ID: 1135651267

View in Genome Browser
Species Human (GRCh38)
Location 16:24208791-24208813
Sequence GGGAGCGCTCCTGAAGCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135651263_1135651267 0 Left 1135651263 16:24208768-24208790 CCAAGGGCTGACGTCTCCATTTA 0: 1
1: 0
2: 0
3: 3
4: 95
Right 1135651267 16:24208791-24208813 GGGAGCGCTCCTGAAGCTAATGG 0: 1
1: 0
2: 0
3: 2
4: 57
1135651262_1135651267 1 Left 1135651262 16:24208767-24208789 CCCAAGGGCTGACGTCTCCATTT 0: 1
1: 0
2: 1
3: 11
4: 81
Right 1135651267 16:24208791-24208813 GGGAGCGCTCCTGAAGCTAATGG 0: 1
1: 0
2: 0
3: 2
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135651267 Original CRISPR GGGAGCGCTCCTGAAGCTAA TGG Intronic
900662187 1:3790310-3790332 GTGAACCCTCCTGAAGCCAAAGG - Intronic
905143376 1:35867217-35867239 GGGAGGCCCCTTGAAGCTAAGGG + Intergenic
914816575 1:151067436-151067458 GGGAGCTCTCCAGAAGTTGAAGG - Exonic
915939139 1:160107511-160107533 AGGAGTGCTCCAGAAGATAAAGG - Intergenic
1064004176 10:11687333-11687355 GGGAGGGCTGAGGAAGCTAAGGG - Intergenic
1064218746 10:13421544-13421566 GACAGTGCTTCTGAAGCTAATGG - Intergenic
1065092922 10:22252749-22252771 GGGGGCGCTCCTGGAGGTGACGG + Intergenic
1069362832 10:67662980-67663002 GGAAGAGCTCCTGGAGCCAAAGG - Intronic
1070577004 10:77686990-77687012 AGCAGCGTTCCTGAAGCTGATGG - Intergenic
1070826195 10:79391785-79391807 GAGAGCGCTCCGGGAGCTACTGG - Intronic
1071044674 10:81359494-81359516 TGGAGTGCTTCTGAAGTTAATGG + Intergenic
1077926313 11:6684714-6684736 TGGAGCACACCTGAAGCCAAGGG + Intergenic
1082814277 11:57498022-57498044 GGGAGCCTTTTTGAAGCTAAAGG - Intronic
1090958385 11:131534304-131534326 GGAAGCTCTCCTGATGCTCATGG + Intronic
1096718382 12:53504384-53504406 GGGGGGGCTCCTGAAGGAAAAGG - Exonic
1105139605 13:17083874-17083896 TGGAGCGCTCCTGAGGCCTAAGG + Intergenic
1105155728 13:17346911-17346933 TGGAGCGCTCCTGAGGCCTACGG + Intergenic
1110345024 13:74436572-74436594 GGGAGGGATGGTGAAGCTAAGGG + Intergenic
1112694354 13:101931137-101931159 GTGAGGTCTCCTGAAACTAAAGG - Intronic
1113930632 13:113967175-113967197 GGGAGCTCTCCTGGAGCTGCTGG + Intergenic
1115635571 14:35287455-35287477 GGCAGAGCACCTTAAGCTAAGGG + Intronic
1117377355 14:55129012-55129034 GGGAGCGCCACGGAACCTAACGG + Intronic
1122389024 14:101367817-101367839 GGGAGGGCTCCGGGAGCTGATGG + Intergenic
1123068018 14:105627921-105627943 GGGACAGCTCCTGGAGCTCAGGG - Intergenic
1123072097 14:105646929-105646951 GGGACAGCTCCTGGAGCTCAGGG - Intergenic
1124887224 15:33698475-33698497 GGGGGAGCTCCTGTTGCTAAGGG + Intronic
1125431089 15:39594086-39594108 GGGTGCGCACCTGAAGGAAAAGG - Exonic
1130577044 15:85102233-85102255 GAGAGCGTTGCTGAAGCTGAAGG + Intronic
1135651267 16:24208791-24208813 GGGAGCGCTCCTGAAGCTAATGG + Intronic
1139287092 16:65825448-65825470 GGGAGCACTCAGGAAGCAAAAGG + Intergenic
1154163317 18:11995921-11995943 GGGAGCATTCCTGATGCTAGGGG + Intronic
1156220020 18:35041646-35041668 GGGAGCGTTCCTACAGGTAATGG + Exonic
1157227503 18:45880448-45880470 GTGAGCGCTGCTGAAGCTGGTGG + Intronic
1157766602 18:50302313-50302335 AGGAGCGCTCCAGGAGCTCACGG + Intergenic
1163737411 19:18990028-18990050 GGGAGTGCCACTGAAGCTAGCGG + Intergenic
926082715 2:10001171-10001193 GGGAGCGCACCTGAAGAGTACGG + Exonic
926506873 2:13727147-13727169 GAGACCACTCCTGAAGCTAAGGG + Intergenic
933834337 2:86233014-86233036 GGGAGGGATCCTGGAGCCAAAGG - Intronic
946301495 2:218827129-218827151 GGGAGCCCTCTTGAAGCTGCTGG - Intronic
947094568 2:226551307-226551329 TGGAGAGCTCAGGAAGCTAAAGG + Intergenic
948941547 2:241199496-241199518 GGGAGCCCTCCTGAGGCTGTCGG - Intronic
1169282054 20:4276384-4276406 GGGAGAGCTCCAGCAGCCAAAGG + Intergenic
1171365048 20:24617742-24617764 GGGAGAGCTCGGGAAGCTTAAGG + Intronic
1179087899 21:38236724-38236746 TGGAGGGCCCCTGTAGCTAAGGG - Intronic
964823670 3:160802001-160802023 GAAAGCACTTCTGAAGCTAAGGG - Intronic
967963919 3:194945701-194945723 AGGAGGGCTCCTGGAGCTAGGGG + Intergenic
971142566 4:23940357-23940379 TGGAGCTTCCCTGAAGCTAATGG - Intergenic
981226764 4:142305483-142305505 GGGAGAGCTGCTGAAGTCAAAGG - Exonic
990296390 5:54405823-54405845 GGGAGCTCTCCTGAGGCTCAAGG - Intergenic
992332326 5:75730051-75730073 GGGGGCGATCCTGAAGGAAAGGG - Intergenic
1002175757 5:177400243-177400265 GCGCGCGCTCCTGGTGCTAATGG - Exonic
1008278301 6:49566271-49566293 GGCAGAGCTCATGAAGCTCAGGG - Intergenic
1018912217 6:168108370-168108392 GGGCGGTCTCCTGAAGCTCATGG - Intergenic
1019630823 7:2048775-2048797 GGGAGAGCACCTGAAGCTGGAGG - Intronic
1038266280 8:26041885-26041907 GGGAGCGCTCCTCCAGCTCCAGG + Intronic
1041962991 8:63640951-63640973 GGGAGCTTTCATGAAGATAATGG - Intergenic
1057736483 9:97666547-97666569 GGGGGCTCGCCTGAATCTAATGG + Intronic
1061084575 9:128391607-128391629 GGGGCCGCTCCTGCAGCTCAGGG - Exonic
1062564328 9:137157201-137157223 GGGAGCGCTCCTCAAGAGATGGG + Intronic
1186928581 X:14361780-14361802 GGGAGTGGTCCTGAAACCAAAGG - Intergenic