ID: 1135660965

View in Genome Browser
Species Human (GRCh38)
Location 16:24296206-24296228
Sequence GGTGGGAGTCACCCTGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 497}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135660965_1135660970 -8 Left 1135660965 16:24296206-24296228 CCACCCTCAGGGTGACTCCCACC 0: 1
1: 0
2: 2
3: 33
4: 497
Right 1135660970 16:24296221-24296243 CTCCCACCTAGGGATTTACATGG 0: 1
1: 0
2: 0
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135660965 Original CRISPR GGTGGGAGTCACCCTGAGGG TGG (reversed) Intronic
900477551 1:2882979-2883001 GGTGGGTCTCAGCCTGAGGCCGG + Intergenic
900686879 1:3954378-3954400 GATGGGAGTGACCCAGAGAGGGG - Intergenic
901252382 1:7790455-7790477 GGTGGGAGGAACCCGGAGGGAGG - Intronic
901754688 1:11434449-11434471 GGTGGGCCTCCCCCTGAGGGAGG + Intergenic
902396575 1:16135177-16135199 TGTTGGAGTCTCCCTGTGGGTGG + Exonic
902548631 1:17206173-17206195 GGTGGGAGTCTCCCTCAAAGAGG + Intronic
902916737 1:19644253-19644275 GGAGGGAGCCACCCTGACGTCGG + Intronic
904093508 1:27960716-27960738 GGAGGTAGTCACCCTGAGACAGG + Intronic
904352892 1:29920490-29920512 GGGTGGAGTCACCCTGCTGGGGG - Intergenic
904386306 1:30144618-30144640 TGTGGGAGGGACCCAGAGGGAGG - Intergenic
904877120 1:33663672-33663694 GGTGGGAGTCTCCCTGTGTGGGG + Intronic
905205775 1:36342118-36342140 GGTGGGAGTGGCGCTGAGGGTGG + Intronic
905475451 1:38223918-38223940 TGTGGGAGGGACCCTGTGGGAGG + Intergenic
905921147 1:41719744-41719766 GGTTGAAGTGACCCTGAGGAAGG - Intronic
906124590 1:43419944-43419966 GGTGAGAGGCACACTGAGGTGGG + Exonic
906758862 1:48352272-48352294 TGTGGGAGGGACCCTGTGGGAGG - Intronic
907482965 1:54757420-54757442 CCTGGGTGTTACCCTGAGGGGGG - Exonic
909164121 1:72195971-72195993 GGAGTGAGTGAACCTGAGGGAGG - Intronic
910333696 1:86104958-86104980 GGTGGGGGTCACACTGGTGGTGG + Intronic
911407971 1:97465474-97465496 TGTGGGAGGGACCCTGTGGGAGG + Intronic
911681167 1:100717539-100717561 TGTGGGAGGGACCCTGTGGGAGG - Intergenic
912755916 1:112324924-112324946 GGTGGGGGGCAGCCTGGGGGTGG - Intergenic
912975840 1:114329505-114329527 GGAGGGAGTGACCCTCAGGGAGG + Intergenic
913484798 1:119324371-119324393 AGTGAGAGTCACACTAAGGGAGG + Intergenic
913494667 1:119417529-119417551 GGTGGGTGTCAGCCCGAGAGTGG - Intronic
913500578 1:119469269-119469291 GGTGGGTGACAGCCTGAGAGTGG - Intergenic
915828452 1:159103065-159103087 CGTGGGAGGCACCCAGTGGGAGG + Intronic
916272119 1:162954349-162954371 GGTGGGAGGGACCCGGAGGGAGG + Intergenic
917166377 1:172117387-172117409 GGTGGGAGGGACCCAGGGGGAGG + Intronic
917752722 1:178068272-178068294 GGAGGTGGTCACCCTGAGGGTGG + Intergenic
918931555 1:190861654-190861676 TGTGGGAGTGACCCGGTGGGAGG - Intergenic
920594405 1:207254806-207254828 GGTGGGAGGGACCCAGTGGGAGG - Intergenic
920598071 1:207292628-207292650 GGTGGGAGGGACCCAGTGGGGGG + Intergenic
921019523 1:211223534-211223556 GGAGGGACATACCCTGAGGGAGG - Intergenic
921254392 1:213325972-213325994 GGTGGGAGAAACCCTGAAGAGGG - Intergenic
922751751 1:228073378-228073400 GGTGGGTGGCCCCGTGAGGGAGG - Intergenic
