ID: 1135655371

View in Genome Browser
Species Human (GRCh38)
Location 16:24243867-24243889
Sequence TGGGACTACTGGGGAGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135655371_1135655375 -7 Left 1135655371 16:24243867-24243889 CCAATTTCTCCCCAGTAGTCCCA No data
Right 1135655375 16:24243883-24243905 AGTCCCACACAATGTTCTGCTGG No data
1135655371_1135655378 14 Left 1135655371 16:24243867-24243889 CCAATTTCTCCCCAGTAGTCCCA No data
Right 1135655378 16:24243904-24243926 GGAACCCACTGCTCTCTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135655371 Original CRISPR TGGGACTACTGGGGAGAAAT TGG (reversed) Intergenic
No off target data available for this crispr