ID: 1135643772

View in Genome Browser
Species Human (GRCh38)
Location 16:24143519-24143541
Sequence CTCCCTAGCAGGGATGGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 307}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135643762_1135643772 11 Left 1135643762 16:24143485-24143507 CCTGATCCTATACCCAGTGTCAT 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1135643772 16:24143519-24143541 CTCCCTAGCAGGGATGGGAGAGG 0: 1
1: 0
2: 3
3: 25
4: 307
1135643764_1135643772 -1 Left 1135643764 16:24143497-24143519 CCCAGTGTCATCCACAAGCCTGC 0: 1
1: 0
2: 0
3: 10
4: 147
Right 1135643772 16:24143519-24143541 CTCCCTAGCAGGGATGGGAGAGG 0: 1
1: 0
2: 3
3: 25
4: 307
1135643760_1135643772 30 Left 1135643760 16:24143466-24143488 CCTTGCAACAGATGAGTACCCTG 0: 1
1: 0
2: 2
3: 7
4: 205
Right 1135643772 16:24143519-24143541 CTCCCTAGCAGGGATGGGAGAGG 0: 1
1: 0
2: 3
3: 25
4: 307
1135643763_1135643772 5 Left 1135643763 16:24143491-24143513 CCTATACCCAGTGTCATCCACAA 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1135643772 16:24143519-24143541 CTCCCTAGCAGGGATGGGAGAGG 0: 1
1: 0
2: 3
3: 25
4: 307
1135643765_1135643772 -2 Left 1135643765 16:24143498-24143520 CCAGTGTCATCCACAAGCCTGCT 0: 1
1: 0
2: 0
3: 9
4: 165
Right 1135643772 16:24143519-24143541 CTCCCTAGCAGGGATGGGAGAGG 0: 1
1: 0
2: 3
3: 25
4: 307
1135643761_1135643772 12 Left 1135643761 16:24143484-24143506 CCCTGATCCTATACCCAGTGTCA 0: 1
1: 0
2: 0
3: 7
4: 125
Right 1135643772 16:24143519-24143541 CTCCCTAGCAGGGATGGGAGAGG 0: 1
1: 0
2: 3
3: 25
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135643772 Original CRISPR CTCCCTAGCAGGGATGGGAG AGG Intronic
900316503 1:2059848-2059870 CTCCCTAGGAGGGAGGGGCCAGG + Intronic
900407687 1:2499654-2499676 GTACCTAGAAGGGATGGAAGAGG + Exonic
900520319 1:3102233-3102255 CTCCCCAGCGGGGCTGGGAGGGG + Intronic
901530388 1:9849153-9849175 CTCCCTCCCAGGGAAGGGGGTGG + Exonic
901661941 1:10804196-10804218 CACCCTGGCAGGCGTGGGAGGGG - Intergenic
901806256 1:11740523-11740545 TTCCCTAACAGAGATGGCAGAGG + Intronic
902342675 1:15794255-15794277 CTCTCTAGCAGGGTAGGGAGGGG - Intergenic
903502132 1:23806512-23806534 ATCCCTAGCAGGGAGGGGGAGGG - Intronic
903517798 1:23924053-23924075 AACCCTTGCAAGGATGGGAGTGG - Intergenic
904292738 1:29498240-29498262 CTTCCCAGCCTGGATGGGAGAGG + Intergenic
905239827 1:36574337-36574359 CTCCCTGGTTGGGATGAGAGAGG - Intergenic
906145487 1:43557986-43558008 CCTCCTAGGAGGGAGGGGAGGGG - Intronic
906329894 1:44876273-44876295 CTTCCTAGATGGGATGGCAGCGG - Intronic
907304539 1:53506450-53506472 CTCCCTGGCAGCGCTGGGTGGGG + Exonic
908824402 1:68119521-68119543 CTACCTACAAAGGATGGGAGTGG + Intronic
909483309 1:76148523-76148545 CTCTCTTGGAGGGAAGGGAGAGG - Intronic
909814531 1:79975343-79975365 CACAGTAGGAGGGATGGGAGAGG + Intergenic
912797239 1:112700638-112700660 CTCCCCAGCAGGGGAGGGGGTGG - Exonic
914514335 1:148361506-148361528 CACCCTAGTCGGGATGGCAGAGG + Intergenic
915141900 1:153773174-153773196 CTTCCTGGAAGAGATGGGAGGGG - Exonic
915822171 1:159035808-159035830 ATCAGGAGCAGGGATGGGAGGGG + Intronic
917724913 1:177819133-177819155 CTCCCTAGGTGGGTAGGGAGAGG + Intergenic