923920733 1:238561766-238561788 GGTGGGAGGAACCCGGTGGGAGG + Intergenic
924247676 1:242100617-242100639 GGTGGGGGTCACCCAGGGAGTGG - Intronic
924785829 1:247198459-247198481 TGTGGGAGGGACCCAGAGGGAGG + Intergenic
1063693114 10:8306032-8306054 GGTGGCAGTTCCCCTGAGGATGG - Intergenic
1065467277 10:26037904-26037926 GGGGGGAGGGACCCTGTGGGAGG - Intronic
1066335781 10:34476775-34476797 GTTGGGAGTTACCCTGAGCATGG - Intronic
1066482687 10:35812341-35812363 CGTGGGAGGGACCCTGTGGGTGG + Intergenic
1067202514 10:44185560-44185582 TGTGCGAGTCACCCTCAGGGGGG - Intergenic
1068399573 10:56510159-56510181 GGTGGGAGGAACCCAGTGGGAGG + Intergenic
1069058990 10:63873675-63873697 TGTGGGAGGGACCCAGAGGGAGG - Intergenic
1069332589 10:67310800-67310822 GGTGGGAGGGACCCGGTGGGAGG - Intronic
1069625780 10:69866932-69866954 GCTGGGAATCACCGGGAGGGTGG + Intronic
1069773241 10:70912498-70912520 GGTGGGAGGGACCCGGTGGGAGG - Intergenic
1069929466 10:71872829-71872851 TCTGGCAGTCACCCTGAGTGGGG - Intergenic
1070351211 10:75593838-75593860 GGTGGCCGTCAGCCTGAGAGAGG + Intronic
1071280653 10:84099618-84099640 GGTGGGAGACATGGTGAGGGAGG - Intergenic
1072781849 10:98256913-98256935 GGTGGGCGTATCCCTGAGGAGGG - Exonic
1074278995 10:112033310-112033332 TGTGGGAGGCACCCAGTGGGAGG - Intergenic
1074539310 10:114351559-114351581 GGTTGGAGTCAACCGGGGGGAGG + Intronic
1075516266 10:123110974-123110996 GGTGGGAGGGACCCAGTGGGAGG + Intergenic
1076116279 10:127903936-127903958 TGTGGGAGGGACCCTGTGGGAGG - Intergenic
1076487654 10:130835213-130835235 GGTGGGGTGCTCCCTGAGGGTGG - Intergenic
1076487667 10:130835249-130835271 GGTGGGGTGCACCCTGTGGGTGG - Intergenic
1076487726 10:130835446-130835468 GGTGGGGTGCACCCTGTGGGAGG - Intergenic
1076487740 10:130835482-130835504 GGTGGGGTGCACCCTGTGGGAGG - Intergenic
1076618606 10:131772532-131772554 GGAGGGCGTCAGCCTGGGGGTGG + Intergenic
1076772926 10:132676902-132676924 GGTGGGGGTCACCATGTGGATGG - Intronic
1076791079 10:132777045-132777067 GGTGCCAGTAGCCCTGAGGGCGG - Intronic
1077920799 11:6640583-6640605 GGTGGGGCTCACCCTGAGCTGGG - Exonic
1077961118 11:7077809-7077831 TGTGGGAGGCACCCAGTGGGAGG - Intergenic
1078199999 11:9172492-9172514 GGTGGGAGGGACCCAGTGGGAGG + Intronic
1080203313 11:29699399-29699421 AGTGGGAGTCAGGCTGTGGGTGG + Intergenic
1080582120 11:33652302-33652324 GGTAGAAGACACCCTGGGGGAGG + Intronic
1080778490 11:35408363-35408385 TGTGGGAGGGACCCAGAGGGAGG + Intronic
1081421242 11:42876231-42876253 GGAGGGCCACACCCTGAGGGAGG - Intergenic
1081581653 11:44356355-44356377 GGTTGAAGAGACCCTGAGGGAGG - Intergenic
1083079923 11:60080677-60080699 CGTGGGAGGGACCCTGTGGGAGG + Intergenic
1083607730 11:63988773-63988795 GGTGGGAAGCACCCTGGGGGTGG + Intronic
1083694418 11:64433164-64433186 AGAGGGAGCCAGCCTGAGGGTGG - Intergenic
1083724862 11:64622816-64622838 GGTGGTAGTCTCCATGATGGTGG + Exonic
1083746436 11:64739604-64739626 GTTGGGAGACACCGGGAGGGAGG + Intronic
1083854177 11:65384256-65384278 GGTGGGTGGCACCATGGGGGAGG - Intergenic
