ID: 1135652193

View in Genome Browser
Species Human (GRCh38)
Location 16:24216154-24216176
Sequence CGGGGGCTGTGGCCCATTCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135652180_1135652193 3 Left 1135652180 16:24216128-24216150 CCCCAGTGTTCAGCCACTCGGAG 0: 1
1: 0
2: 0
3: 12
4: 117
Right 1135652193 16:24216154-24216176 CGGGGGCTGTGGCCCATTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1135652190_1135652193 -10 Left 1135652190 16:24216141-24216163 CCACTCGGAGGGGCGGGGGCTGT 0: 1
1: 0
2: 0
3: 22
4: 218
Right 1135652193 16:24216154-24216176 CGGGGGCTGTGGCCCATTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1135652181_1135652193 2 Left 1135652181 16:24216129-24216151 CCCAGTGTTCAGCCACTCGGAGG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1135652193 16:24216154-24216176 CGGGGGCTGTGGCCCATTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 133
1135652183_1135652193 1 Left 1135652183 16:24216130-24216152 CCAGTGTTCAGCCACTCGGAGGG 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1135652193 16:24216154-24216176 CGGGGGCTGTGGCCCATTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135652193 Original CRISPR CGGGGGCTGTGGCCCATTCA GGG Exonic
900358261 1:2275107-2275129 TGGGGGCAGTAGCCCTTTCAGGG - Intronic
900428093 1:2589614-2589636 CGGGGGCTGTGGAGGATGCAGGG - Exonic
901259217 1:7859384-7859406 CGGGGCCTGTGACCCCCTCAGGG - Intergenic
903367096 1:22811760-22811782 CGGGGGCAGTGGCTCATGCCTGG + Intronic
903583377 1:24389266-24389288 CGGGGAATGGGGCCCATCCACGG + Intronic
905357806 1:37396820-37396842 AGGAGGCTGTGGCCCAGTCATGG - Intergenic
906407625 1:45554526-45554548 GGAGTGCAGTGGCCCATTCATGG - Intronic
911471765 1:98327841-98327863 AGGCGGCAGTGGCCCAGTCAGGG - Intergenic
913049700 1:115106454-115106476 CGGGTGCTGTGGCACGATCATGG + Intergenic
915912097 1:159921882-159921904 TGGGGACTGTGGCCCATTCTTGG - Intronic
920263072 1:204702930-204702952 CTGGGGCTCTATCCCATTCAGGG - Intergenic
920381146 1:205535195-205535217 AGGAGGCTGTGGCTAATTCATGG - Intergenic
921989430 1:221348439-221348461 CAGGGGCTGTAGCCCTTCCAAGG + Intergenic
922274848 1:224067934-224067956 AGGGGGTTGTGGCTCATTGATGG + Intergenic
924518523 1:244786099-244786121 CGGGTGCTGTGGCTCATGCCTGG + Intergenic
1063825422 10:9891983-9892005 GGGGGGATGTGGAACATTCAAGG - Intergenic
1067720772 10:48726091-48726113 TGTGGGCTGTGGGCCATGCAAGG + Intronic
1071187574 10:83061635-83061657 CGGGGTCTGAGGCCCTTTGATGG - Intergenic
1075675937 10:124295910-124295932 CAGGGGCTGTTTCCCATTCCAGG - Intergenic
1076673035 10:132133595-132133617 CTGGGGGAGTGGCCCATGCAGGG - Intronic
1077423798 11:2465122-2465144 AGGGGCCTGTGGCCCATGGAAGG - Intronic
1077514137 11:2991832-2991854 CGGGGGCTGTGGCGGTTACACGG - Intronic
