ID: 1135645954

View in Genome Browser
Species Human (GRCh38)
Location 16:24162278-24162300
Sequence TGGGCTGGCAGCAGTACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 281}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135645950_1135645954 -1 Left 1135645950 16:24162256-24162278 CCTGGTAACTCGGGCTCAGCTCT 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1135645954 16:24162278-24162300 TGGGCTGGCAGCAGTACCCAAGG 0: 1
1: 0
2: 2
3: 22
4: 281
1135645942_1135645954 20 Left 1135645942 16:24162235-24162257 CCCCGAGAATGTCCCAGGGGTCC 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1135645954 16:24162278-24162300 TGGGCTGGCAGCAGTACCCAAGG 0: 1
1: 0
2: 2
3: 22
4: 281
1135645944_1135645954 18 Left 1135645944 16:24162237-24162259 CCGAGAATGTCCCAGGGGTCCTG 0: 1
1: 0
2: 2
3: 21
4: 204
Right 1135645954 16:24162278-24162300 TGGGCTGGCAGCAGTACCCAAGG 0: 1
1: 0
2: 2
3: 22
4: 281
1135645947_1135645954 8 Left 1135645947 16:24162247-24162269 CCCAGGGGTCCTGGTAACTCGGG 0: 1
1: 0
2: 0
3: 7
4: 62
Right 1135645954 16:24162278-24162300 TGGGCTGGCAGCAGTACCCAAGG 0: 1
1: 0
2: 2
3: 22
4: 281
1135645943_1135645954 19 Left 1135645943 16:24162236-24162258 CCCGAGAATGTCCCAGGGGTCCT 0: 1
1: 0
2: 0
3: 19
4: 145
Right 1135645954 16:24162278-24162300 TGGGCTGGCAGCAGTACCCAAGG 0: 1
1: 0
2: 2
3: 22
4: 281
1135645949_1135645954 7 Left 1135645949 16:24162248-24162270 CCAGGGGTCCTGGTAACTCGGGC 0: 1
1: 0
2: 0
3: 7
4: 133
Right 1135645954 16:24162278-24162300 TGGGCTGGCAGCAGTACCCAAGG 0: 1
1: 0
2: 2
3: 22
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135645954 Original CRISPR TGGGCTGGCAGCAGTACCCA AGG Intronic
900230235 1:1553211-1553233 TCGGCTGGCAGCAGTGCTGAGGG - Intronic
900308112 1:2020711-2020733 TGGGCTGGCAGCTGTCCCCATGG - Intronic
900799578 1:4728927-4728949 TGGTCTGGCAGCTGGGCCCAGGG - Intronic
901207055 1:7503410-7503432 TGGGCTGGCTGTATTACCCCAGG - Intronic
901501487 1:9655167-9655189 TGGTCTAGAAGCAGTACCCCGGG + Intronic
902548933 1:17208005-17208027 TGGGCTGGCAGCAGGAGGAAGGG + Intronic
902988635 1:20171047-20171069 TGGGCTGGCTGCACTCGCCAGGG - Intronic
903472730 1:23598660-23598682 TGGGCAGGAAGCAGTAACAATGG - Intronic
904935864 1:34129110-34129132 GGGGGTGGCAGCGGGACCCATGG - Intronic
906345957 1:45014555-45014577 AGGCCTGGCACCAGTGCCCATGG + Exonic
906693661 1:47809801-47809823 TGGGCTGGGAGCAGGGACCAGGG + Intronic
911470850 1:98316423-98316445 GGAGTTGGCAGCAGTACACAGGG - Intergenic
911781613 1:101886570-101886592 TGGAATGGCTGCAGTAGCCAGGG - Intronic
914937314 1:151992876-151992898 TGGACAGGCAGCAGTGTCCACGG + Intronic
915693595 1:157716127-157716149 TGGACTGACAGAATTACCCATGG - Intergenic
916150859 1:161788166-161788188 TGGGCTGGCAGCAGTGCCTGAGG + Intronic
916678813 1:167086266-167086288 TGGAATGGCAACAGGACCCAGGG + Intronic
916806361 1:168265209-168265231 TGGACTGGCTGCTGTACCTAGGG - Intergenic
