 13:64469889-64469911 TGTGATCTTGAGGTAGAGGAAGG - Intergenic
1109724044 13:66316087-66316109 TGTGTTTTGAAGATAGAGGGAGG - Intronic
1111125910 13:83911020-83911042 TGGGATCTTGACATTGAGCGGGG + Intergenic
1111630571 13:90842414-90842436 TGGGATCTTGACATTGAGTGGGG - Intergenic
1113210712 13:107976750-107976772 TGGGATCTAGGGATATAGGGAGG - Intergenic
1114256927 14:21011097-21011119 TGGGATCCTAACATATAGGCTGG - Intergenic
1116391810 14:44400807-44400829 TGGGAACTTAAGATATTGGCTGG + Intergenic
1117231565 14:53724601-53724623 TGGTAACTTAATATAGAGGGGGG + Intergenic
1117507681 14:56418907-56418929 TGGGGTCAGAAGAAAGAGGGAGG - Intergenic
1119317333 14:73706470-73706492 TGGGATCTTGACATTGAGTGGGG - Intergenic
1119441419 14:74631201-74631223 TGGAATCTCAAGCTAGAGGCTGG + Intergenic
1119694006 14:76698339-76698361 TGGGATCTTAAGGAACAGAGGGG - Intergenic
1119887584 14:78155907-78155929 TGGGATCCTACGAGAGAGGCTGG - Intergenic
1121101855 14:91254819-91254841 TGGGGTCTTAAGATGGGGGCAGG - Intergenic
1121916506 14:97840645-97840667 TGGGAGCCTATGATGGAGGGGGG + Intergenic
1126927747 15:53609426-53609448 TTGTATTTTCAGATAGAGGGGGG + Intronic
1127644360 15:60945171-60945193 TTGGATTTTCAGAGAGAGGGTGG - Intronic
1127923362 15:63512741-63512763 TTGTATCTTAAGAAAGGGGGAGG - Intronic
1128414211 15:67429161-67429183 TAGGATACTAATATAGAGGGTGG + Intronic
1128833096 15:70787075-70787097 GGGGATCTCAAGAGAGTGGGTGG - Intergenic
1130246435 15:82254267-82254289 TGGGATCTAAGGAGAGATGGAGG - Intronic
1130259259 15:82343023-82343045 TAAGATCTTCAGAGAGAGGGAGG + Intronic
1130269417 15:82436142-82436164 TAAGATCTTCAGAGAGAGGGAGG - Intronic
1130282006 15:82526160-82526182 TAAGATCTTCAGAGAGAGGGAGG - Intergenic
1130454189 15:84088692-84088714 TGGGATCTGAGGAGAGATGGAGG + Intergenic
1130473373 15:84242323-84242345 TAAGATCTTCAGAGAGAGGGAGG - Intronic
1130480787 15:84356387-84356409 TAAGATCTTCAGAGAGAGGGAGG - Intergenic
1130490925 15:84431372-84431394 TAAGATCTTCAGAGAGAGGGAGG + Intergenic
1130502509 15:84510171-84510193 TAAGATCTTCAGAGAGAGGGAGG + Intergenic
1130595652 15:85246901-85246923 TAAGATCTTCAGAGAGAGGGAGG - Intergenic
1131441323 15:92461677-92461699 TGGGAGCTGAAGCTGGAGGGTGG + Intronic
1133701053 16:8309401-8309423 TGGGATGTCAAGAGAGAAGGTGG + Intergenic
1134237692 16:12480501-12480523 AGGGATCTTGAGACAAAGGGTGG - Intronic
1135643667 16:24142836-24142858 TGGGATCTTAAGATAGAGGGAGG + Intronic
1135643758 16:24143436-24143458 TAGGATCTTAAGACAGAGGGAGG + Intronic
1138166178 16:54803742-54803764 TGAGATTTTAAGATAGAAGCAGG - Intergenic
1138560691 16:57799329-57799351 TGGGGTTTTAAGATTGAGGTGGG + Intronic
1146119752 17:30181985-30182007 TGGGAGGCTGAGATAGAGGGGGG - Intronic
1147559691 17:41501218-41501240 TGGGTGCTGAAGACAGAGGGAGG + Exonic
1147895988 17:43751709-43751731 TGGGACCTGAAGATACAGGATGG - Intergenic
1155996797 18:32339104-32339126 TGGTATTTATAGATAGAGGGAGG - Intronic
1156077620 18:33300129-33300151 TGGGAGCGAAAGAGAGAGGGAGG - Intronic
1160332247 18:78004892-78004914 TGGGACCTCATGACAGAGGGTGG + Intergenic
1161362435 19:3858294-3858316 TGGGATCTGCAGATAGAGGCAGG + Intronic
1165493737 19:36140328-36140350 TTGGATCATGAGACAGAGGGTGG - Intronic
1165510194 19:36262227-36262249 TGGGATCTTGACATTGAGTGGGG + Intergenic
1165577723 19:36836064-36836086 AGGAAGCTTAAGATAGAAGGGGG - Intronic
