ID: 1135656580

View in Genome Browser
Species Human (GRCh38)
Location 16:24255834-24255856
Sequence GCCAGGGCGCTGACTGTCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 162}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135656574_1135656580 2 Left 1135656574 16:24255809-24255831 CCGGGTCGTGCTGCAGCGCCCAG 0: 1
1: 0
2: 1
3: 16
4: 162
Right 1135656580 16:24255834-24255856 GCCAGGGCGCTGACTGTCCTCGG 0: 1
1: 0
2: 1
3: 17
4: 162
1135656567_1135656580 28 Left 1135656567 16:24255783-24255805 CCTTAACCCTTCCTAGAGCGGAG 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1135656580 16:24255834-24255856 GCCAGGGCGCTGACTGTCCTCGG 0: 1
1: 0
2: 1
3: 17
4: 162
1135656569_1135656580 22 Left 1135656569 16:24255789-24255811 CCCTTCCTAGAGCGGAGGAACCG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1135656580 16:24255834-24255856 GCCAGGGCGCTGACTGTCCTCGG 0: 1
1: 0
2: 1
3: 17
4: 162
1135656573_1135656580 17 Left 1135656573 16:24255794-24255816 CCTAGAGCGGAGGAACCGGGTCG 0: 1
1: 0
2: 0
3: 32
4: 73
Right 1135656580 16:24255834-24255856 GCCAGGGCGCTGACTGTCCTCGG 0: 1
1: 0
2: 1
3: 17
4: 162
1135656570_1135656580 21 Left 1135656570 16:24255790-24255812 CCTTCCTAGAGCGGAGGAACCGG 0: 1
1: 0
2: 1
3: 2
4: 78
Right 1135656580 16:24255834-24255856 GCCAGGGCGCTGACTGTCCTCGG 0: 1
1: 0
2: 1
3: 17
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135656580 Original CRISPR GCCAGGGCGCTGACTGTCCT CGG Exonic
900146684 1:1161712-1161734 GGCCGGGCCCTGACTGTCCGGGG + Intergenic
900176971 1:1295283-1295305 GCCAAGGCCCTGACTGTCAGGGG - Intronic
900228723 1:1545155-1545177 GGCAGGGGCCTCACTGTCCTAGG + Intronic
900284858 1:1894230-1894252 GCCAGGGCGGGCACTGGCCTGGG - Intergenic
900312662 1:2041689-2041711 ACCAGGGCGTGGACTGGCCTGGG - Intergenic
900382389 1:2391415-2391437 GACAGGTCGCTGGCTGCCCTGGG - Intronic
900583789 1:3422827-3422849 GCCAGGGCGCTGCCTGTCACTGG + Intronic
900937181 1:5773797-5773819 GCCCGGCCGCTCTCTGTCCTGGG + Intergenic
902715930 1:18272698-18272720 GCCAGGGACCTGGCTGCCCTGGG + Intronic
903626691 1:24735786-24735808 GCCAAGATGCTGTCTGTCCTGGG + Intergenic
904376522 1:30085576-30085598 GCCAGTGCCCTGCCTGTGCTGGG - Intergenic
904490507 1:30856063-30856085 GCAAGGGCTCTGTCTGACCTGGG - Intergenic
905009987 1:34740618-34740640 GCCTGGGCGCTGACTGCACTTGG - Intronic
905857258 1:41322250-41322272 GCCTGGGAACTGACTGTCCCCGG + Intergenic
906110396 1:43318456-43318478 GACAGGGGGATGACTGTCCAGGG + Intronic
907248229 1:53121448-53121470 GACAAGGAGCTGAATGTCCTGGG + Intronic
915525513 1:156473697-156473719 CCCAGTGCGCGGGCTGTCCTGGG - Intronic
918077383 1:181180844-181180866 GCCAGGGATATTACTGTCCTTGG - Intergenic
920948139 1:210548584-210548606 GCCAGGGCTCTGGCCCTCCTTGG + Intronic
922765206 1:228152831-228152853 GCCAGGACGCTGCCTGGCCCAGG - Intronic