917933374 1:179839662-179839684 TGGGATAGCAGCAATTCCCAGGG + Intergenic
919743663 1:200995300-200995322 GGGGCTGCCACCAGTGCCCAGGG + Intronic
919881937 1:201906598-201906620 AGGGCAGGCAGCAGGGCCCAGGG + Intronic
920815426 1:209327067-209327089 TTGGCAGGCAGAAGAACCCATGG + Intergenic
921048055 1:211491279-211491301 TGGGGATGCAGCAGCACCCAGGG - Intronic
922340224 1:224648991-224649013 TGGGCTGGCTGAAGAAGCCAGGG - Intronic
923096549 1:230779547-230779569 AGGGCTGGCAGCAGTATCCAGGG + Intronic
923340992 1:233006939-233006961 AGAGCTTGCTGCAGTACCCAAGG - Intronic
924778385 1:247126745-247126767 TGGGCGGGCAGCGGCACCCCGGG + Intronic
924783273 1:247171675-247171697 TGGGCGGGCAGCGGCACCCCGGG - Intronic
1063785625 10:9379866-9379888 TGGGCGAGCAGCAGTCTCCATGG - Intergenic
1065047762 10:21759224-21759246 TGGCGTTGCAGCAGTACCCAAGG - Exonic
1067429627 10:46234492-46234514 TAGGCTGGAGGCAGCACCCAGGG - Intergenic
1067550235 10:47229259-47229281 TGGCCTGACAGCAGAACTCAGGG + Intergenic
1067685404 10:48463803-48463825 TGGGCTTGCAGCAGAGGCCAAGG + Intronic
1067705838 10:48605885-48605907 AGGGCGGGCACCAGAACCCAGGG + Intronic
1070313945 10:75293914-75293936 TGGGCTGGCAGTAAAAGCCAGGG - Intergenic
1072922966 10:99592093-99592115 GGGGCTGGCAGCAGCCCCAAGGG - Intergenic
1073057211 10:100710360-100710382 TGGGCTGGCAGCAGGAGCGCGGG - Intergenic
1075948924 10:126460725-126460747 TTGGCTGGCTCCTGTACCCAGGG - Intronic
1077417610 11:2432145-2432167 TCCCCTGGCAGCAGTGCCCATGG - Intergenic
1078012383 11:7582574-7582596 TGGACTGGCAGCAGCACTTAGGG + Intronic
1079512262 11:21225131-21225153 TGGGATGGCAGCAGGACCCCAGG + Intronic
1084012521 11:66360560-66360582 TGGGCAGGCAGCAGTAGCTGGGG + Intronic
1084778834 11:71395778-71395800 TGGCCTGGCAGCAGGACCCCTGG + Intergenic
1084958411 11:72703524-72703546 TGGGCTGGGAGCAGGACGCCTGG + Intronic
1086445388 11:86865711-86865733 TGAGCTGGCAGCACTGTCCACGG - Intronic
1089762166 11:120735824-120735846 TGGTCTGGCAGAACTCCCCATGG - Intronic
1089989866 11:122849328-122849350 TGAGCTGGGATCTGTACCCAGGG - Intronic
1090448011 11:126780695-126780717 TAGGCTGGCAGGTGTATCCAGGG + Intronic
1090880503 11:130828147-130828169 GGGGCTGGCAGAAGCCCCCAGGG - Intergenic
1091178073 11:133579522-133579544 AGAGCTGGCAGCCGTCCCCAGGG + Intergenic
1091735989 12:2922352-2922374 TGGCTTGGAAGCAGTATCCACGG - Exonic
1091820889 12:3474437-3474459 TGGGCTGGGAGCAGAAACCATGG - Intronic
1092196154 12:6550885-6550907 TGGGCAGACAGGGGTACCCAGGG + Intronic
1095633592 12:44405601-44405623 TGGGCAGGCAGCAGGAGGCATGG + Intergenic
1096343911 12:50828555-50828577 TGGCCTGGCAGAACCACCCATGG - Intergenic
1096559879 12:52428496-52428518 TGGGCTGTCAGCAGGACTCATGG - Intronic
1097714778 12:62954728-62954750 TGGCCTGGCAGAAGCCCCCATGG - Intergenic
1098230657 12:68369242-68369264 GGGGCTGGCAGCACGATCCAGGG - Intergenic
1098489300 12:71056587-71056609 TGGGCTGCCAGCAATACCATAGG - Intronic