1083371515 11:62185971-62185993 TGGAGGCTGAGGCCCATCCAAGG - Intergenic
1083667976 11:64285648-64285670 CGGGGGCCGTGCCGCATCCAGGG - Intronic
1083681808 11:64354873-64354895 TGGGGGCTGAGGCTCATGCAGGG - Intronic
1083681848 11:64355004-64355026 TGGGGGCTGAGGCTCATGCACGG - Intronic
1084263612 11:67993882-67993904 CCGGGGCTGGGACCCATACAGGG - Intronic
1087146885 11:94821649-94821671 CGGGGGCTGTGGAGCACCCAGGG - Exonic
1090652625 11:128821085-128821107 CGGGGGCGGTGGCTCATGCCTGG + Intergenic
1091345076 11:134846991-134847013 GGGAGGGTGTGGCCCAGTCACGG + Intergenic
1091440438 12:508579-508601 CGGAGGCTGTGCCCAATTCTGGG - Intronic
1091889250 12:4039921-4039943 GGAGTGCTGTGGCACATTCATGG - Intergenic
1098313134 12:69167384-69167406 CTGGGGCTGTAGCCCAAGCATGG + Intergenic
1101434297 12:104651953-104651975 CAGGGGCTGTGGCTCATGCAAGG - Intronic
1102291032 12:111699867-111699889 GGGGAGCTGTGGCACAGTCATGG - Intronic
1105732107 13:23228068-23228090 CGGGTGCTGTGGCTCATTTTGGG - Intronic
1113575841 13:111394791-111394813 TGGGGACTGTGGACCATGCAGGG + Intergenic
1116880855 14:50167482-50167504 GGAGTGCAGTGGCCCATTCATGG - Intronic
1118734330 14:68691016-68691038 TGGGGGCTGCGGCCCCTCCATGG - Intronic
1119472736 14:74909723-74909745 AGGGGGCTGTGGCCGAGGCATGG - Exonic
1121100050 14:91244384-91244406 TGCGGGTTGTGACCCATTCATGG - Exonic
1122738074 14:103855285-103855307 CTGGGCCTGTGGCCCACTCTGGG + Intergenic
1123117371 14:105900756-105900778 CGGAGGCTGTGGCTCATTTTAGG + Intergenic
1128520097 15:68369485-68369507 TGGGACCTGTGGCCCATTCTAGG + Intronic
1129389015 15:75211240-75211262 CTGACCCTGTGGCCCATTCAGGG + Exonic
1132114150 15:99123710-99123732 CGGGGCCTGTGGGTGATTCACGG - Intronic
1132206446 15:99989143-99989165 CGGGGGGTGTGGGCGAGTCACGG + Intronic
1135589590 16:23695408-23695430 CGGGGGCAGGGGGGCATTCAGGG + Intronic
1135652193 16:24216154-24216176 CGGGGGCTGTGGCCCATTCAGGG + Exonic
1136556768 16:31011505-31011527 CGGGTGCGGTGGCCCAGGCATGG - Intergenic
1136687489 16:32003739-32003761 CAGGGCCTGTGGCCCTCTCATGG + Intergenic
1136788102 16:32947290-32947312 CAGGGCCTGTGGCCCTCTCATGG + Intergenic
1136881681 16:33906499-33906521 CAGGGCCTGTGGCCCTCTCATGG - Intergenic
1137626292 16:49910858-49910880 GGGGAGCTGCGGCCCATTCTGGG - Intergenic
1139954370 16:70686174-70686196 CGCGGGCGCAGGCCCATTCACGG + Intergenic
1141103179 16:81212741-81212763 CTGAGGCTGTGGCCCCTGCAAGG - Intergenic
1141601050 16:85126721-85126743 TGGGGGCTGTGGCCTCTTCTAGG - Intergenic
1142170957 16:88622591-88622613 CGGGGTCTGTGCCCCATTTGGGG - Intronic
1144340148 17:14303497-14303519 CCCGGGCTGTGACCCATTCTCGG + Intronic
1145849703 17:28080938-28080960 GGAGTGCAGTGGCCCATTCATGG + Intronic
1147148469 17:38499408-38499430 CAGGGCCTGTGGCCCTCTCATGG + Intronic
