ID: 1135655371 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:24243867-24243889 |
| Sequence | TGGGACTACTGGGGAGAAAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1135655371_1135655375 | -7 | Left | 1135655371 | 16:24243867-24243889 | CCAATTTCTCCCCAGTAGTCCCA | No data | ||
| Right | 1135655375 | 16:24243883-24243905 | AGTCCCACACAATGTTCTGCTGG | No data | ||||
| 1135655371_1135655378 | 14 | Left | 1135655371 | 16:24243867-24243889 | CCAATTTCTCCCCAGTAGTCCCA | No data | ||
| Right | 1135655378 | 16:24243904-24243926 | GGAACCCACTGCTCTCTTCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1135655371 | Original CRISPR | TGGGACTACTGGGGAGAAAT TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||