1098527106 12:71498929-71498951 AAGGCTCGCAGCAGTTCCCATGG + Intronic
1100171243 12:91977552-91977574 TGTGCTAGAAGCAGAACCCAAGG + Intergenic
1102040990 12:109800645-109800667 TGGGCTGGAAGAAGCGCCCACGG + Exonic
1102304996 12:111798173-111798195 TGGGCTGGATGAAGTAACCACGG - Exonic
1102635027 12:114315881-114315903 AGGGCTGGGATCAGAACCCAGGG - Intergenic
1102895462 12:116594912-116594934 TGGGCTGTCCGCAGTCACCATGG + Intergenic
1104010314 12:124925575-124925597 TGGTGTGGCAGAAGCACCCATGG - Intergenic
1104371558 12:128228330-128228352 TGGGGTGGCAGGAGGACCCCTGG + Intergenic
1104744737 12:131203782-131203804 TGTGCTGACAGCAGCAACCATGG + Intergenic
1104749578 12:131229833-131229855 TCTGCTGGGAGCACTACCCACGG - Intergenic
1106256056 13:28022891-28022913 TGGGCTGGCAGCAGTCCTGCAGG - Intronic
1110329280 13:74252248-74252270 TTGGCTGGCAGCCCTACCTAAGG - Intergenic
1112168845 13:96948527-96948549 TGGCTTGGAAGCAGTATCCAAGG + Intergenic
1112493331 13:99885994-99886016 TGGCCTCACAGCAGTTCCCAGGG - Intronic
1112946469 13:104933695-104933717 TAGTCTGGAAGCAGTAGCCAAGG - Intergenic
1113760105 13:112840879-112840901 TGGGCAGGCAGTGGTCCCCAGGG - Intronic
1114225428 14:20733516-20733538 AGGGCAGGCAACAGTGCCCATGG + Intronic
1116905314 14:50397633-50397655 TGTCCTGGAAGCAGTACCCGAGG + Intronic
1117273558 14:54169625-54169647 AGGGCTGGCAGCAGTTGCCGAGG + Intergenic
1118000176 14:61515620-61515642 TGGTCTGGCACCAGTACCTTGGG - Intronic
1118908594 14:70042565-70042587 TGGAATGGCAGCAGTAAGCATGG - Intergenic
1120148407 14:81004699-81004721 TGAGCTGGCAGCAATGACCATGG - Intronic
1120697487 14:87660034-87660056 TGGCCTGGCAGTACTCCCCATGG + Intergenic
1122843376 14:104477372-104477394 TGGGCAAGCACCAGCACCCACGG + Intronic
1122861675 14:104585270-104585292 TGGCCTGGCATCAGCTCCCAGGG + Intronic
1125549856 15:40537229-40537251 GGGGCTGGCACCACTCCCCAGGG - Intronic
1126101441 15:45120467-45120489 TGGCCTGGCACCAGTCCCCATGG - Intronic
1126687216 15:51258869-51258891 TGGGGAGCCAGCAATACCCAAGG + Intronic
1126792772 15:52236223-52236245 TGGGCTGGCAGCAGGCCCCGTGG + Intronic
1128809571 15:70561093-70561115 TGGGCCTACTGCAGTACCCAGGG + Intergenic
1129189572 15:73929460-73929482 TTGGCCTCCAGCAGTACCCAGGG - Intronic
1129239703 15:74244186-74244208 TGGGCTGTGAGCAGAAACCAGGG + Intronic
1131042352 15:89282242-89282264 TGAGCTGGCAGCAGTTCCAAAGG + Intronic
1132498174 16:273632-273654 TGGGCAGGCAGCCACACCCAGGG + Intronic
1132659488 16:1055050-1055072 TGGCCTGGCTGCAGGGCCCAGGG - Intergenic
1132669349 16:1096340-1096362 GGGGCTGGCAGGAGGACCCTGGG - Intergenic
1132932074 16:2463990-2464012 TGGGGTAGCAGCCGAACCCAGGG - Intronic
1135645954 16:24162278-24162300 TGGGCTGGCAGCAGTACCCAAGG + Intronic
1137725165 16:50651968-50651990 TGGGATGGCAGCAGATACCATGG - Intergenic
1141477352 16:84282786-84282808 TGGGAGGGCAGGAGCACCCATGG + Intergenic
1141873593 16:86806425-86806447 TGGGCTGGAAGCAGTCTGCAGGG + Intergenic
