ID: 1135644032

View in Genome Browser
Species Human (GRCh38)
Location 16:24145762-24145784
Sequence CCGGGCCAGTTGAAAACCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 35}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135644021_1135644032 27 Left 1135644021 16:24145712-24145734 CCCTTGCACACTAGTGTGGCCAT 0: 1
1: 0
2: 1
3: 27
4: 479
Right 1135644032 16:24145762-24145784 CCGGGCCAGTTGAAAACCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 35
1135644027_1135644032 -6 Left 1135644027 16:24145745-24145767 CCCTCAGGACAAAGCTCCCGGGC 0: 1
1: 0
2: 2
3: 9
4: 93
Right 1135644032 16:24145762-24145784 CCGGGCCAGTTGAAAACCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 35
1135644022_1135644032 26 Left 1135644022 16:24145713-24145735 CCTTGCACACTAGTGTGGCCATT 0: 1
1: 0
2: 1
3: 9
4: 127
Right 1135644032 16:24145762-24145784 CCGGGCCAGTTGAAAACCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 35
1135644028_1135644032 -7 Left 1135644028 16:24145746-24145768 CCTCAGGACAAAGCTCCCGGGCC 0: 1
1: 0
2: 4
3: 8
4: 154
Right 1135644032 16:24145762-24145784 CCGGGCCAGTTGAAAACCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 35
1135644024_1135644032 8 Left 1135644024 16:24145731-24145753 CCATTTGCACTGCTCCCTCAGGA 0: 1
1: 0
2: 0
3: 30
4: 337
Right 1135644032 16:24145762-24145784 CCGGGCCAGTTGAAAACCGGAGG 0: 1
1: 0
2: 0
3: 0
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135644032 Original CRISPR CCGGGCCAGTTGAAAACCGG AGG Intronic
907815551 1:57915353-57915375 CTAGGCCAGTTGAAAACCCCTGG + Intronic
917178114 1:172261842-172261864 CCAGGCCAGTTGACCACCTGTGG - Intronic
919754643 1:201059150-201059172 CCGGGCCAGATGAGAAGCTGGGG - Intronic
1067944725 10:50682635-50682657 CCTGGCCAGCTGAAACCTGGAGG + Intergenic
1070866225 10:79709506-79709528 CCTGGCCAGCTGAAACCTGGAGG + Intronic
1070880019 10:79847637-79847659 CCTGGCCAGCTGAAACCTGGAGG + Intronic
1071633131 10:87231727-87231749 CCTGGCCAGCTGAAACCTGGAGG + Intronic
1071646580 10:87363945-87363967 CCTGGCCAGCTGAAACCTGGAGG + Intronic
1073462301 10:103672932-103672954 CCAGGCCAGGAGAAAACCAGGGG + Intronic
1075261259 10:120965455-120965477 CAGGGCCAGTTGGAAACCCCAGG + Intergenic
1075262081 10:120971858-120971880 CCGGGGGAGTTGAGAACAGGTGG - Intergenic
1083262261 11:61529599-61529621 CCGTGCCAGGTGAAAAGCGTCGG + Intronic
1101098184 12:101365472-101365494 CCGGGCCAGTTTCAAACTCGTGG - Exonic
1133542969 16:6773969-6773991 CAGGTTCAGTTGAAAACGGGAGG - Intronic
1135644032 16:24145762-24145784 CCGGGCCAGTTGAAAACCGGAGG + Intronic
1136171464 16:28492202-28492224 CCGCTCCAGTTTAAAACCTGCGG - Exonic
1138385269 16:56632272-56632294 CAGGCCCAGTTGAAAACGGCGGG + Exonic
1144281252 17:13729248-13729270 CCAGGCCAGTTAAAAACAAGGGG - Intergenic
1144778140 17:17795182-17795204 CCTGGCCAGAGGAAAACCTGGGG + Exonic
929507016 2:42536165-42536187 CCGGGCCATATGAAAATCGAGGG + Intronic
937058947 2:118967333-118967355 CCAGGCCAGATGACAACTGGTGG - Intronic
1176300418 21:5096488-5096510 CCGTGCCAGTTGAACTCCTGAGG + Intergenic
1177240269 21:18446650-18446672 CCGTGCCTGTTGAAAATCAGTGG - Intronic
1179856626 21:44165493-44165515 CCGTGCCAGTTGAACTCCTGAGG - Intergenic
1181269697 22:21652040-21652062 CCGGGCCAATCGGAACCCGGAGG + Intergenic
1184892804 22:47389892-47389914 ACGGGCCAGCTGTAAACCTGGGG - Intergenic
951577386 3:24127609-24127631 CGGGGCCAGCTGAAAAATGGGGG - Exonic
963843244 3:150129545-150129567 CTGGGCCAGATGAAAACCTTTGG + Intergenic
967920375 3:194609785-194609807 CAGGGCCAGTTGGAAGCCCGAGG - Intronic
983077603 4:163344286-163344308 CCGGGTGAGTTGGGAACCGGAGG - Exonic
1002458195 5:179358010-179358032 CCTGGCCAGTGGAACACAGGTGG - Intergenic
1006223229 6:32513262-32513284 GGGGGCCAGTTGCAAACTGGAGG - Intergenic
1017818241 6:158030414-158030436 CAAGGCCAGATGAAAACCTGTGG - Intronic
1039960269 8:42241274-42241296 AAGGGCCAGTTGAAAATCTGTGG + Intergenic
1061490463 9:130941166-130941188 CCTGGGCAGGTGCAAACCGGAGG + Intergenic
1190160490 X:48028421-48028443 CCCAGCCAGTTGAAAGCCTGAGG - Intronic