ID: 1135659187

View in Genome Browser
Species Human (GRCh38)
Location 16:24279738-24279760
Sequence TACCTTTACATGCAACAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 164}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135659187_1135659189 6 Left 1135659187 16:24279738-24279760 CCTGACTGTTGCATGTAAAGGTA 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1135659189 16:24279767-24279789 AATGAGCTCAAGGCACATCTAGG 0: 1
1: 0
2: 0
3: 23
4: 261
1135659187_1135659190 26 Left 1135659187 16:24279738-24279760 CCTGACTGTTGCATGTAAAGGTA 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1135659190 16:24279787-24279809 AGGTTTCTGCCTTTAACCTTTGG 0: 1
1: 0
2: 1
3: 20
4: 190
1135659187_1135659188 -4 Left 1135659187 16:24279738-24279760 CCTGACTGTTGCATGTAAAGGTA 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1135659188 16:24279757-24279779 GGTAAGAGAGAATGAGCTCAAGG 0: 1
1: 0
2: 0
3: 23
4: 284
1135659187_1135659191 30 Left 1135659187 16:24279738-24279760 CCTGACTGTTGCATGTAAAGGTA 0: 1
1: 0
2: 0
3: 13
4: 164
Right 1135659191 16:24279791-24279813 TTCTGCCTTTAACCTTTGGATGG 0: 1
1: 0
2: 2
3: 19
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135659187 Original CRISPR TACCTTTACATGCAACAGTC AGG (reversed) Intronic
906863354 1:49387260-49387282 TAGCTTTACATGCAAAAATGAGG + Intronic
907134135 1:52123075-52123097 TTCCTTAACATGCCACAGTGAGG - Intergenic
908311164 1:62885831-62885853 TTCCTTAACATGGACCAGTCAGG - Intergenic
909129831 1:71720902-71720924 TACCTTTACTTGGAACAATGAGG + Intronic
911700698 1:100949240-100949262 TAGCTTTCCTTGTAACAGTCAGG + Intronic
915010241 1:152678839-152678861 TACCTCTTAATGCAACATTCAGG + Intergenic
917114195 1:171585279-171585301 TAGCTATACATACAACAGTGTGG + Intronic
1063122305 10:3113609-3113631 TACCTTTTCATGCCTCAGTCCGG + Intronic
1064367754 10:14723557-14723579 AGCCTTTCCATGCAACAGTAAGG - Intronic
1066327228 10:34374425-34374447 TTCCTTTTCATACAACAGTAAGG + Intronic
1066800817 10:39187746-39187768 TTCCTTTTCATTCAACAGTTTGG - Intergenic
1070911221 10:80120110-80120132 TACCACTACATGCAACATTATGG - Intergenic
1079653159 11:22956482-22956504 AATCTTTACAACCAACAGTCTGG - Intergenic
1082136831 11:48558809-48558831 TAGTTTTCCATGTAACAGTCAGG + Intergenic
1082147668 11:48689895-48689917 TTTCTTTACATTCAGCAGTCTGG + Intergenic
1082147965 11:48694211-48694233 TTTCTTTTCATGCAGCAGTCTGG + Intergenic
1082148821 11:48706082-48706104 AACCTTTTCATTCAGCAGTCTGG - Intergenic
1082296939 11:50452281-50452303 TATCTTTTCATTCAACAGTTTGG + Intergenic
1082305678 11:50571170-50571192 TTTCTTTTCATGCAGCAGTCTGG - Intergenic
1082307270 11:50595274-50595296 TTTCTTTTCATTCAACAGTCTGG + Intergenic
1082577305 11:54823944-54823966 TTTCTTTACATCCAGCAGTCTGG + Intergenic