1167538111 19:50068352-50068374 TGGGCACCTAAGACAGAGGGAGG - Intergenic
925022360 2:581702-581724 TGGCATCTTACGATGGAGGCCGG - Intergenic
926794590 2:16608435-16608457 TGCGATCTTAAAATAGATGAGGG - Intronic
928467288 2:31533826-31533848 TGTGAGCTTAAGAAAGAGGTGGG - Intronic
930228318 2:48817214-48817236 AGGGGTCTCAAGATGGAGGGAGG + Intergenic
930955227 2:57195932-57195954 TGGGATCTTGACATTGAGCGGGG - Intergenic
931857978 2:66323793-66323815 AGGGAGCTGAAGATACAGGGAGG + Intergenic
934652133 2:96098801-96098823 TGGGATCTTTAGGCAGAAGGTGG - Intergenic
935297015 2:101658529-101658551 TGGCATCTCAAGTTAGTGGGGGG - Intergenic
940879198 2:158929528-158929550 TGGGGTAGGAAGATAGAGGGGGG - Intergenic
941658133 2:168166417-168166439 AGGGATCTGAAGCTAGAGAGAGG + Intronic
943421452 2:187673221-187673243 TGGGATCTTGACATTGAGTGGGG + Intergenic
944137552 2:196415440-196415462 TGGGAGCTTTAGACAGAGGTTGG + Intronic
948170124 2:235894729-235894751 AGAGATCTTAAGATGGAAGGAGG - Intronic
1168836042 20:878107-878129 TGGGGTCTTCAGCTAGTGGGCGG - Intronic
1172430972 20:34891448-34891470 TGAGATGGTAAGAAAGAGGGAGG + Intronic
1172596518 20:36154487-36154509 TGGGAGCCTGAGAGAGAGGGCGG + Intronic
1173737660 20:45373223-45373245 TGAGGTCTTCAGATTGAGGGTGG + Exonic
1175315773 20:58045528-58045550 TGGGCTCTAAAGATACAGAGGGG + Intergenic
1176526482 21:7922877-7922899 TGGAATCTAAAGATAGAGAATGG - Intergenic
1182407162 22:30144927-30144949 TGGGAGCTTGGGAGAGAGGGAGG + Intronic
1184038802 22:41931518-41931540 TGGGGTCTTCAGAGAGAAGGGGG + Intergenic
952020158 3:29009250-29009272 TGGAATTTTAAAATTGAGGGTGG + Intergenic
952183206 3:30941461-30941483 TGGGTTATTAAGGTAGTGGGTGG + Intergenic
952585988 3:34892859-34892881 TGGGAAGATGAGATAGAGGGGGG + Intergenic
960937233 3:122911673-122911695 TGGGGTCTGAGGAGAGAGGGAGG - Intronic
962298041 3:134211801-134211823 TGTGGACTTAAAATAGAGGGTGG - Intronic
963124689 3:141804266-141804288 TGGGATTTCGTGATAGAGGGAGG + Intronic
963305265 3:143644633-143644655 TGGGATCTTTAAACAGAGGCTGG - Intronic
964321489 3:155502230-155502252 TTGGATCTTTAGAAAGAGTGTGG + Intronic
964705577 3:159615325-159615347 TGGGATTTTAAGCAAGAGAGTGG + Intronic
964785997 3:160397416-160397438 TGGGATATCAAGTTAGAGGAAGG - Intronic
970471411 4:16382829-16382851 TGAGATCTTAAGAGGCAGGGAGG - Intergenic
973228738 4:47817809-47817831 TAGGATCATGTGATAGAGGGTGG - Intronic
973309514 4:48693397-48693419 TGGGACCTGCAGAAAGAGGGTGG + Intronic
974247741 4:59342683-59342705 TGTAATCTTAAAATAGAGTGGGG + Intergenic
976125324 4:81828299-81828321 AGGGATGTTAAGATATGGGGGGG + Intronic
977217025 4:94295969-94295991 TGGGATCTTGACATTGAGCGGGG + Intergenic
979583003 4:122382057-122382079 TAGTATCTTAACATAGATGGTGG + Intronic
980407244 4:132368451-132368473 TGCGACCTTAGGATAGAGGCAGG - Intergenic
982096165 4:151925527-151925549 TGGGATCTGAAGATAACAGGAGG - Intergenic
983843344 4:172483726-172483748 TGGTAACTTAAGATACAAGGGGG + Intronic
984035809 4:174666172-174666194 TGGAATTTTAAGATACAGAGAGG - Intronic
988486929 5:31675026-31675048 TGGGATCTGAGGAGAGAGGATGG + Intronic
990538493 5:56748560-56748582 TGGAATCCTAAAATAGAGGTGGG + Intergenic
994532418 5:100986995-100987017 TGGGATCTTGACATTGAGCGGGG + Intergenic
994617837 5:102128319-102128341 TGGACCCCTAAGATAGAGGGAGG - Intergenic