1142060636 16:88027110-88027132 TGAGCTCACAGCAGCACCCAAGG - Intronic
1142286067 16:89172023-89172045 TGGGCTGGGGGCAGCACCCCAGG + Intronic
1142574198 17:895425-895447 TGTCATGGCAGCAGTCCCCATGG - Intronic
1142759674 17:2035264-2035286 AGGCCTGGCAGCAGTTCCCACGG + Intronic
1144599689 17:16600919-16600941 GGGGCTGGGAGCAGAACCTAGGG - Intergenic
1146258612 17:31406257-31406279 TGCGCTGGGAGCAGAGCCCAAGG - Intronic
1148786757 17:50149491-50149513 GGGGCTGGCTGCAGTTGCCACGG + Exonic
1150221224 17:63496950-63496972 TGGGCTGGCCGCAGTACAACTGG + Exonic
1150630508 17:66877232-66877254 TGAGCAGGTGGCAGTACCCACGG - Exonic
1151292618 17:73161496-73161518 TGGGCTGCCAGCAGCACTCAGGG - Intergenic
1152658324 17:81530268-81530290 TGGGCAGGCAGCTTTACCCGGGG + Intronic
1152750059 17:82058534-82058556 TGGCTTGGGAGCAGTTCCCAGGG - Intronic
1152799675 17:82324941-82324963 TTGGCTGGCTGCTGTGCCCAGGG + Intronic
1152921026 17:83066762-83066784 AGGGCGGGCAGCCGTGCCCAGGG - Intergenic
1152921050 17:83066847-83066869 GGGGCGGGCAGCCGTGCCCAGGG - Intergenic
1152921071 17:83066932-83066954 AGGGCGGGCAGCCGTGCCCAGGG - Intergenic
1152921095 17:83067017-83067039 AGGGCGGGCAGCCGTGCCCAGGG - Intergenic
1152925941 17:83087801-83087823 TGGCCTGGCAGCACGACCCACGG + Intronic
1154170703 18:12048167-12048189 TGGTCTGGCTGCATTGCCCATGG - Intergenic
1156912339 18:42425799-42425821 TAGGCTGGCAGTATTCCCCATGG - Intergenic
1157313644 18:46570974-46570996 GGGGCTGGGACCAGTACCCAGGG - Intronic
1157365950 18:47064439-47064461 GGTGCTGTGAGCAGTACCCAGGG + Intronic
1158110466 18:53935195-53935217 TAGGTTGGCAGCAGTGCCAAGGG - Intergenic
1158960844 18:62586563-62586585 TGGGTTGGCAGCATAAACCAAGG + Intronic
1159061009 18:63513908-63513930 TGGGCTGAGGGCAGAACCCAGGG + Intergenic
1159977184 18:74728416-74728438 TGTGCTGGCAGCATGACACAAGG + Intronic
1160163626 18:76492825-76492847 TGGGCACGCAGCAGCCCCCACGG - Intronic
1160419720 18:78735671-78735693 TGGGCTGGCACCAGCACACGTGG + Intergenic
1160629082 18:80232888-80232910 TGAGCTGGTAGCAGTTCCCCAGG - Intronic
1161197336 19:2994105-2994127 TGGGCTGGGGGCAGGACCCGGGG + Intronic
1161266728 19:3367590-3367612 TGGGCTGGAAGGAGTCCCCGGGG - Intronic
1161335047 19:3708515-3708537 TGGGCAGGCAGCAGGTGCCAGGG - Intronic
1161346220 19:3770050-3770072 TGGGCTGACAGCTGTGCCCGAGG + Exonic
1161956891 19:7501099-7501121 TGCGCTTGCAGCAGCTCCCACGG - Exonic
1163753467 19:19092477-19092499 AGGGCTGCCTGCAGTGCCCATGG - Intronic
1163849781 19:19656414-19656436 TGGGCTGGGAGCAGTCCAGAGGG - Intronic
1164049116 19:21568913-21568935 TGCGCTGACAGCAGGACCCTGGG - Intergenic
1164162226 19:22634644-22634666 TGCGCTGGCAGCCGGACCCCCGG + Intronic
1164596413 19:29533325-29533347 GGGGCTGACAGCAGCACCCCTGG + Intronic
1164693072 19:30225474-30225496 TGGGCTGGGAACAGTTCGCAGGG + Intergenic
1165889189 19:39100478-39100500 TGGGCTGGAAGCTGGACTCAGGG + Intronic