1082582036 11:54883097-54883119 TTTCTTTTCATACAACAGTCTGG + Intergenic
1082582138 11:54884809-54884831 TTCCTTTTCATTCATCAGTCTGG + Intergenic
1082594335 11:55056832-55056854 TTTCTTTACATTCAGCAGTCTGG - Intergenic
1082614198 11:55338706-55338728 TAGTTTTCCATGTAACAGTCAGG + Intergenic
1082660857 11:55909434-55909456 TACCACTACACGCAACAGTATGG - Intergenic
1087147357 11:94825353-94825375 CACCTTCACGTGCAACACTCAGG - Intronic
1087427211 11:98005788-98005810 TACTGTTACATGCAACAATGCGG - Intergenic
1088722275 11:112604549-112604571 TTCCTATACATGCTACAGTCTGG + Intergenic
1095075281 12:37913525-37913547 TTCCTTTTCATTCAACAGTTTGG - Intergenic
1098864627 12:75747599-75747621 TACTGATACATGCAACAATCTGG - Intergenic
1100766035 12:97866474-97866496 TAGTTTTACATCTAACAGTCAGG - Intergenic
1102117915 12:110417506-110417528 TACCTTTACTTTCACCAGTTTGG + Intergenic
1111614754 13:90648826-90648848 TACCTTTCCATGCAGCTTTCTGG + Intergenic
1114927680 14:27423848-27423870 TAAGTTTACATGCAATAGTCTGG - Intergenic
1116924916 14:50624732-50624754 TTCCTTTGCATCCAACAGCCTGG - Intronic
1119722265 14:76899219-76899241 TCCCTTTACCTGCCACAATCTGG - Intergenic
1120390135 14:83896282-83896304 TACCCTTGCATTCAACATTCTGG - Intergenic
1124397129 15:29312129-29312151 TAACTTTTCCTGCTACAGTCTGG + Intronic
1125806803 15:42500192-42500214 TTCCTTTATCTGCAACACTCTGG + Intronic
1127092468 15:55480603-55480625 TACCTTTAACTGCAACCATCAGG + Intronic
1130374820 15:83319549-83319571 TACAATTACATGCAACAATTTGG - Intergenic
1133363746 16:5194662-5194684 TTCCTCTTCATGCAGCAGTCAGG + Intergenic
1134629090 16:15744141-15744163 TATTGATACATGCAACAGTCTGG + Intronic
1135659187 16:24279738-24279760 TACCTTTACATGCAACAGTCAGG - Intronic
1138369290 16:56512554-56512576 TACTTTTATATGCAACAATATGG + Intronic
1138583112 16:57954419-57954441 TAGCTTTACATGGAAAAATCTGG - Intronic
1140305009 16:73794720-73794742 TACCTTTTCCTGCAACAGATGGG + Intergenic
1140581324 16:76234528-76234550 TATATTTACATGCAACCCTCAGG + Intergenic
1141881146 16:86860388-86860410 TCCCTTTACACCCAGCAGTCGGG - Intergenic
1146774224 17:35597734-35597756 AACCTTTGCATTCAAGAGTCAGG + Intronic
1154073689 18:11178482-11178504 TACTTTTTCTAGCAACAGTCTGG + Intergenic
1158752554 18:60280337-60280359 TACAGTTACATGCAACAGTATGG - Intergenic
1162450534 19:10751630-10751652 GCCCTTTGCATGCAGCAGTCTGG + Intronic
1162507931 19:11098355-11098377 TACCTTTATATGAAAGATTCTGG - Intronic
1164359498 19:27488158-27488180 TACCATTTCATTCAACAGTTTGG + Intergenic
1166583513 19:43924928-43924950 ATGCTTTACATGAAACAGTCAGG + Intronic
926921906 2:17947236-17947258 TAGCTCTACAGGCAACAGTGGGG + Intronic
928499722 2:31877826-31877848 TTCCTTTACATGTTACAGTTAGG + Intronic
929985884 2:46731891-46731913 TACCTTCACATGCAAACTTCAGG - Intronic