1063031629 10:2240859-2240881 CCCATGGAGCTGAGTGTCCTGGG - Intergenic
1063418329 10:5890559-5890581 GCCAGGGCGCTCACTGAACTCGG + Intronic
1064266564 10:13830212-13830234 GGCAGGGCGCTGTCCCTCCTCGG + Intronic
1067468358 10:46518173-46518195 GCCAGGTCCCTGTCTCTCCTGGG + Intergenic
1067663871 10:48256760-48256782 ACCAGGCCACTGTCTGTCCTTGG + Intronic
1071482949 10:86078774-86078796 GCCAGGGGGCTGGGGGTCCTAGG - Intronic
1073100100 10:101002011-101002033 GGCAGGGCACTGCCTGGCCTTGG + Exonic
1073321850 10:102620428-102620450 GCTGGGGCCCTGACTCTCCTGGG - Intronic
1076030330 10:127152422-127152444 GCCAAGCTGCTGACTGTTCTTGG - Intronic
1077097235 11:804288-804310 TCCAGGGCGCTGCCTTTCCTGGG - Exonic
1077193044 11:1263462-1263484 GCCAGGTCACTGCCTGACCTGGG + Intergenic
1078144587 11:8714183-8714205 GGCAGGGAGCTGAGTGGCCTGGG + Intronic
1078161770 11:8846367-8846389 GTCAGGGCGCTATCTATCCTTGG + Intronic
1079284579 11:19117285-19117307 GGCCGGGCGGTGGCTGTCCTGGG + Intronic
1082862771 11:57871551-57871573 GCCAGGAGGCTGACTGTGCTAGG - Intergenic
1084551247 11:69843459-69843481 GCCAGGGCTCTGACGTTCCCAGG + Intergenic
1085390995 11:76182113-76182135 CCCAGGGCTCTGCCTGTCTTCGG + Intergenic
1085508635 11:77074220-77074242 GCCAGGGCTCTTCCAGTCCTGGG + Intronic
1085634313 11:78146464-78146486 TCCAGGGCGCTTTCTGTTCTTGG + Intergenic
1090536066 11:127643276-127643298 GCCATTGCCCTGACTGACCTAGG + Intergenic
1092261702 12:6956370-6956392 GCCAAGGGGCTCACTGTCTTGGG + Intronic
1092428305 12:8390680-8390702 GCCAGGGCCCTACCTGTCCACGG - Intergenic
1093948383 12:25135856-25135878 GTCTGGGCTCTGACTCTCCTTGG - Intronic
1096194989 12:49644020-49644042 ACCAGCGTGCTGACTGGCCTAGG - Exonic
1098487110 12:71034156-71034178 TTCAGGGTGCTGACTCTCCTGGG + Intergenic
1102086949 12:110149741-110149763 GGCAGGCCACTGACTGACCTAGG - Intronic
1103432950 12:120903863-120903885 GCCATGGCGCTGCCTCTCGTGGG + Exonic
1103626907 12:122226581-122226603 GGCAGGCCGCCGACCGTCCTGGG - Exonic
1103847675 12:123911851-123911873 TCCTGGGCGGTGTCTGTCCTTGG + Intronic
1104806330 12:131591853-131591875 GCCCTGGCTCTGTCTGTCCTCGG - Intergenic
1112087003 13:96041874-96041896 GTCTGGGCTCAGACTGTCCTTGG - Intronic
1112326013 13:98443305-98443327 CCCAGGTCCCTGACTGTACTAGG - Intronic
1114051052 14:18920188-18920210 GCCAGGGCACTGGCTGTCTCCGG + Intergenic
1114234627 14:20813333-20813355 GCCAAGGTGCTGTCTGACCTTGG - Intergenic
1121300054 14:92862913-92862935 ACCTGGGCTCTGACTGTCCTGGG + Intergenic
1122903377 14:104791113-104791135 GCCAGGGCCTTGACTGCCCAGGG - Intronic
1126385297 15:48087973-48087995 GCCATGGAGTTAACTGTCCTGGG - Intergenic
1128245160 15:66127892-66127914 GCCACGGGGCTGCCAGTCCTGGG + Intronic
1129207085 15:74043805-74043827 CCCAGGGCTCTGACTGGGCTGGG + Intronic
1132625706 16:890523-890545 GCCAAGGCTCAGCCTGTCCTGGG + Intronic