1166920308 19:46224714-46224736 AAGGCTGGGAGCAGTGCCCAGGG - Intergenic
1168691035 19:58377735-58377757 TGTGGTGGCAGCAGTGCCCTTGG - Intronic
925187649 2:1860202-1860224 TGCTCTGGCAGCAGTTCCCATGG - Intronic
925221309 2:2143671-2143693 TGGGGTGGCATTTGTACCCAGGG + Intronic
927372061 2:22367599-22367621 TGGGCTTGCAGGACTTCCCAAGG + Intergenic
927981470 2:27377569-27377591 CCGGCTGCCAGCAGTCCCCAGGG + Exonic
928759911 2:34570127-34570149 TGGGCTCGCTGTAGCACCCAGGG + Intergenic
929501184 2:42493159-42493181 GGCGCTGGCAGCAGTACTCGAGG + Exonic
933140763 2:78790755-78790777 GGGCCAGGCAGCAGTACTCATGG - Intergenic
934491073 2:94762327-94762349 GGGCCTGACAGCAGTCCCCAGGG - Intergenic
934574251 2:95390524-95390546 TGGGCTGGCAGCAGTGCCTCTGG - Intergenic
936086641 2:109473921-109473943 TGGGAGGGCAGCATTACCCTAGG - Intronic
936094466 2:109521314-109521336 AGGGCTGGCAGCAGTGTCCCAGG + Intergenic
936316333 2:111427579-111427601 TGGGCTGGCAGCCTGCCCCAGGG - Intergenic
936671598 2:114662739-114662761 TGGGCTGCAAGCAGAACCCCAGG - Intronic
937926986 2:127175115-127175137 TGGTCTGGGAGCAGTAACCCTGG + Intergenic
938011398 2:127831697-127831719 AAGGCTGTCAGCAGGACCCAGGG + Intergenic
938172079 2:129088264-129088286 AGAGCTGGCAGCAGTGCTCAGGG - Intergenic
943241690 2:185392769-185392791 TGGACTAGCTGCAGTAGCCATGG + Intergenic
944095895 2:195968001-195968023 TGGCCTGGCAGAACTGCCCATGG - Intronic
945571964 2:211479326-211479348 TGGACTGGAGGCATTACCCAGGG - Intronic
947088682 2:226485137-226485159 TGGGCAGCCAGCAGCCCCCAGGG + Intergenic
947484867 2:230538744-230538766 TGGGCCTGCAGCAGTACCTCTGG - Intronic
947671530 2:231939596-231939618 TGGGCTGGCTCCAGAACCGAGGG + Intergenic
949030511 2:241794707-241794729 GGGCCTGGCCGCAGTCCCCACGG + Intronic
1169287965 20:4325394-4325416 TCAGCTGGCAGCAGCACACAGGG - Intergenic
1170145611 20:13170725-13170747 TGGGTCGGCTGCAGTGCCCATGG + Intergenic
1171494893 20:25548702-25548724 GGGGCTGACCCCAGTACCCACGG + Intronic
1171519687 20:25766267-25766289 TGGGCCTGCAGCAGTGCCCCAGG + Intronic
1171557233 20:26090226-26090248 TGGGCCTGCAGCAGTGCCCCAGG - Intergenic
1172447027 20:34998631-34998653 TGGGCTGGCACCGGTGACCATGG + Intronic
1172767066 20:37356546-37356568 TGGACAGGCAGAAGGACCCAGGG - Intronic
1173596348 20:44260970-44260992 AGGGCTGGAGGCAGTCCCCAAGG + Intronic
1173744497 20:45426137-45426159 TCGGCTGGCAGCACTGGCCAAGG + Exonic
1174284241 20:49461089-49461111 TGGGCTGGCAGCAGAACGTGGGG - Intronic
1174552488 20:51372177-51372199 AGGACTGGCAGCAGTTCCCAGGG + Intergenic
1175959228 20:62626587-62626609 GGGGCTGCCAGCAGTGCCCAGGG - Intergenic
1176230916 20:64032507-64032529 TGGGCTGGCAACACTTTCCAGGG - Intronic
1176429722 21:6568221-6568243 AAAGCTGGCAGCAGCACCCACGG - Intergenic
1176653831 21:9572551-9572573 TGGGCCTGCAGCAGTGCCCCAGG + Intergenic
1177782865 21:25639401-25639423 GGGGCTGCCAGCTGTCCCCAGGG - Exonic
1179705116 21:43175683-43175705 AAAGCTGGCAGCAGCACCCACGG - Intergenic