919797432 1:201329677-201329699 CTCCCCACCAGGGATTGGGGTGG - Intronic
920415172 1:205794807-205794829 ATGCCCTGCAGGGATGGGAGAGG - Intronic
920430999 1:205919061-205919083 GACCAGAGCAGGGATGGGAGAGG + Intronic
920921426 1:210300423-210300445 CTGTCTGGCAGGGATGGCAGTGG + Intergenic
923147829 1:231210195-231210217 CTCCCCAGCAGGAAGGGGTGAGG + Intronic
923268767 1:232336005-232336027 CTCCCCAGCAGGCCTGGGGGTGG + Intergenic
1062768433 10:82205-82227 CAGCCCAGCAGGGAGGGGAGGGG + Intergenic
1062860366 10:805424-805446 GCCCCACGCAGGGATGGGAGGGG + Intergenic
1062964222 10:1594943-1594965 GTCCCCAGCAGAGATGGGGGAGG - Intronic
1063091659 10:2870801-2870823 CTTCTCAGCAGCGATGGGAGAGG + Intergenic
1063602408 10:7494183-7494205 CTCCAAAGCAGTGGTGGGAGGGG - Intergenic
1068625956 10:59247536-59247558 CTACTTAGCAAGGATGGCAGAGG + Exonic
1069430856 10:68332619-68332641 CTCCCTGGAAGGGATGAGGGTGG + Intronic
1069604678 10:69731856-69731878 CACCCTGCCAGGAATGGGAGTGG + Intergenic
1069631261 10:69898266-69898288 CCCCCAAGCAGGGATGGGTGGGG + Intronic
1069994526 10:72334399-72334421 CTCCCTCGCAGGGCTGGCGGAGG - Exonic
1072041492 10:91611177-91611199 CTCCATGGCAGGGGTGGGAAGGG + Intergenic
1072277871 10:93840355-93840377 CTCCCTAGATGGGCTGGGCGCGG + Intergenic
1072733852 10:97866028-97866050 CCCCCTCGCAGGGTTGGGAGAGG - Exonic
1072916339 10:99539455-99539477 CTCCGGAGCAGGGTAGGGAGCGG - Intergenic
1075190148 10:120299749-120299771 AACCATGGCAGGGATGGGAGGGG + Intergenic
1075553798 10:123414105-123414127 CTCCAGAGCAGGGCAGGGAGGGG + Intergenic
1076326771 10:129629848-129629870 CTCACTAGGAGGGATGGGTTGGG - Intronic
1076760929 10:132605407-132605429 ATCCCCAGGAGGGATGGGAAAGG + Intronic
1077504623 11:2924326-2924348 CCCCCTCACAGGGCTGGGAGGGG - Intronic
1078552508 11:12290253-12290275 CCCCCTAGCAGGGGTGGGAGTGG + Intronic
1080563659 11:33487949-33487971 CTGCCTCCCAGGGATGGGAAAGG - Intergenic
1083381233 11:62270249-62270271 CTGCGTAGCAGTGCTGGGAGAGG - Exonic
1083864508 11:65446241-65446263 CTCCCTCTTGGGGATGGGAGGGG - Intergenic
1084547329 11:69820943-69820965 CTCCCTAAGAGGCATGGAAGAGG + Intergenic
1085305448 11:75483071-75483093 ATCCCTGGCAGGAAGGGGAGGGG - Intronic
1087045078 11:93838035-93838057 CTCCCCAGCAGGGATTGGGAAGG - Intronic
1088592506 11:111415651-111415673 CTCCAGAGCAGAGCTGGGAGGGG + Intronic
1089395688 11:118135400-118135422 GCCCCTAGGAGGGATGAGAGAGG - Exonic
1089691443 11:120189162-120189184 CTCCCTTGCAGGGTGTGGAGTGG - Intergenic
1089752110 11:120659379-120659401 CTCCCTGGCCCAGATGGGAGCGG - Intronic
1090235949 11:125147206-125147228 CTGCCTGGCAGGGGAGGGAGGGG - Intergenic
1090752752 11:129761871-129761893 CTTCCTGGCAGCGATGGCAGTGG + Intergenic
1090834626 11:130445214-130445236 CTCCCGAGCAGAACTGGGAGAGG + Intergenic
1092827915 12:12414976-12414998 CTTCCTAGATGGGATGGGGGTGG + Intronic
1093940067 12:25043278-25043300 CTCCCTAGCATGGTGGGGTGGGG + Intronic
1094773338 12:33691669-33691691 TTCCCTCACAGGGATGAGAGTGG + Intergenic
1095952369 12:47788583-47788605 CTCCCTACGAGGGATGGGGCTGG - Intronic
1096365585 12:51026250-51026272 CTCGCTGGCAGGGAGGGGCGCGG - Intronic
1096527123 12:52217000-52217022 TTCCCCAGCAGGGGTGGCAGGGG - Intergenic