1132955956 16:2593653-2593675 GCAAGAGCTCTGACTGGCCTGGG + Intronic
1135273249 16:21086785-21086807 GGCCTGGCCCTGACTGTCCTTGG - Intronic
1135500504 16:22991811-22991833 ACCAGGGCACTGCATGTCCTTGG + Intergenic
1135656580 16:24255834-24255856 GCCAGGGCGCTGACTGTCCTCGG + Exonic
1137595448 16:49720519-49720541 GCCAGGGCACTGACTGGACCAGG - Intronic
1139593988 16:67947771-67947793 TCCAGGGCGCTGTCCTTCCTGGG - Exonic
1141285144 16:82664475-82664497 GACAGGACTCTGACTGTGCTGGG - Intronic
1141597553 16:85106626-85106648 GCGAGGGCGCAGACTCTCCCTGG + Intronic
1143410455 17:6705297-6705319 TCCAAGGCACTGCCTGTCCTGGG - Intronic
1144695959 17:17303893-17303915 GCTGGGGCGCTGACCGTCCAAGG - Intronic
1145248724 17:21285767-21285789 GCCAGGGTGCTGGCTGTGCAAGG + Intronic
1145286788 17:21512064-21512086 GCCCGGACGCTGACTGGCGTGGG + Intergenic
1152224870 17:79088052-79088074 GCCAGCCCGGGGACTGTCCTGGG + Intronic
1153805157 18:8704844-8704866 GCGAGGGAGGTGACTGGCCTCGG + Intergenic
1154356819 18:13627844-13627866 GCCAGAGGGCAGACGGTCCTGGG + Intronic
1160027198 18:75228262-75228284 GCCTGGGCTCTGACTGCCCTTGG - Intronic
1160418702 18:78729356-78729378 GCCATGGCGCTGGCTGGCTTTGG + Intergenic
1161854240 19:6754384-6754406 GCCGGGGCGCTGGCGGTGCTGGG - Exonic
1162203544 19:9038637-9038659 GACAGAGAGCTGACTGTACTTGG + Intergenic
1163447830 19:17357926-17357948 GCCGAGGCCCTGACAGTCCTGGG + Intronic
1165956059 19:39502881-39502903 GCCTGCGCGCTGAATGTCCCGGG - Exonic
1166999932 19:46739693-46739715 GCCTGGGCTCTGGCTGTTCTGGG - Intronic
1167488237 19:49775978-49776000 GCCAGGGAGCTGCCTTACCTTGG - Intronic
1168129091 19:54305985-54306007 GCCAGGGCCCTTAGTGTCCTCGG - Intergenic
1168288535 19:55346183-55346205 GCCAGGGCGCTGAGTGGGCTTGG + Intronic
1168310945 19:55460569-55460591 GCCAGGACAGTGACTGCCCTTGG + Intronic
928423724 2:31160717-31160739 CCCAGGGTGCTGACTCTCTTGGG - Intergenic
929536118 2:42785067-42785089 GCCAGGGTGCTGTGTGCCCTTGG + Intronic
931455803 2:62409014-62409036 GTCAGGGAGGTGACTGGCCTTGG + Intergenic
932281995 2:70501420-70501442 CCAAGGGCAATGACTGTCCTTGG + Intronic
932411375 2:71549878-71549900 GCCAGTGCCCTGTCTGTGCTGGG + Intronic
946543383 2:220710651-220710673 GGCTGGACTCTGACTGTCCTAGG + Intergenic
946696055 2:222360352-222360374 GCCAGGGAGCTGGCTGATCTAGG - Intergenic
948193946 2:236081088-236081110 GGCAGGGCTGTGACTGTCATGGG - Intronic
948772631 2:240259307-240259329 GCCAGGCTGCTGTCTGCCCTTGG - Intergenic
1169203997 20:3730062-3730084 GCCAAGGCGTGGACTGCCCTTGG - Intergenic
1172010521 20:31843508-31843530 GCATGGGCTGTGACTGTCCTAGG - Intergenic
1174183775 20:48691177-48691199 GCGAGGGCCCTGCCTGTGCTGGG - Intronic
1174305467 20:49611464-49611486 GCCATGGCTCTGACTGCCGTGGG - Intergenic
1174398095 20:50260385-50260407 GCATGGCCGCTGTCTGTCCTGGG + Intergenic