930997680 2:57741014-57741036 CACCTTTAAATGAAACAGTGTGG - Intergenic
936615665 2:114045210-114045232 TGACTTTAAATGCAACAGGCAGG + Intergenic
938897053 2:135762857-135762879 TACCTTTATTTGCACCACTCTGG + Intronic
940702024 2:157057050-157057072 TACTTTTTCATGCAACAGTTTGG - Intergenic
941498998 2:166245169-166245191 TGCCTATACATGCAAAAGTTTGG + Intronic
942479111 2:176363469-176363491 AACTGTTACTTGCAACAGTCTGG + Intergenic
946571595 2:221029746-221029768 TACCTTTGCCTGACACAGTCAGG - Intergenic
1169132151 20:3171936-3171958 TACCTGTACATGTAACTGTCAGG - Intronic
1173884187 20:46442294-46442316 TACTGATACATGCAACAGCCTGG - Intergenic
1175345018 20:58266619-58266641 TACCTTTGCATCCCACTGTCTGG + Intergenic
1181087498 22:20448208-20448230 AACCTGTACATGCAACAACCTGG - Intronic
949748252 3:7320759-7320781 TACTATTATATGCAACAGTAAGG - Intronic
949954206 3:9254280-9254302 TACCAATACATGCTACAGTATGG + Intronic
950943554 3:16920169-16920191 TCCATTTACATGCAACAGTGTGG - Intronic
951859147 3:27231714-27231736 CACCTTTACATGCACAAATCAGG + Intronic
952231985 3:31441342-31441364 TAATTTTACATGCAATAGACAGG - Intergenic
953084359 3:39652467-39652489 CAGCTTTTCATGCATCAGTCTGG - Intergenic
957993985 3:87664833-87664855 TACCTTTAACTGCAAAACTCTGG - Intergenic
958979677 3:100706872-100706894 TATCTTTCCTTGCTACAGTCTGG + Intergenic
961979696 3:131064012-131064034 TACTGATACATGCTACAGTCTGG + Intronic
962191907 3:133319488-133319510 TTCCATTGCATGCAACATTCTGG + Intronic
965098387 3:164264968-164264990 TAGCTTTCCATGTAACATTCAGG + Intergenic
965388824 3:168079261-168079283 TACAACTACATGTAACAGTCTGG + Intronic
966526216 3:180922350-180922372 TCCCTTTACATCCAACAGACTGG - Intronic
971194462 4:24458568-24458590 TACCCTTACATGTACCTGTCTGG + Intergenic
971883350 4:32410274-32410296 TACTTTTCCATCTAACAGTCAGG - Intergenic
976114963 4:81716137-81716159 TAGTTTTCCATGCAACAGTCAGG - Intronic
977222227 4:94351722-94351744 TTTCTTTATATGTAACAGTCGGG + Intergenic
980098512 4:128518252-128518274 TAAATTTACATGAAACAGGCTGG - Intergenic
983921372 4:173349362-173349384 TACTGATACATGCAACAGCCTGG + Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
988580437 5:32464116-32464138 TACTGTTACATGCAACAGCATGG + Intergenic
989899812 5:47154173-47154195 TACCTTTTCATACAGCAGTTTGG + Intergenic
989899981 5:47156893-47156915 TACCTTTTCATACAGCAGTTTGG + Intergenic
989900141 5:47159614-47159636 TACCTTTTCATACAGCAGTTTGG + Intergenic
989900302 5:47162335-47162357 TACCTTTTCATACAGCAGTTTGG + Intergenic
989900464 5:47165055-47165077 TACCTTTTCATACAGCAGTTTGG + Intergenic
989900624 5:47167775-47167797 TACCTTTTCATACAGCAGTTTGG + Intergenic
989900793 5:47170494-47170516 TACCTTTTCATACAGCAGTTTGG + Intergenic
989901123 5:47175936-47175958 TACCTTTTCATACAGCAGTTTGG + Intergenic