1099295169 12:80821246-80821268 GTCCCTAGCTGAGAGGGGAGAGG - Intronic
1102432827 12:112896989-112897011 CTCCATCCCAGGGATGAGAGAGG - Exonic
1103095063 12:118126157-118126179 CCCCCTTCTAGGGATGGGAGCGG - Intronic
1103405245 12:120670406-120670428 CTCCCCAGCAGGGAAGGTAGTGG - Intergenic
1103518786 12:121524201-121524223 TTCCCCAGAAGGGAGGGGAGTGG - Intronic
1104064403 12:125295238-125295260 CTCCGTGGCTGGGCTGGGAGTGG + Intronic
1104749678 12:131230255-131230277 CTCCTGAGCCGGGAGGGGAGAGG + Intergenic
1107413540 13:40179338-40179360 AGCCCTGGCAGGGATGGGTGTGG - Intergenic
1107450132 13:40500812-40500834 CTACCTAGCAGGGATGTAATGGG - Intergenic
1107559607 13:41547470-41547492 GTGCCTAGCTGGGCTGGGAGCGG - Intergenic
1108198066 13:48014933-48014955 CTCCCTCTCTGGGATGGAAGAGG + Intergenic
1112620392 13:101048328-101048350 CATCCTTGCAGGGATAGGAGGGG + Intergenic
1112727111 13:102317702-102317724 CTCCCCAGTAGTGAAGGGAGGGG - Intronic
1113086921 13:106578060-106578082 CCGCATAGCAGAGATGGGAGCGG + Intergenic
1115766173 14:36625624-36625646 CTCCAGAGCAGGGATGTGATAGG + Intergenic
1115902001 14:38162024-38162046 ATCCCCAGCAGGGATAGGAAAGG + Intergenic
1118315169 14:64721703-64721725 ATCTCCAGGAGGGATGGGAGGGG + Intronic
1120530909 14:85630447-85630469 CTCCCTAGTTGGGATAGGATGGG + Exonic
1121824137 14:96996850-96996872 CTTCCCACCAGGGATGGGAAGGG - Intergenic
1121984664 14:98493132-98493154 CTGTAAAGCAGGGATGGGAGTGG - Intergenic
1122611168 14:102984500-102984522 CTCCCTTGCGGGGGTAGGAGCGG - Intronic
1122785575 14:104161914-104161936 CTCCCTGGCAGTGTTGGGTGTGG + Intronic
1124123003 15:26908304-26908326 ATCCTTAGCAAGGATGGAAGAGG - Intronic
1124982928 15:34581873-34581895 CTCCCTGGCTGGGCTGGGACTGG - Intronic
1126458751 15:48893185-48893207 CTTCCTGGCAGGGAGGGGATTGG + Intronic
1126796540 15:52264505-52264527 CTTCCTAGCAGCCATGGCAGAGG - Intronic
1127719224 15:61683346-61683368 CTCTCTAGCAATGATGGGGGAGG + Intergenic
1128666260 15:69540424-69540446 CTCCTTCCCAGGGAGGGGAGGGG - Intergenic
1129018438 15:72490698-72490720 ATGACAAGCAGGGATGGGAGAGG + Intronic
1129054204 15:72807498-72807520 CTTCCTAGATGGGATGGCAGTGG + Intergenic
1129273232 15:74430342-74430364 CTCTCTCTCTGGGATGGGAGGGG - Intronic
1129523450 15:76199877-76199899 CTTCCCAGGAGGGATGTGAGGGG + Intronic
1129831465 15:78673800-78673822 GTCCCTGGCAGGCATGGGAGTGG - Intronic
1129975135 15:79815637-79815659 CTCCCTTTCAGGGCAGGGAGTGG - Intergenic
1130277220 15:82487238-82487260 CTCCCTAATAAGGAAGGGAGAGG - Intergenic
1130469583 15:84214588-84214610 CTCCCTAATAAGGAAGGGAGAGG - Intergenic
1130477072 15:84329152-84329174 CTCCCTAATAAGGAAGGGAGAGG - Intergenic
1130494693 15:84458978-84459000 CTCCCTAATAAGGAAGGGAGAGG + Intergenic
1130591876 15:85219217-85219239 CTCCCTAATAAGGAAGGGAGAGG - Intergenic
1131761451 15:95627195-95627217 CTCCCCAGCTGGGCTGGGAAAGG + Intergenic
1132457303 16:31228-31250 CAGCCCAGCAGGGAGGGGAGGGG + Intergenic
1132688750 16:1172976-1172998 CTGCCTGGGAGGGAGGGGAGGGG + Intronic
1132697544 16:1208684-1208706 CGCCCTAGCAGGGGAGGAAGCGG + Intronic
1132841111 16:1978957-1978979 CTGGCCAGCAGGGATGGGAGGGG - Exonic