1179937076 21:44612790-44612812 TGGGCTGGCAGGAGGAGGCAGGG - Exonic
1180351929 22:11812947-11812969 TGCTCTGGGAGCACTACCCACGG - Intergenic
1180713948 22:17858866-17858888 TGGGCAGGCAACAGCAGCCAGGG + Intronic
1182348689 22:29685772-29685794 TGTGGTTTCAGCAGTACCCATGG + Intronic
1183046744 22:35226571-35226593 TGGTGGGGCAGCAGTGCCCAGGG + Intergenic
1183175675 22:36223220-36223242 TGGGATGCCAGCTGTGCCCAGGG + Intergenic
1183858426 22:40652319-40652341 TGGGCTGGCAGCCTTTTCCAAGG - Intergenic
1184871239 22:47239867-47239889 TGAGCAGGCAGCAGAACCCAGGG + Intergenic
1185273410 22:49938918-49938940 GGGGCTGGGAGCAGTCCCCTGGG - Intergenic
950363134 3:12463932-12463954 TTGGCTGGCAGCACTTCCAAAGG - Intergenic
950665457 3:14492368-14492390 TGGGCGGGCAGGTGTAGCCAGGG - Exonic
950695598 3:14699062-14699084 TAGGCTGGCAGTACTCCCCATGG - Intronic
951481756 3:23168923-23168945 TGGGCAGCCAGGAGAACCCAGGG - Intergenic
953417715 3:42732446-42732468 TGGGCTGGCAGTAGGAACAAAGG + Intronic
953548699 3:43883899-43883921 TGGGCTGGCAGCAAGTCCCTGGG + Intergenic
953869428 3:46613691-46613713 TGAGCGGGCAGGAGCACCCAGGG - Intronic
954306049 3:49726014-49726036 CGGGCTGGCAGCCGGACACATGG + Exonic
954538408 3:51378273-51378295 TGAGCTTGCAGCAGAACGCAGGG - Intronic
954853995 3:53627086-53627108 TGGCCAGGCAGCAGCACCCTTGG + Intronic
954962894 3:54581478-54581500 TGGGCTGTCAGCCATGCCCAGGG + Intronic
956176257 3:66475993-66476015 GGGGCTGGCTGCAGGACCCATGG + Intronic
956636287 3:71368746-71368768 TGGGATGTCAGCAGTAGCAAGGG + Intronic
956647013 3:71466133-71466155 TGGGCTGGCATCTGTTTCCAAGG - Intronic
959410108 3:106010174-106010196 TGGGCTGCCTCCAGAACCCAAGG - Intergenic
960572656 3:119200331-119200353 TGGGCTGGGTGCAGTGCTCATGG - Intronic
961393396 3:126570019-126570041 TAGCCTGGCTGCAGGACCCAGGG - Intergenic
961451690 3:127005066-127005088 TGGGCAGGCAGCAGGAGGCATGG - Intronic
961556752 3:127701391-127701413 GGGGCTGACAGCAGTGGCCAGGG - Intronic
962407443 3:135112036-135112058 GGGGCTGGGAGCAGTGACCAGGG + Intronic
964473239 3:157076235-157076257 TGGGCTGGCAGCAGATCCTCAGG - Intergenic
964810134 3:160654461-160654483 TGGCCTGGCAGAAATCCCCATGG + Intergenic
966065129 3:175812238-175812260 TAGGATGGCAGCAGTGCCGATGG - Intergenic
966161986 3:176978309-176978331 TTGGCTGGCATCAGTATACATGG - Intergenic
970674439 4:18432570-18432592 TGGGCTGGCAACACTAACAAAGG - Intergenic
972266128 4:37461750-37461772 TGGCCTGGCAGCAGTGACCCTGG + Intronic
976156178 4:82147229-82147251 AGGGCTGACAGCAGAACCCCTGG - Intergenic
979712011 4:123790877-123790899 TGTTCTGGCAGCAGAAACCATGG - Intergenic
984098015 4:175455250-175455272 TAGCCTGGCAGCAGTGTCCAGGG + Intergenic
1202769691 4_GL000008v2_random:192061-192083 TGTGCTGGCAGCAGTGCCTCTGG - Intergenic
985576205 5:674592-674614 TGGGCAGGCAGCAGTGACCTGGG - Intronic
986256163 5:6102473-6102495 TGGGCTTGCTGGAGAACCCAAGG - Intergenic