989901287 5:47178657-47178679 TACCTTTTCATACAGCAGTTTGG + Intergenic
989901433 5:47181037-47181059 TACCTTTTCATACAGCAGTTTGG + Intergenic
989901599 5:47183758-47183780 TACCTTTTCATACAGCAGTTTGG + Intergenic
989901764 5:47186478-47186500 TACCTTTTCATACAGCAGTTTGG + Intergenic
989901929 5:47189200-47189222 TACCTTTTCATACAGCAGTTTGG + Intergenic
989902093 5:47191920-47191942 TACCTTTTCATACAGCAGTTTGG + Intergenic
989902405 5:47197019-47197041 TACCTTTTCATACAGCAGTTTGG + Intergenic
989902574 5:47199739-47199761 TACCTTTTCATACAGCAGTTTGG + Intergenic
989902736 5:47202458-47202480 TACCTTTTCATACAGCAGTTTGG + Intergenic
989902905 5:47205177-47205199 TACCTTTTCATACAGCAGTTTGG + Intergenic
989903071 5:47207898-47207920 TACCTTTTCATACAGCAGTTTGG + Intergenic
989903293 5:47211634-47211656 TACCTTTTCATACAGCAGTTTGG + Intergenic
989903434 5:47214014-47214036 TACCTTTTCATACAGCAGTTTGG + Intergenic
989903633 5:47217415-47217437 TACCTTTTCATACAGCAGTTTGG + Intergenic
989903796 5:47220135-47220157 TACCTTTTCATACAGCAGTTTGG + Intergenic
989903944 5:47222514-47222536 TACCTTTTCATACAGCAGTTTGG + Intergenic
989904111 5:47225235-47225257 TACCTTTTCATACAGCAGTTTGG + Intergenic
989904289 5:47228122-47228144 TACCTTTTCATACAGCAGTTTGG + Intergenic
989904455 5:47230842-47230864 TACCTTTTCATACAGCAGTTTGG + Intergenic
989904618 5:47233563-47233585 TACCTTTTCATACAGCAGTTTGG + Intergenic
989904780 5:47236282-47236304 TACCTTTTCATACAGCAGTTTGG + Intergenic
989904947 5:47239001-47239023 TACCTTTTCATACAGCAGTTTGG + Intergenic
989905027 5:47240361-47240383 TACCTTTTCATACAGCAGTTTGG + Intergenic
989905191 5:47243080-47243102 TACCTTTGCATACAGCAGTTTGG + Intergenic
989905361 5:47245796-47245818 TACCTTTTCATACAGCAGTTTGG + Intergenic
989905678 5:47250896-47250918 TACCTTTTCATACAGCAGTTTGG + Intergenic
989905846 5:47253615-47253637 TACCTTTTCATACAGCAGTTTGG + Intergenic
989906011 5:47256337-47256359 TACCTTTTCATACAGCAGTTTGG + Intergenic
989906179 5:47259057-47259079 TACCTTTTCATACAGCAGTTTGG + Intergenic
989906343 5:47261777-47261799 TACCTTTTCATACAGCAGTTTGG + Intergenic
989906673 5:47267220-47267242 TACCTTTTCATACAGCAGTTTGG + Intergenic
989906844 5:47269942-47269964 TACCTTTTCATACAGCAGTTTGG + Intergenic
989907172 5:47275381-47275403 TACCTTTTCATACAGCAGTTTGG + Intergenic
989907337 5:47278104-47278126 TACCTTTTCATACAGCAGTTTGG + Intergenic
989907500 5:47280824-47280846 TACCTTTTCATACAGCAGTTTGG + Intergenic
989907829 5:47286263-47286285 TACCTTTTCATACAGCAGTTTGG + Intergenic
989907992 5:47288981-47289003 TACCTTTTCATACAGCAGTTTGG + Intergenic
989908151 5:47291702-47291724 TACCTTTTCATACAGCAGTTTGG + Intergenic
989908316 5:47294422-47294444 TACCTTTTCATACAGCAGTTTGG + Intergenic