1133417188 16:5616045-5616067 CCCCGGAGCAGGGAGGGGAGTGG - Intergenic
1133983877 16:10653238-10653260 CTCCCAGGCAGGGCTGGGCGGGG - Intronic
1135643772 16:24143519-24143541 CTCCCTAGCAGGGATGGGAGAGG + Intronic
1136185769 16:28588088-28588110 TTCCACAGCAGGGATGGGTGTGG - Intronic
1136559285 16:31029377-31029399 CAACCTAGCAGGTGTGGGAGAGG + Intergenic
1138121240 16:54402438-54402460 CTCCCTGGGAGAGATGGCAGAGG + Intergenic
1138534506 16:57652869-57652891 CTCCTTAGGAGGGATGTGCGGGG - Intronic
1139650005 16:68357513-68357535 CTCCCCAGCTGGGAAGGGAGTGG + Exonic
1139820229 16:69715193-69715215 CTCCCCAGGAGGAATGGGAAAGG - Intronic
1140258601 16:73357971-73357993 CTCCCGAGAGGGGATGGGGGAGG - Intergenic
1141026345 16:80552277-80552299 CTCCCAAGTGGTGATGGGAGAGG + Intergenic
1141526521 16:84615311-84615333 CTGCCCCCCAGGGATGGGAGTGG - Intronic
1142129062 16:88424432-88424454 GATCCTGGCAGGGATGGGAGGGG + Intergenic
1143446420 17:7012771-7012793 CTCCCCGGCAAGGATCGGAGAGG + Intronic
1143626290 17:8111989-8112011 CTCCCTGGGAGGGCTGGGAGAGG + Intronic
1144281715 17:13733545-13733567 CTCCATACCTGTGATGGGAGGGG - Intergenic
1144780484 17:17805888-17805910 TTCTGTAGCAGGGCTGGGAGTGG - Intronic
1145050508 17:19656225-19656247 GTCCCTGTGAGGGATGGGAGAGG - Intronic
1146390676 17:32419722-32419744 CTGCATTGGAGGGATGGGAGTGG + Intergenic
1146694465 17:34898112-34898134 CTCCCCACCAGGACTGGGAGAGG + Intergenic
1147716084 17:42509605-42509627 CTACCTGGCAGGGATGGGTGGGG + Intronic
1147986801 17:44311687-44311709 CTCCATTGCAGGGATGGCAGGGG + Intronic
1148559406 17:48597379-48597401 AACCCTACCAGGGCTGGGAGAGG + Intronic
1148669822 17:49402286-49402308 CTCCCTGCCAGGGATGGCAAAGG - Intronic
1149993514 17:61395677-61395699 CCCCTTAGCAGGGATGGGGAGGG + Intergenic
1150709658 17:67519807-67519829 CTACCTAGCAAGGCTGGGAGAGG - Intronic
1151315070 17:73316907-73316929 CTCTCTTGCAGGCATGGGAGTGG - Intergenic
1151702421 17:75750484-75750506 CTCCCATGCGGGGGTGGGAGGGG - Intronic
1151771763 17:76167524-76167546 CTCCCTATCTGGGAAGGAAGTGG + Intronic
1151843467 17:76634378-76634400 CTCCACAGCAGGGAGTGGAGAGG - Intronic
1152179063 17:78806611-78806633 GTCCCTAGCAGGGGTGGGGCGGG - Intronic
1152418089 17:80175888-80175910 CTTCCTGGCAGGGATGAGAGAGG + Intronic
1153535850 18:6100841-6100863 CACCCTAGCAGAGCTGGGAGGGG + Intronic
1153770919 18:8415928-8415950 GCCCCTAGCAGGGAGTGGAGTGG - Intergenic
1158101489 18:53834697-53834719 CTCCTGAACTGGGATGGGAGGGG - Intergenic
1159354212 18:67316236-67316258 ATACCTACCAGGGAAGGGAGAGG + Intergenic
1163251575 19:16129021-16129043 TTGCCTGGCAGGGCTGGGAGCGG - Intronic
1164414117 19:28031852-28031874 CTCCCTGCCTGTGATGGGAGGGG + Intergenic
1164684680 19:30158952-30158974 CTCCCACCCAGGGAGGGGAGAGG - Intergenic
1165835265 19:38751263-38751285 CAGCCTAGCAAGGAGGGGAGAGG - Intronic
1166107228 19:40603338-40603360 ATCCTTAGCTGGGAGGGGAGGGG + Intronic
1166130863 19:40744786-40744808 CTCCCTCGCTGGCCTGGGAGAGG - Intronic
1166381754 19:42358454-42358476 CTCCAAATCAGGGATGGAAGCGG - Intronic
1167333051 19:48868055-48868077 TTCCCTGGCTGGGCTGGGAGGGG - Intronic
1167746168 19:51353081-51353103 CTCCCGAGCAGGGATGAGCAAGG + Intronic