998091756 5:139375120-139375142 TTGGATCTTGAGAGAGAGGGAGG + Intronic
1001660527 5:173388884-173388906 TGGCATCTTAGATTAGAGGGAGG - Intergenic
1003265373 6:4561025-4561047 TGGCATCATCAGAGAGAGGGTGG + Intergenic
1004690937 6:17991568-17991590 TGGGATGTGAAGATTGAGGGAGG + Intergenic
1012961684 6:105628850-105628872 TGGGAGTTTTAGATACAGGGAGG - Intergenic
1015278284 6:131405786-131405808 TGGGATCTTGACATTGAGTGGGG - Intergenic
1016302886 6:142651622-142651644 TAGGAACTTGAGATACAGGGAGG + Intergenic
1017389634 6:153924458-153924480 TGGGATCTTGACATTGAGTGGGG - Intergenic
1018307092 6:162469322-162469344 TGGAATGTTAAGAAAGTGGGGGG + Intronic
1019077488 6:169399612-169399634 TGACAACTTAAGATAGTGGGGGG + Intergenic
1019581467 7:1765647-1765669 TGGGCTCTGAAGATGGAGGAAGG + Intergenic
1021412732 7:20346510-20346532 TGGGATCTCAAGGTAGATAGTGG + Intronic
1021508204 7:21408093-21408115 TGGGATTTGAAGAAAGAAGGAGG + Intergenic
1021977767 7:26026934-26026956 TGGGATCTTGACATTGAGCGGGG + Intergenic
1024207308 7:47174856-47174878 TGGCATCTTAAGAGGGACGGTGG - Intergenic
1026530640 7:71194402-71194424 TGGGATCTTAAGAAAAGGGTAGG + Intronic
1028037189 7:85999506-85999528 AGGGATCTTAAGATCCAGTGGGG + Intergenic
1032489011 7:132309934-132309956 TGGGATGTGAAGGGAGAGGGAGG - Intronic
1035674283 8:1444081-1444103 CTGGAGCTTAAGGTAGAGGGAGG - Intergenic
1038023895 8:23572145-23572167 TGGGATCTAAGGATCCAGGGAGG - Exonic
1039226345 8:35392519-35392541 TTGGCTTTAAAGATAGAGGGAGG - Intronic
1039824382 8:41160702-41160724 TGGGATCTGAAGATAGGGTCTGG + Intergenic
1044345210 8:91096929-91096951 TGGGAACCCAAGATAGAGGTGGG + Intergenic
1045014949 8:97992998-97993020 TGGGATCTTACTATAGAGAGTGG + Intronic
1045273209 8:100679469-100679491 TGGGATCCTAAGATACAAGGAGG - Intergenic
1045346035 8:101294561-101294583 TGGGATCTCAGGAGAGAGTGCGG - Intergenic
1045726760 8:105182961-105182983 TGGGATCAAAAGAGAGAGAGTGG - Intronic
1047002454 8:120586604-120586626 TAGGATCTTGAGATGGAGAGAGG - Intronic
1047908137 8:129494821-129494843 TAGGATCTTGAGATGGAGAGAGG - Intergenic
1049315533 8:141965022-141965044 TGGGAATTTAAGAAAGAGTGGGG + Intergenic
1049777260 8:144412499-144412521 TGGGATCTTAAGTCAAAGGTGGG + Exonic
1050480530 9:6082789-6082811 TGGGATCTGACCAAAGAGGGAGG - Intergenic
1055889481 9:81107580-81107602 AGGAATTTTAAGAAAGAGGGTGG + Intergenic
1056706538 9:88956646-88956668 TTGAACCTTAAGACAGAGGGAGG - Intergenic
1057766922 9:97928934-97928956 TGGGAACTGAAGATAGAAGATGG + Intronic
1058304698 9:103424325-103424347 TTAGTTCTTAAGATAGAGTGTGG - Intergenic
1060517432 9:124274746-124274768 TGGGATCCTGAGAATGAGGGAGG + Intronic
1060974068 9:127754659-127754681 TGGGATCTGAAGACTGAGTGAGG - Intronic
1185971080 X:4664729-4664751 TGAGATCTTAACAGAGAGTGAGG + Intergenic
1188073668 X:25748878-25748900 TGCAATATTAAGATACAGGGAGG + Intergenic
1192615030 X:72611042-72611064 TGGGATCTTAAGGAAGAAAGTGG - Exonic
1194478356 X:94388802-94388824 TGGAGACTTAAGATAGAGGAAGG + Intergenic
1196108623 X:111922428-111922450 TGGCATGTTAGGATGGAGGGAGG - Intronic
1196572626 X:117282124-117282146 TGGGATCTTGACATTGAGTGGGG - Intergenic
1201932209 Y:19362958-19362980 TGGGCTCATAAGAGATAGGGAGG - Intergenic
1202367315 Y:24174226-24174248 TAAGATCTTCAGAGAGAGGGAGG - Intergenic
1202503466 Y:25495897-25495919 TAAGATCTTCAGAGAGAGGGAGG + Intergenic