991579009 5:68134830-68134852 TACCCATACATGGAACAATCAGG - Intergenic
993452206 5:88086107-88086129 TACCTCTTCATGCAAGATTCTGG + Intergenic
993824014 5:92658752-92658774 TCCATTTACATGGAACATTCAGG - Intergenic
994007521 5:94856836-94856858 AGCCTTTATATGCAACACTCTGG + Intronic
994872566 5:105371320-105371342 TACTGAGACATGCAACAGTCTGG + Intergenic
997843631 5:137265416-137265438 TACCTTTGCAAGCAAAAGCCTGG + Intronic
1001353058 5:170991405-170991427 TACCTTTACAAGCAACAATTGGG - Intronic
1003719825 6:8688976-8688998 TACTGATACATGCCACAGTCTGG - Intergenic
1009063086 6:58420447-58420469 TTTCTTTTCATTCAACAGTCAGG - Intergenic
1009250761 6:61294996-61295018 TTTCTTTTCATTCAACAGTCAGG - Intergenic
1012389893 6:98726542-98726564 TACTTTTACATGCAGCATGCTGG - Intergenic
1015685759 6:135857777-135857799 TACCTCTACATGCAAAAATCTGG + Intronic
1016014039 6:139166207-139166229 AACCTGTACTTGCAACAGTATGG - Intronic
1018227603 6:161644233-161644255 TAACTTTGCACCCAACAGTCTGG - Intronic
1025524571 7:61788518-61788540 TTTCTTTACATTCAGCAGTCTGG - Intergenic
1025547932 7:62200736-62200758 TTTCTTTACATTCAGCAGTCTGG - Intergenic
1025585916 7:62787175-62787197 TTTCTTTTCATACAACAGTCTGG + Intergenic
1025587457 7:62809456-62809478 TCTCTTTTCATTCAACAGTCTGG - Intergenic
1025592881 7:62885223-62885245 TTTCTTTACATGCAGCAGTCTGG + Intergenic
1025595398 7:62917599-62917621 TTTCTTTACATACAGCAGTCTGG + Intergenic
1027838573 7:83278577-83278599 TACAGGTACAGGCAACAGTCAGG - Intergenic
1030361974 7:108604916-108604938 TTCCTTTAAATGAACCAGTCAGG + Intergenic
1030894504 7:115040623-115040645 TGCCTGTACATGCAAGAGACTGG + Intergenic
1033524923 7:142202003-142202025 TTCTTTTACATGCAACAGCATGG + Intronic
1034830201 7:154302429-154302451 TACCTTTCCTTGGAACATTCTGG - Intronic
1036168687 8:6462039-6462061 TGCCTTCACATGCAACAAGCTGG - Intronic
1047561959 8:125995659-125995681 ACACTTTACATGCAACAGACTGG + Intergenic
1048095454 8:131287328-131287350 TACCTTTCCATGCAAACATCAGG + Intergenic
1051149403 9:14064044-14064066 TCCCAGTACATACAACAGTCTGG - Intergenic
1052549331 9:29928164-29928186 AAGCTTTCCATGCAAGAGTCTGG + Intergenic
1186318926 X:8402748-8402770 TATTATTACATGCAACAGTGTGG + Intergenic
1186741544 X:12523426-12523448 TTCCTATAAATGCAACTGTCAGG - Intronic
1189025597 X:37390442-37390464 TACAATTACATGCAACAGTATGG + Intronic
1193027512 X:76860492-76860514 TACCTTAATCTGCAATAGTCTGG - Intergenic
1194353559 X:92853565-92853587 TATTATTACATGCAACAATCGGG - Intergenic
1196996834 X:121393125-121393147 TATATTTACATGCAACTCTCAGG + Intergenic
1200661919 Y:5970638-5970660 TATTATTACATGCAACAATCGGG - Intergenic
1201543287 Y:15132399-15132421 TACTTTTTCTTCCAACAGTCAGG - Intergenic
1201987111 Y:19980603-19980625 TGCCTTTAACTGCAACAGCCAGG - Intergenic