1148793930 17:50188309-50188331 CGGGAGCTGGGGCCAACTCATGG + Intronic
1150572307 17:66397745-66397767 TGGGGGGTGTGAGCCATTCAAGG + Intronic
1152124987 17:78441263-78441285 GGTGGGCTGTGGCCCAGGCAGGG + Intronic
1158086623 18:53658763-53658785 TGGGGGCAGTGGACCATTTAAGG - Intergenic
1162133800 19:8543451-8543473 GGGGGGCTGTGTCCTAGTCAGGG + Intronic
1167642284 19:50688367-50688389 GGGGTGCAGTGGCCCAATCATGG + Intronic
1168108409 19:54178666-54178688 CGGGGGCAGGGGCCCAGCCAGGG + Intronic
926396763 2:12450866-12450888 CGGGGGATGGTGCCCATTCTTGG + Intergenic
926417949 2:12668907-12668929 AGGGGGCTGTGACCCCTTGAAGG - Intergenic
926718072 2:15940462-15940484 AGGGGGCTGTGGCGCAGACAAGG - Intergenic
930359445 2:50359200-50359222 AGGGGGCTGTGGTCCTTTGAAGG - Intronic
937178514 2:119967167-119967189 CGGGAGCGGTGGCCCATGCCTGG + Intronic
938121219 2:128635694-128635716 GCGGGGCTGTGGCCAATCCAGGG - Intergenic
942640968 2:178059897-178059919 CTGGGGCTGGGGCCCACTCTGGG + Intronic
944660913 2:201920849-201920871 CAGGGACTGTGGCTCACTCACGG - Intergenic
946275003 2:218624832-218624854 CGGGCGCTGTGGCTCATGCTTGG + Intronic
946618351 2:221533651-221533673 CGGGGGCTGTGCCTCCTCCAGGG + Intronic
1171186555 20:23127598-23127620 CAGGGGCTGTGGGCCACTAAGGG + Intergenic
1175501250 20:59452772-59452794 AGGGGGATTTGGCCCATTAAAGG + Intergenic
1176284721 21:5013318-5013340 CGCTGGCTGTGGCCCCTCCATGG - Intergenic
1176285007 21:5014745-5014767 TGGGGGCTGCAGCCGATTCAGGG - Intergenic
1179872174 21:44248730-44248752 TGGGGGCTGCAGCCGATTCAGGG + Intronic
1179872460 21:44250157-44250179 CGCTGGCTGTGGCCCCTCCATGG + Intronic
1182505607 22:30780128-30780150 CCGGGGCTGTGGGCCCCTCAAGG - Intronic
1183386999 22:37520359-37520381 CGGGGGCGGTGGCTCATGCCTGG + Intergenic
1184992587 22:48180749-48180771 CTGGGGCTGTGGCCTCTCCACGG + Intergenic
1185291156 22:50028503-50028525 CAGGGGCTGGGACCCACTCACGG - Intronic
949388935 3:3537545-3537567 CGGGGCCTGTTGCCCACACATGG - Intergenic
954292381 3:49656428-49656450 CTGGGGCTGGGGGCCCTTCAAGG + Exonic
957079052 3:75621833-75621855 CCGGGGCTGGGACCCATACAGGG - Intergenic
961770995 3:129249825-129249847 CGGAGGCTGAGGCCCAGTGAGGG + Intronic
968410499 4:386218-386240 CGGAGGCTGAGGCCGAATCACGG - Intergenic
968658155 4:1787414-1787436 AGGGGGCTCTGGCCCACTCTCGG + Intergenic
969376493 4:6766877-6766899 GGAGGGCAGTGGCACATTCATGG + Intergenic
969484463 4:7464395-7464417 GAGGGGCTGTGGTCTATTCAGGG + Intronic
980709463 4:136545541-136545563 CAGGGCCTGTGACCCATTCCTGG - Intergenic
982342230 4:154312496-154312518 GGAGGGCAGTGGCCCAATCATGG - Intronic
983550210 4:169009963-169009985 CGGCGGCTTTGGCCCCTTCCAGG + Exonic
986272282 5:6243799-6243821 CTGGGCATGTGGCCCATTTAAGG - Intergenic
991350020 5:65711523-65711545 CTGGGCCTGTGGCCCCCTCAGGG - Intronic