986932634 5:12845834-12845856 TGAGCTGGCTGCAGTTCACAGGG + Intergenic
989166571 5:38438373-38438395 TGGGCCGGCAGCTGCCCCCATGG - Exonic
990087982 5:52002626-52002648 TGGGCTGGCATCATTCTCCAGGG + Intergenic
990666544 5:58079034-58079056 AGGGCTCTCAGCAGTGCCCAGGG - Intergenic
991976297 5:72186560-72186582 TGGGATGGCAGCACTGCCCATGG + Intronic
993568524 5:89506427-89506449 TGGGATGGCAGAAGTAGGCATGG - Intergenic
994226221 5:97254307-97254329 TGGCCTGGCAGAACTCCCCATGG + Intergenic
994881717 5:105506476-105506498 AGAGCTGGCAGCAGTACACTGGG - Intergenic
995290226 5:110443374-110443396 TGGCCTGGCAGAATTCCCCATGG - Intronic
996727669 5:126686886-126686908 TGGACAGGCAGCAGCAACCATGG - Intergenic
999762496 5:154713211-154713233 AGGGCTGGAACCAGCACCCAAGG - Intronic
999870593 5:155746421-155746443 TGGGCTGACAGTAGCAGCCAGGG + Intergenic
1000409639 5:160924584-160924606 TGGGATTGCAGCAGAAGCCAGGG + Intergenic
1000917551 5:167100466-167100488 TGGTCTGGCAGCAATAACAATGG - Intergenic
1002283900 5:178149649-178149671 TGGGCTGGCAGCAGGACGACTGG - Exonic
1002518367 5:179775630-179775652 TGTCCTGGCAGCAGGACCCCAGG + Exonic
1002782879 6:380390-380412 TGGGCTGGGGGCGGGACCCAGGG - Intergenic
1002908791 6:1472219-1472241 TGGGCTGGCTGAAGCCCCCAGGG + Intergenic
1005841668 6:29748145-29748167 TGGGAGGGCAACAGGACCCAAGG + Intergenic
1007795002 6:44339980-44340002 TGCCCTGGCAGCTGTGCCCAAGG - Intronic
1011848521 6:91596654-91596676 TGAGTTGACAGCAGTACCCTAGG - Intergenic
1011945147 6:92891028-92891050 TGGGCTGGCACCAGTGGCCTTGG - Intergenic
1013292743 6:108732853-108732875 CAGGCAGGCAGCAGTACTCAGGG + Intergenic
1014696166 6:124623774-124623796 TGGGCGTGAAACAGTACCCATGG - Intronic
1014963275 6:127714003-127714025 TTGGTTGGTAGCAGTAGCCATGG + Intronic
1017243400 6:152196067-152196089 TGGCCTGGCAGTATTCCCCACGG - Intronic
1017269568 6:152490834-152490856 TGGGCTGGCCTGAGGACCCAAGG - Intronic
1017829554 6:158113822-158113844 GGGGCAGGAAGCAGTTCCCAGGG + Intronic
1018028844 6:159826330-159826352 TGGGCTGGCAGCACCACTGAGGG + Intergenic
1018650671 6:165988959-165988981 TGGGCCGCCAGCGGTACTCAGGG - Intergenic
1020027541 7:4909863-4909885 AGGGCTGGCAGCACTTACCATGG + Exonic
1023729731 7:43179212-43179234 GTGGCTGACAGCAGCACCCAAGG + Intronic
1023995398 7:45156516-45156538 TGGGAAGGTAGCAGTACCTACGG + Intergenic
1024230843 7:47362102-47362124 GAGCCTGGCAGCAGCACCCAGGG + Intronic
1025280174 7:57621217-57621239 TGGGCCTGCAGCAGTGCCCCAGG + Intergenic
1025304559 7:57844284-57844306 TGGGCCTGCAGCAGTGCCCCAGG - Intergenic
1025776170 7:64562734-64562756 TGGGCTGACAGCCGGACCCCGGG - Intronic
1026467218 7:70664703-70664725 TGGTCTAGCAGCAGCATCCATGG - Intronic
1028263037 7:88687027-88687049 TGTGCTGGCAGGAGTAGTCAGGG + Intergenic
1032164227 7:129533108-129533130 TGGACTGGCTGCAGGAGCCATGG - Intergenic
1033136270 7:138787116-138787138 AGAGCTGGAAGCAGAACCCAGGG + Intronic