1167863862 19:52308098-52308120 CTCCCTAGCATGGATGGAGATGG + Intronic
1167952376 19:53037720-53037742 CTTACTAGCAGTGAGGGGAGCGG + Intergenic
1168702069 19:58446450-58446472 CTACCTTGGAGGGATGGTAGGGG + Intergenic
1168712984 19:58512296-58512318 GTACCCAGCAGGGATGGGAGGGG - Intronic
1168713518 19:58514577-58514599 CTGCCAGGAAGGGATGGGAGAGG - Intronic
925825518 2:7844814-7844836 CTCCCTAGCTGTGATGGGAGGGG - Intergenic
928096222 2:28406811-28406833 CTCCCTAGCAGGGAGGCTGGGGG - Intronic
928100879 2:28436855-28436877 CTCCCAGGCAGGGATGGGCCAGG + Intergenic
928151816 2:28837805-28837827 CTCCCTGGCAGGGAGGAGAATGG - Intronic
931693225 2:64852837-64852859 ATCCCTGGCAGGGCTGTGAGAGG + Intergenic
932267553 2:70381375-70381397 CTCCCTAGCAGGGCAGGAAGTGG - Intergenic
935447323 2:103170454-103170476 CACCCGAGCAGGGATAGTAGAGG + Intergenic
935630877 2:105211344-105211366 CTTCCTAGATGGGATGGCAGCGG + Intergenic
936095617 2:109528514-109528536 CCCGCTGGAAGGGATGGGAGGGG + Intergenic
936513839 2:113169249-113169271 GTGCCTACCTGGGATGGGAGGGG - Intronic
937036639 2:118787626-118787648 CGCCCTCCCAGGGATGGGATGGG + Intergenic
937083474 2:119156580-119156602 CTCCCTTGCCGGGATGGGGATGG + Exonic
941490114 2:166133217-166133239 CTCGATAGCAGGGAAGGCAGAGG - Intergenic
945098341 2:206240262-206240284 CTCTCTAACAGGGATGTGGGAGG - Intergenic
945761887 2:213924020-213924042 CTGCCTAGCAGTGGTGGGGGTGG + Intronic
946665343 2:222043972-222043994 TTCCCTAACAGGGATTGGGGTGG + Intergenic
1169754341 20:9027243-9027265 CTTCCTGGTAGAGATGGGAGGGG + Intergenic
1169883863 20:10376260-10376282 CTGACTTCCAGGGATGGGAGAGG - Intergenic
1169906278 20:10607945-10607967 TTCCCTTGCAGGAATGGCAGTGG - Intronic
1170066424 20:12315670-12315692 ATCCACAGCAGGGCTGGGAGAGG - Intergenic
1170644973 20:18189896-18189918 CACCCAAGCAGGGAATGGAGTGG - Intergenic
1171243376 20:23588978-23589000 CTCCCTAGCAGACAAGGAAGTGG - Intergenic
1171872242 20:30537830-30537852 CTACCTACCCGGGATGGGATGGG + Intergenic
1172092782 20:32445870-32445892 CCCCCAAGGAGGGATGGGGGGGG - Exonic
1172119887 20:32592026-32592048 CACCCAGGCAGGGAGGGGAGGGG + Intronic
1173499996 20:43546161-43546183 CTTCCTGGCAGGGGTGGTAGAGG + Intronic
1175273109 20:57748785-57748807 CTGTCTGGCAGGGATGGGGGTGG - Intergenic
1177276584 21:18919982-18920004 CTGGCTGGAAGGGATGGGAGTGG - Intergenic
1178074577 21:29003035-29003057 GTCCCTCGCAGGGATGGCAAAGG + Intergenic
1178499982 21:33117731-33117753 CTCCCTGGCAGGGAGGAGAAAGG - Intergenic
1178663029 21:34522685-34522707 ATACCTTGCTGGGATGGGAGAGG - Intronic
1178722639 21:35023523-35023545 CTCCCTAGCCGGGAGGCCAGAGG + Intronic
1179577772 21:42318407-42318429 CTCCCAAGGAGGAAAGGGAGAGG - Intergenic
1180246783 21:46553825-46553847 CTCACTAGCAGTGAAGGGACAGG - Intronic
1181449918 22:23012871-23012893 CTCCTAAGCAGGGAGGGGAGGGG + Intergenic
1181473352 22:23154109-23154131 CTACCCAGCTGGGGTGGGAGAGG - Intronic
1181521806 22:23452556-23452578 CTCCCGAGCAGGGCTGTGTGTGG - Intergenic
1181637831 22:24182425-24182447 CTCCCCAGAAAGGAGGGGAGCGG + Intronic
1183978063 22:41524607-41524629 CGGCCCTGCAGGGATGGGAGAGG + Intronic
1184403967 22:44289575-44289597 CTCCCTGTCAGGGAAGGGAGGGG + Intronic