1084221283 11:67681343-67681365 GGTGGGAGTGACCTGGTGGGAGG - Intergenic
1084564083 11:69919857-69919879 GGAAGGACTCACCCTGAGGAGGG - Intergenic
1085002724 11:73055196-73055218 TGTAGGAGGCACCCTGTGGGAGG - Intronic
1085038726 11:73314538-73314560 GGAGGGAGTCAGCCTGCAGGGGG + Intronic
1085861963 11:80245080-80245102 GGGGGCAGTCACCCTCATGGTGG + Intergenic
1086180282 11:83942923-83942945 TGTGGGAGGGACCCTGTGGGAGG + Intronic
1086231857 11:84578886-84578908 TGTGGGAGGCACCCAGGGGGAGG + Intronic
1086758902 11:90602700-90602722 TGTGGGAGGGACCCAGAGGGAGG + Intergenic
1087997079 11:104822429-104822451 TGTGGGAGGGACCCAGAGGGAGG + Intergenic
1088427095 11:109715906-109715928 GGTGGGAGGAACCCAGTGGGAGG - Intergenic
1089702252 11:120252516-120252538 GGTGGGAGCCACTCTGAGAAGGG - Intronic
1092003087 12:5047158-5047180 GCTGAGAGCCACCCTGAGGAGGG - Intergenic
1092954973 12:13541373-13541395 GGTGGGAGCCAGTCTGAAGGAGG + Exonic
1093239816 12:16656471-16656493 TGTGGGAGGCACCCAGTGGGAGG - Intergenic
1094837276 12:34328044-34328066 GGTGGGAGTCACACGCAAGGGGG - Intergenic
1095343792 12:41124886-41124908 TGTGAGAGGGACCCTGAGGGAGG + Intergenic
1095526316 12:43129824-43129846 GGTGGGAGCCTTCCTGATGGTGG - Intergenic
1096626468 12:52898965-52898987 GGTGGGGAGGACCCTGAGGGAGG - Intronic
1096969380 12:55653247-55653269 GGTGGGAGGGACCCCGTGGGAGG - Intergenic
1098371959 12:69768956-69768978 TGTGGGAGGGACCCTGTGGGAGG + Intronic
1098578605 12:72072179-72072201 GGTGGGAGGGACCCAGTGGGAGG - Intronic
1099115544 12:78619758-78619780 GGAAGGAGTCACTCTAAGGGTGG - Intergenic
1099907701 12:88791502-88791524 GGTGGGAGGCACCAGGTGGGAGG + Intergenic
1100657842 12:96666667-96666689 GGTGGGAGGGACCCAGTGGGAGG - Intronic
1101973845 12:109337653-109337675 GATGGGAGGGACCCTGTGGGAGG - Intergenic
1102005556 12:109587239-109587261 TGTGAGAGTCACCATGATGGAGG + Intronic
1102249154 12:111374250-111374272 TGTGGGAGGGACCCTGGGGGAGG - Intergenic
1103270416 12:119668600-119668622 TGAGAAAGTCACCCTGAGGGAGG + Intronic
1103403370 12:120658447-120658469 GGTAGGAGTCACCCATAGGGAGG - Intronic
1104937977 12:132376684-132376706 TGTGGCAGACACCCGGAGGGAGG + Intergenic
1105831343 13:24165261-24165283 GGTGGGAGACAGTCTGAGGCAGG - Intronic
1106124118 13:26886116-26886138 TGTGGGAGGGACCCAGAGGGAGG - Intergenic
1106159953 13:27192509-27192531 TGTGGGAGGGACCCTGTGGGAGG + Intergenic
1107183071 13:37484891-37484913 GGTGGGAGGGACCCGGTGGGAGG - Intergenic
1107678105 13:42817999-42818021 TGTGGGAGTGACCCAGTGGGAGG - Intergenic
1109714706 13:66206199-66206221 TGTGGGAGGGACCCAGAGGGAGG - Intergenic
1109862878 13:68224136-68224158 TGTGGGAGGGACCCGGAGGGAGG - Intergenic
1111176842 13:84606379-84606401 GGTGGGACGCAGTCTGAGGGGGG + Intergenic
1111527205 13:89488319-89488341 TGTGGGAGTGACCCAGATGGAGG + Intergenic
1112133304 13:96548098-96548120 GGTGGGAGGCACGGTGTGGGGGG - Intronic
1114847949 14:26346763-26346785 TGTGGGAGGCACCCAGTGGGAGG - Intergenic
1115456328 14:33607979-33608001 GGTGGGAGGGACCCAGTGGGAGG - Intronic
1116339901 14:43709112-43709134 GGTGGGAGGGACCCGGTGGGAGG + Intergenic