991956775 5:72002568-72002590 CAGTGGCTGTTGCCCATACATGG + Intergenic
997294132 5:132759447-132759469 AGGGGTCTGTGGCCAGTTCAGGG - Intronic
1001941213 5:175741038-175741060 CGGGGTCCCTGGGCCATTCAGGG - Intergenic
1002320474 5:178372512-178372534 CGGGGGCTGCGGTCCCTGCAAGG + Intronic
1002880282 6:1244684-1244706 TGGGGGCTGTGGCCCGGTGAGGG + Intergenic
1004213688 6:13680703-13680725 GGAGGGCTGTGGCACAATCATGG - Intronic
1006644871 6:35509168-35509190 AGGGGGCTGAGGTCCCTTCAGGG - Intronic
1007692078 6:43708947-43708969 TGGGGGCTGTGGGCAATTCTAGG + Intergenic
1011755890 6:90497909-90497931 TGGGGGATGTGGGCCATGCAGGG - Intergenic
1022790619 7:33685291-33685313 CGGGCGCTGTGGCTCATGCCTGG + Intergenic
1024296507 7:47847361-47847383 CAGGGGGTGTGGCCTGTTCAGGG - Intronic
1026738363 7:72963163-72963185 CGGGGGCTCTGGTCAAGTCATGG - Intronic
1027105371 7:75401907-75401929 CGGGGGCTCTGGTCAAGTCATGG + Intronic
1030330497 7:108265100-108265122 CGGGAGCCGTGGCTCATACAGGG + Intronic
1031992596 7:128207810-128207832 GGGAGGCTGTGGCCCCTCCAGGG - Intergenic
1038438854 8:27558050-27558072 CAGGGGCTGTGGCCAACACAAGG - Intergenic
1039918487 8:41876422-41876444 TGGGGGCTGGGGCGCATTCAAGG + Intronic
1040638581 8:49304406-49304428 TGGGAGCTGTGGATCATTCAGGG + Intergenic
1045010838 8:97957174-97957196 CTGGGGTTGTGAGCCATTCATGG + Intronic
1045037707 8:98188960-98188982 CAGGAGCTGTGGCCCATCCAAGG - Intergenic
1045269503 8:100649751-100649773 CTGGGGCTGGGGCGCATCCACGG + Intronic
1047559683 8:125973124-125973146 TGAGGGCTCTGGCCCATTAATGG - Intergenic
1048970873 8:139644424-139644446 CGTGGGCTGTGATCCATTAATGG - Intronic
1049108017 8:140625588-140625610 CCGGGGGTGAGGCCCGTTCATGG - Intronic
1049147133 8:141008934-141008956 CGGGGGCTGTGGCTCATGCCTGG + Intergenic
1049432288 8:142570963-142570985 CGGGTGCAGTGGCTCATTCCTGG - Intergenic
1049574931 8:143385588-143385610 TGGGGGCTAAGGCCCATGCATGG - Intergenic
1050352708 9:4755523-4755545 CACAGGCTGTGGCCCATACAGGG + Intergenic
1053448593 9:38173047-38173069 TGGGGGCTTTGGGCCATTCTTGG - Intergenic
1057296563 9:93848035-93848057 CAGAGGCCATGGCCCATTCAGGG - Intergenic
1057392881 9:94653944-94653966 CGAGGGCTGTGGCCAGTCCAAGG + Intergenic
1062099994 9:134723069-134723091 CGGGGGCTGTGACCCACAAAGGG - Intronic
1062407863 9:136405689-136405711 CGGGTGCAGTGGCGCAATCACGG - Intronic
1062470860 9:136703610-136703632 GGGGGGCTCTGGCCCATTTCAGG + Intergenic
1062477056 9:136733516-136733538 GGAGGGCTGTGGCACAATCATGG - Intergenic
1189417720 X:40829845-40829867 AGGGAGCTGTGGGCCTTTCAGGG - Intergenic
1189813451 X:44801659-44801681 CGAGGGCGGTGGCACAGTCACGG + Intergenic
1192370189 X:70506646-70506668 CCAGGGCTGTGGTGCATTCAGGG - Intergenic
1195379051 X:104254288-104254310 CGCCGGCTGTGGCCCCTCCACGG + Exonic