1184559623 22:45254591-45254613 CTCCCTACCAGAGATGAAAGTGG + Intergenic
1184786226 22:46673273-46673295 CTCACTGTCAGGGATGGCAGGGG - Intronic
1184790166 22:46695280-46695302 CTTCATAGCAGTGGTGGGAGAGG + Exonic
1185151813 22:49168032-49168054 CTCCTTAGCAGGGCAGTGAGGGG - Intergenic
1185285520 22:49998106-49998128 CTGCTCAGCAGGGATGGGGGTGG - Intronic
950101794 3:10361682-10361704 TTGCCTGGCAGGGAAGGGAGAGG - Intronic
950140392 3:10611247-10611269 CTCCCTGGCAGGGGTGGGCAAGG + Intronic
952610796 3:35206488-35206510 CGCCCTGGTAGGAATGGGAGTGG - Intergenic
952995958 3:38882579-38882601 CTCCCTAGCAGGGAGGAGAAAGG + Intronic
953715429 3:45313261-45313283 CTCCCAGGCAGGCAGGGGAGTGG - Intergenic
953720958 3:45354846-45354868 CTCCCTAACATGGCTGGGGGAGG - Intergenic
954309832 3:49757429-49757451 CTGCCTAGCAGAGATAGTAGAGG - Intronic
954461256 3:50628253-50628275 CTCCCTAGCAGGGGTGGCCAGGG - Intronic
954629233 3:52039302-52039324 CTTCCTAGCAGGGAGAGGCGTGG - Intergenic
956379627 3:68651855-68651877 CTCCTTGGCAGGGTCGGGAGGGG + Intergenic
956402663 3:68896752-68896774 ATACCCAGCAGGGATGTGAGAGG - Intronic
956895750 3:73658118-73658140 CTGCCTATCGGGGATGGGGGAGG - Intergenic
958823466 3:99002610-99002632 CACCCTAGCAGAGGTGGGTGAGG + Intergenic
961738440 3:129016836-129016858 CTCCCAAGCAGTGCTGTGAGTGG + Intronic
962897446 3:139729032-139729054 CTTATTAGCAGGGCTGGGAGAGG + Intergenic
963057812 3:141201724-141201746 CTCCCCAGAAGGGATGTCAGAGG + Intergenic
963108139 3:141664142-141664164 CCCTCTGGAAGGGATGGGAGGGG - Intergenic
963127403 3:141828009-141828031 CTCACTAGGAGGGAGGAGAGGGG + Intergenic
964392691 3:156213926-156213948 CTGTCTACCAGGGAGGGGAGAGG + Intronic
965516761 3:169629964-169629986 CTCCGCAGAAGGGCTGGGAGAGG - Intronic
966794266 3:183698404-183698426 CTCCCTGGGATGGAGGGGAGGGG + Intronic
967947807 3:194818051-194818073 CTCCTTGGCAGGGTAGGGAGAGG - Intergenic
968814262 4:2813565-2813587 GGCCCTGGCAGGGCTGGGAGTGG + Intronic
968925984 4:3548741-3548763 CTGCCCAGCAGGGATGTGGGTGG + Intergenic
969518814 4:7663993-7664015 CACCTAAGCAGGGATGGGGGCGG - Intronic
970552327 4:17194726-17194748 CTCCTTGCCAGTGATGGGAGAGG - Intergenic
972324754 4:38004992-38005014 CTCCCTGGCAGGGAGGGGGAGGG + Intronic
972883497 4:43455676-43455698 CTCCCTAGCCACAATGGGAGTGG + Intergenic
974184474 4:58429052-58429074 CTCCCTTTCAGGGATGCCAGTGG + Intergenic
975874322 4:78818003-78818025 CTCCCTAAAATGGATGGGGGAGG + Intronic
979189130 4:117834867-117834889 CACCCGAGCTGGGAGGGGAGAGG + Intergenic
983006781 4:162493578-162493600 CTGCCTAGCAGAGCTGTGAGAGG + Intergenic
984587330 4:181579038-181579060 AGCCCAGGCAGGGATGGGAGAGG - Intergenic
984814163 4:183821717-183821739 CTGCCTAGAGGGGAGGGGAGGGG + Intergenic
986407726 5:7443109-7443131 TTCCACAGCAGGGATGGGAATGG + Intronic
986804966 5:11300808-11300830 CACCCTTGAGGGGATGGGAGTGG - Intronic
987065105 5:14281984-14282006 CTCCCTAACAGGGCTGGCTGTGG + Intronic
987391009 5:17375467-17375489 CTGCCTCGTGGGGATGGGAGGGG + Intergenic
988976842 5:36524322-36524344 CTCCCTGGCTGGGATGGATGTGG + Intergenic
991075520 5:62532196-62532218 TTCCCTAAGAGTGATGGGAGAGG + Intronic