1175879203 20:62247011-62247033 GCCAGGTCGCCGACTGCTCTGGG + Intronic
1176086603 20:63298065-63298087 GCCACCACACTGACTGTCCTCGG - Intronic
1176242523 20:64081645-64081667 GTCAGGGCGCAGAGGGTCCTGGG - Intronic
1179049359 21:37875468-37875490 GCCAGGGCGCTAATCTTCCTGGG + Intronic
1179261058 21:39758356-39758378 ACCAGGGCCATCACTGTCCTGGG + Intronic
1179879886 21:44289037-44289059 ACCAGGGCCCTGGCTGTGCTTGG - Intronic
1180064355 21:45405202-45405224 CCCGCGGCGCTGACGGTCCTGGG + Intronic
1180469527 22:15642563-15642585 GCCAGGGCACTGGCTGTCTCCGG + Intergenic
1184593966 22:45503182-45503204 GCCTCGGCGCTGACAGTCCGGGG - Intronic
1185029867 22:48436564-48436586 CCCAGGGTTCTGACTGTCCCAGG - Intergenic
1185281959 22:49976033-49976055 GCCAGGGCGGGGACAGGCCTTGG + Intergenic
1185333911 22:50263116-50263138 GCAAGGGCACAGACTGTCCCTGG + Intergenic
949936691 3:9121420-9121442 CCCAGGGCACTGACTGGCCTCGG - Intronic
950450341 3:13061664-13061686 GCCAGGGATCTGGCTGCCCTGGG + Intronic
951161303 3:19426102-19426124 GCCAGGGCTCTGGCTATCCCAGG - Intronic
951851902 3:27151007-27151029 GCCAGAGCTCAGACTCTCCTTGG - Intronic
954407620 3:50354251-50354273 GCCAGGGCCCGGAGTGGCCTGGG - Intronic
961512387 3:127410997-127411019 AGCAAGGCTCTGACTGTCCTCGG + Intergenic
961604301 3:128082428-128082450 GCGAGGGCCCTGGCTGTGCTGGG + Intronic
967681660 3:192370783-192370805 GCCAGAGGACTGACTGTGCTTGG + Intronic
968725728 4:2247045-2247067 CCCAGGGAGCGGGCTGTCCTCGG + Intergenic
968741603 4:2334290-2334312 GCCAGGCCGCTCACTCCCCTAGG - Intronic
968819342 4:2837813-2837835 GCCAGGAGGTTGCCTGTCCTTGG + Exonic
968912281 4:3482472-3482494 GCCAGGCCTCTGACGGTCTTGGG + Intronic
969054071 4:4390758-4390780 GCCAGGGCTGTGAGTGTCCAGGG + Intronic
969205045 4:5637340-5637362 GACATGAGGCTGACTGTCCTCGG + Intronic
969449229 4:7263681-7263703 GCAAGGCTGCTGACTCTCCTGGG + Intronic
969610003 4:8222247-8222269 GCCTAGGAGCTCACTGTCCTAGG + Intronic
970594085 4:17584114-17584136 GCCAGGGCCCCCACTGTGCTTGG - Intronic
973037505 4:45424269-45424291 GTCAGGGCTCAGACTCTCCTTGG + Intergenic
973717866 4:53695019-53695041 GCCAGGGATCTGAATGTCCTGGG + Intronic
975746772 4:77482561-77482583 ACCAGAGCACAGACTGTCCTTGG + Intergenic
979300515 4:119081202-119081224 CCCAGGGAGCTGACAGTTCTAGG + Intergenic
980989758 4:139729093-139729115 GCCAGGCGGCTGACTGACCTTGG + Intronic
981847381 4:149184962-149184984 GCCAGGGGGCTGAGTGTGCTAGG + Intergenic
984869088 4:184311055-184311077 GCCAGGGCAATGCCTGTCCCTGG - Intergenic
985517519 5:354503-354525 GCCTGTGCCCTGTCTGTCCTTGG + Intronic
990603718 5:57386311-57386333 GCCAGGGAGCAGAGAGTCCTGGG + Intergenic
991454579 5:66788758-66788780 GCGAGGGCGCCGACTGGCCCAGG - Exonic
995462545 5:112419229-112419251 TCCCGGGCGCTGACTCTCCCGGG - Exonic
997248201 5:132369636-132369658 GCCCGGGCGGGGCCTGTCCTGGG - Intergenic