1034191726 7:149218276-149218298 TGGGGTAGCAGCAGTGCACAGGG + Intronic
1034413586 7:150953811-150953833 TGGGCAGCCAGCTGAACCCAAGG + Intronic
1034900818 7:154906945-154906967 TGGGCTGCAAGCAGCACTCATGG + Intergenic
1035139140 7:156739181-156739203 TGGCCTGGCAGAACTCCCCATGG + Intronic
1036199383 8:6754620-6754642 TGGGGAGGCAGCAGTCACCATGG + Intronic
1038650031 8:29394234-29394256 TGGGATGGTGGCAGTACCAAGGG - Intergenic
1039867460 8:41517869-41517891 TGGGCTGCCAGCAGTAGCAGTGG - Intergenic
1039906608 8:41791009-41791031 TGGGCTGACAGCAGGACAGAGGG + Intronic
1040105233 8:43537871-43537893 GGGCCTGACAGCAGTACCCCAGG + Intergenic
1041500388 8:58533424-58533446 TGGACTGGCAGTATTCCCCATGG - Intergenic
1042759333 8:72253505-72253527 TGTGCTGGCAGCTGACCCCAGGG - Intergenic
1043340230 8:79229387-79229409 TGAGCTGGCAGAACTCCCCATGG - Intergenic
1048070198 8:131012862-131012884 TCGGTTGGGATCAGTACCCACGG - Intronic
1049527141 8:143133074-143133096 TCGCCTGGCATCAGCACCCAGGG + Intergenic
1049610589 8:143553087-143553109 TGGCCTGGCAGCAGCTCCCGAGG - Intergenic
1050865153 9:10488748-10488770 TGGTCTGGCAGTACTCCCCATGG - Intronic
1057314213 9:93958530-93958552 TGGGCTGGCAGCTGCGCCCCTGG - Intergenic
1058010088 9:99967544-99967566 TGGCAAGGCTGCAGTACCCAGGG + Intronic
1058663135 9:107283812-107283834 AGGGCCGGCACCAGGACCCAGGG - Intronic
1060385928 9:123228251-123228273 TGGGCAGGCAGCTGGACACATGG + Intronic
1060553545 9:124496910-124496932 TTGGTGGGCAGCAGTGCCCAGGG - Intronic
1061638329 9:131929617-131929639 TGGCCTGGCAGAACTCCCCACGG + Intronic
1062039685 9:134398552-134398574 AGGGCTGGGAGCAGGGCCCAGGG + Intronic
1062528358 9:136987809-136987831 GGGGCTGGCAGCAGGACGGAGGG - Intergenic
1203631552 Un_KI270750v1:76003-76025 TGGGCCTGCAGCAGTGCCCCAGG + Intergenic
1188078476 X:25807576-25807598 TAGCCTGGCAGCACTCCCCATGG - Intergenic
1189559424 X:42176987-42177009 TGGGCTGCCTGCAGTTCTCATGG - Intergenic
1189758384 X:44295654-44295676 TAGGATGGCAGCAGTGGCCATGG + Intronic
1190598772 X:52069186-52069208 TGTGCTGGCAGCAGTAGGCGAGG - Exonic
1190610052 X:52184887-52184909 TGTGCTGGCAGCAGTAGGCGAGG + Exonic
1190692596 X:52923969-52923991 TGGGCTTGCAGCAGCATCCAGGG + Intergenic
1190913682 X:54794217-54794239 TGGTCTGGCAGCAGGACACTGGG + Intronic
1192380847 X:70614397-70614419 TAGGCTGGCAGTACTCCCCATGG + Intronic
1193524468 X:82572536-82572558 TGGTCTGGCAGCACTTCCCATGG - Intergenic
1194892502 X:99397928-99397950 TGGCCTGGCAGAACTCCCCATGG - Intergenic
1195800502 X:108703413-108703435 TGAGCAGGCAGAAGCACCCATGG + Intergenic
1198155416 X:133955193-133955215 TTGGCTGGGAGCAGCCCCCAGGG - Intronic
1198515172 X:137400022-137400044 TAGCCTGGCAGCACTCCCCATGG - Intergenic
1198770540 X:140125892-140125914 TGGCCTGGCAGAATTCCCCATGG - Intergenic
1199274674 X:145926836-145926858 TAGTCTGGCAGTACTACCCATGG + Intergenic
1199690558 X:150306131-150306153 TGGGCAGGCAGCAGTTCCGGAGG + Intergenic