997594240 5:135095602-135095624 CTCCCAATGAGGGAGGGGAGGGG - Intronic
997599148 5:135127563-135127585 GTGCCTAGCAGGGATGGGAAGGG + Intronic
998160231 5:139809026-139809048 CTCACCAGCGGGAATGGGAGGGG + Intronic
998568830 5:143239232-143239254 AACCCTAGCAGGAAAGGGAGGGG - Intergenic
999444875 5:151631318-151631340 CTCCCTAACAGAGATGGAATGGG + Intergenic
999462925 5:151772221-151772243 CGCCCCAGCCGGGACGGGAGCGG - Intronic
1000302140 5:159965776-159965798 CGCCCCAGCAGGGATGGGCAAGG + Intronic
1000958572 5:167571949-167571971 CTGGCTAGCAGGGAGGGAAGTGG - Intronic
1001518153 5:172371793-172371815 TTCCCTAGAAGGAATGGGTGTGG - Intronic
1001734701 5:173988907-173988929 CCACCTCGCAGGGATGGGGGTGG - Intronic
1002488087 5:179553267-179553289 CTTCCCTGCAGGGATGGGACAGG - Intronic
1002580637 5:180207979-180208001 CTCACTAGCTGGTGTGGGAGGGG - Intronic
1002951881 6:1821420-1821442 CTGCCAAGCTGGGATGGGCGAGG + Intronic
1003047276 6:2745090-2745112 CTCAGGAGCAGGGATGGGGGTGG + Intronic
1003303751 6:4908178-4908200 TTCCCTTGCAGAGATGGGTGTGG + Intronic
1006502367 6:34466747-34466769 CCCCACAGCTGGGATGGGAGCGG + Intronic
1007698139 6:43746886-43746908 CTCCCTTGGGGGGCTGGGAGCGG + Intergenic
1008185454 6:48384646-48384668 CTCGATAGGAAGGATGGGAGAGG - Intergenic
1014568632 6:122981714-122981736 CTCCCTAACAGGTTTGAGAGGGG - Intergenic
1015886231 6:137921596-137921618 TTCCCTAGCAGGCATGGGCTTGG - Intergenic
1016272087 6:142301602-142301624 CTCCCCAGCTGGGAGGGGACAGG - Intergenic
1016826071 6:148389775-148389797 CTGCCTAGCAGGGCTAAGAGAGG - Intronic
1016965764 6:149717755-149717777 CTCGCCAGCGGGGATGGGCGTGG + Intronic
1017074692 6:150606896-150606918 TTCCCTAGCAGAGTTGGGAGAGG - Intronic
1017754367 6:157517243-157517265 CTGCTTCCCAGGGATGGGAGTGG + Intronic
1017978204 6:159376058-159376080 CTCCCCAGCAGGGATGGTGATGG - Intergenic
1019260970 7:81834-81856 ATCCCTAGAAGGGAAGGGATGGG - Intergenic
1019353644 7:567859-567881 CTTTCTAGAAGGGCTGGGAGAGG + Intronic
1019557159 7:1638299-1638321 CTCCCTCTCAGTTATGGGAGCGG + Intergenic
1020100046 7:5389378-5389400 CGCCCAGGCAGGGGTGGGAGGGG - Intronic
1020629223 7:10620525-10620547 CTCCTTAGCTGGGAGAGGAGAGG - Intergenic
1021910863 7:25385002-25385024 CTCCCCTGCAGGGCTGGGACTGG + Intergenic
1023402856 7:39802943-39802965 CTCTCTAGCAGGGTAGGGAGGGG - Intergenic
1023864844 7:44233752-44233774 CTCCCTGCCGGGGAGGGGAGGGG - Intronic
1024305363 7:47924334-47924356 TTCCTTGGCAGGGATGTGAGGGG + Intronic
1024343128 7:48287065-48287087 CTGCGCAGCAGGGAGGGGAGGGG + Intronic
1029135362 7:98366671-98366693 CTTCCAGGCAGGCATGGGAGAGG - Intronic
1031049644 7:116932079-116932101 CTCATTAGCAAGGATGTGAGGGG - Intergenic
1032325439 7:130924194-130924216 CTCCCCAGCAGGGCAGGGATGGG + Intergenic
1032511370 7:132475231-132475253 ATCCCAAGGAGGGCTGGGAGGGG - Intronic
1033820736 7:145131346-145131368 CTGCCTCGCTGGAATGGGAGTGG - Intergenic
1034337487 7:150332882-150332904 CTCCAGAGCAGGGATAGGAGGGG + Intronic
1037319592 8:17630642-17630664 TGCCCCAGCAGGGAGGGGAGGGG - Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1037986749 8:23295049-23295071 CTCCCTAGCAGGCCTAGGGGGGG + Intronic
1043336289 8:79180583-79180605 CTCCATACCTGTGATGGGAGTGG + Intergenic