998443597 5:142181634-142181656 GGCAGGTAGCTGACTGTGCTAGG + Intergenic
999973895 5:156891890-156891912 GCCTGGGCCCTGACTGTAGTAGG + Intergenic
1001529025 5:172449317-172449339 ACCACGGAGCTGACTGACCTTGG - Intronic
1003607021 6:7571543-7571565 GCCAGGGAGCTGAATGACCAGGG - Exonic
1005455535 6:26016564-26016586 GCTAGCGAGCTGTCTGTCCTTGG - Intergenic
1005482822 6:26270998-26271020 GCGAGCGAGCTGAATGTCCTTGG + Exonic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006937990 6:37731851-37731873 GCCAGGGGATAGACTGTCCTGGG + Intergenic
1007327227 6:41072250-41072272 GCGAGGACGCAGTCTGTCCTGGG + Intronic
1007421381 6:41721915-41721937 GGCAGGGAGCTCACTCTCCTAGG + Intronic
1012506258 6:99949796-99949818 ACCAGCCAGCTGACTGTCCTTGG + Intronic
1018840663 6:167514259-167514281 GCCTGGGAGCTGACAGGCCTGGG + Intergenic
1018864664 6:167737289-167737311 GCCAGGGCGCCGCCTGGCCTGGG + Intergenic
1019604165 7:1900240-1900262 GCAAGGGCGCTGCCTGCCATGGG + Intronic
1022625676 7:32033564-32033586 GTCAGGAAGCTGACTGTGCTCGG - Intronic
1023887261 7:44368080-44368102 GCCAGGGCACTGATTGCCCAGGG - Intergenic
1024229349 7:47352586-47352608 GCCAGGGCGCTGGCTGTTCCTGG + Intronic
1026957826 7:74389002-74389024 GGCAGGGCGCTGATTCTCCCAGG - Intronic
1029060981 7:97797724-97797746 TCCTGGGAGCTGGCTGTCCTGGG - Intergenic
1030874250 7:114793638-114793660 CACAGGGATCTGACTGTCCTTGG + Intergenic
1033444111 7:141405268-141405290 GCCAGGTGGCTGGCTGTCTTTGG - Intronic
1033732893 7:144195837-144195859 GCCAGGCCGCGGGCTGTCCCAGG + Intergenic
1033743745 7:144294417-144294439 GCCAGGCCGCGGGCTGTCCCAGG + Intergenic
1033750156 7:144355180-144355202 GCCAGGCCGCGGGCTGTCCCAGG - Intergenic
1035423073 7:158745574-158745596 CCCAGAGCACTGCCTGTCCTGGG - Intronic
1035730875 8:1852974-1852996 GCCAGAGGGCAGCCTGTCCTGGG + Intronic
1036175926 8:6538536-6538558 ACCTGGGCGCGCACTGTCCTTGG + Intronic
1037888336 8:22606970-22606992 TCCAGGGCACTGCCTGGCCTGGG - Exonic
1040076149 8:43233405-43233427 ACCAGTGTGCTGTCTGTCCTAGG + Intergenic
1041647124 8:60264383-60264405 GCAAAGGCGCTGACAGTCCAGGG + Intronic
1048337520 8:133514283-133514305 GCCAGGGAGCTTGCTGTACTGGG - Intronic
1049200624 8:141338617-141338639 CCCAAGGCCCTGAGTGTCCTAGG + Intergenic
1053003775 9:34591459-34591481 CCCAGGGGGCTGACCGGCCTCGG + Intergenic
1054743074 9:68828104-68828126 ACCAGGGCCTTGACTGTCATGGG + Intronic
1060551814 9:124489189-124489211 GCCAGGGCTCTGTCTGTCCTTGG - Intronic
1062274944 9:135726163-135726185 GCCAGGGCGCTGTCTGGGCTGGG + Intronic
1062574324 9:137199492-137199514 GCGAGGGCGGTGGCTGTCCTGGG + Exonic
1192088990 X:68132847-68132869 GCCAGGTCGCTGACGGGCCAGGG - Intronic
1195138229 X:101931974-101931996 GCCAGCGGGGTGACTGTGCTCGG + Intronic
1197404319 X:126030352-126030374 CCTAGGGCGATGGCTGTCCTTGG + Intergenic