1047330162 8:123879820-123879842 CTCCCTGGCAGAGCTGGGAGTGG - Intronic
1048078380 8:131098063-131098085 ATAACTAGGAGGGATGGGAGAGG + Intergenic
1048165767 8:132059920-132059942 CTCAGTAGCAGGGCTGGCAGAGG - Intronic
1049472378 8:142782265-142782287 CTGCCTTTCAGGGGTGGGAGTGG + Intergenic
1051712375 9:19945284-19945306 CTCCTTAGCAGGGAAGGGGAGGG + Intergenic
1052894312 9:33733130-33733152 CTTCCTGGCAGTGATGGCAGTGG + Intergenic
1053202627 9:36163307-36163329 CTGCCTAGCAGAGGTGGGGGAGG - Exonic
1053342489 9:37349596-37349618 TACTCTAGCAGGGAGGGGAGGGG - Intronic
1053800866 9:41763919-41763941 CTGCCCAGCAGGGATGAGGGTGG + Intergenic
1054144330 9:61550920-61550942 CTGCCCAGCAGGGATGTGGGTGG - Intergenic
1054189297 9:61976069-61976091 CTGCCCAGCAGGGATGAGGGTGG + Intergenic
1054464018 9:65481879-65481901 CTGCCCAGCAGGGATGAGGGTGG - Intergenic
1054649220 9:67612542-67612564 CTGCCCAGCAGGGATGAGGGTGG - Intergenic
1054790391 9:69251201-69251223 CTCTTGAGGAGGGATGGGAGTGG - Exonic
1055103763 9:72492039-72492061 CTCAAAAGCAGGGTTGGGAGAGG + Intergenic
1057278912 9:93696806-93696828 CTCCCAAGCAGGGATGTTGGAGG - Intergenic
1057476266 9:95405572-95405594 TTCCCTAGAAGTGATGAGAGTGG + Intergenic
1058037922 9:100273332-100273354 CTCCCTCCCATGGGTGGGAGTGG - Intronic
1058149869 9:101452494-101452516 CTCCCGACCTGTGATGGGAGGGG - Intergenic
1058612312 9:106789841-106789863 CAGCCTAGCAAGGAGGGGAGAGG - Intergenic
1059403112 9:114082854-114082876 CTCTCTAGCAGGGTAGGGATGGG - Intergenic
1059405028 9:114094124-114094146 CAGCCTAGCAGTGATGGGTGGGG + Intronic
1060031261 9:120216892-120216914 GGCCCAAGCAGGGATGGCAGTGG - Intergenic
1060141272 9:121212443-121212465 CTCCCTGGCAGGGAGAGAAGAGG - Intronic
1060697772 9:125723939-125723961 CTCCCTGGTGGGGATGAGAGTGG + Intergenic
1061662801 9:132141505-132141527 CTACCTGGCTGGGGTGGGAGGGG - Intergenic
1061677690 9:132227699-132227721 CTCCCTGGCATGGCTGGGCGAGG - Intronic
1062736843 9:138142106-138142128 CAGCCCAGCAGGGAGGGGAGGGG - Intergenic
1187188857 X:17013814-17013836 CCCTGTAGCAGGGCTGGGAGAGG - Intronic
1190230772 X:48580266-48580288 CTGCCTAGGTGGGATAGGAGGGG - Intergenic
1191835308 X:65457010-65457032 CTTCCTAGATGGGATGGCAGCGG - Intronic
1192234373 X:69286376-69286398 CACCCTTGCAAGGGTGGGAGAGG - Intergenic
1192805399 X:74504391-74504413 CTCTGTAGTAGGGGTGGGAGTGG - Intronic
1193362134 X:80590917-80590939 CTTCCTAGATGGGATGGCAGTGG - Intergenic
1195163820 X:102197843-102197865 CTTTATTGCAGGGATGGGAGAGG + Intergenic
1195195041 X:102489252-102489274 CTTTATTGCAGGGATGGGAGAGG - Intergenic
1195745623 X:108114617-108114639 CTCCACAGCAGGGATGTGAAGGG + Intronic
1197958528 X:131978888-131978910 CCCACTAGCATGGGTGGGAGGGG + Intergenic
1198260364 X:134960228-134960250 CTTCCTAGATGGGATGGCAGTGG - Intergenic
1198311230 X:135426760-135426782 CTCTGTAGCAGGGATGGGAGGGG - Intergenic
1199978382 X:152907507-152907529 GTCCCTGGCAGGGCTGGGCGGGG - Intergenic
1200141125 X:153903650-153903672 CACCCTAACAGGGCCGGGAGGGG + Intronic
1200179936 X:154144014-154144036 CTTCCTGGCGGGGATGGGTGGGG + Intergenic
1200399055 X:156008157-156008179 CAGCCCAGCAGGGAGGGGAGGGG - Intronic