1116720941 14:48494912-48494934 TGTGGGAGAGACCCTGTGGGAGG + Intergenic
1116951593 14:50883255-50883277 GGTGGGAGCCAGCATGTGGGAGG - Intronic
1118048702 14:62003039-62003061 GGTGGGAGGGACCCAAAGGGAGG - Intronic
1118729988 14:68659303-68659325 GGAGGGAGTCACGCTGGGGAAGG + Intronic
1118938499 14:70310784-70310806 GGTGGCAGTGAGGCTGAGGGAGG - Intergenic
1119144838 14:72302835-72302857 GGTGGGAGGGACCCAGTGGGAGG + Intronic
1119207835 14:72808019-72808041 GCTGGGGGTGACCCTCAGGGAGG - Intronic
1119216207 14:72871158-72871180 TGTGGGAGGTACCCAGAGGGAGG - Intronic
1120280956 14:82437292-82437314 GGTGGGAGGGACCCAGTGGGAGG + Intergenic
1120670810 14:87360430-87360452 GGTGGCAGTGAGGCTGAGGGAGG - Intergenic
1120701494 14:87703937-87703959 CTTGGGAGTCACCCAGATGGAGG + Intergenic
1121199982 14:92108669-92108691 GGTGGGAATCACCGTGTTGGTGG + Intergenic
1121762267 14:96455842-96455864 TGTGGCAGTCACCCTGGTGGTGG + Intronic
1122097287 14:99381219-99381241 GGTGGGAGGAACCAGGAGGGTGG - Intergenic
1122308530 14:100780400-100780422 AATGGGGGTCACCCTCAGGGTGG - Intergenic
1122384031 14:101331783-101331805 GGTGGCATCCACCCTGAGTGCGG + Intergenic
1122693552 14:103542423-103542445 CGTGGGAGTCTCCTTGAGGCTGG + Intergenic
1123202575 14:106680554-106680576 AGTGTCAGTAACCCTGAGGGAGG - Intergenic
1124629696 15:31329260-31329282 GGTGGGTGTGGCCCTGGGGGAGG + Intronic
1124695975 15:31864592-31864614 TGTGGGAGGGACCCAGAGGGAGG - Intronic
1126939937 15:53756147-53756169 GGTGGGAGGGACCCAGTGGGAGG + Intronic
1127619181 15:60716708-60716730 GGTGGGACTCTCTCTGAGGAGGG - Intronic
1128008169 15:64265341-64265363 AGTGGGAGAGACCCAGAGGGAGG + Intronic
1128688702 15:69706956-69706978 TGTGGGAGTCACCCAGGGGGAGG - Intergenic
1128765919 15:70251071-70251093 TGTGGGGGCCAGCCTGAGGGAGG - Intergenic
1129091071 15:73151719-73151741 TGTGGGAGAGACCCTGTGGGAGG - Intronic
1129494945 15:75970550-75970572 GTTGGGAATGACCCTCAGGGAGG + Intronic
1130125426 15:81089899-81089921 GGTGAGAGACACCCTCAAGGAGG + Intronic
1130486143 15:84399357-84399379 GGTGGGAGCCACCCCGATGCAGG + Intergenic
1131901648 15:97094446-97094468 GGTGGGAGGGACCCTGTGGGAGG + Intergenic
1132709820 16:1261450-1261472 CGCCGGAGTCACCCTGAGGAAGG + Intergenic
1133223091 16:4327679-4327701 GGCGGGGGTCACCCGGAGGGTGG - Intronic
1133275818 16:4637857-4637879 GGTGGGGGCCACCCTGAGGGTGG + Intronic
1133702723 16:8324319-8324341 TGTGGGAGGGACCCAGAGGGAGG + Intergenic
1134110207 16:11510610-11510632 GGAGGGTGTCAGCCTCAGGGTGG + Intronic
1134286745 16:12868368-12868390 AATGGGAGTCACCTAGAGGGAGG + Intergenic
1134510498 16:14842693-14842715 GGTGGTGGTCACCTGGAGGGTGG - Intronic
1134698138 16:16241181-16241203 GGTGGTGGTCACCTGGAGGGTGG - Intronic
1134819753 16:17237372-17237394 GGCAGGAGTCACCCCAAGGGAGG - Intronic
1134973699 16:18553496-18553518 GGTGGTGGTCACCTGGAGGGTGG + Intronic
1135660965 16:24296206-24296228 GGTGGGAGTCACCCTGAGGGTGG - Intronic
1136663119 16:31783102-31783124 TGTGGGAGTGACCCAGTGGGAGG - Intronic
1136908899 16:34129838-34129860 GGTGGCAGTGAGCCTGGGGGAGG - Intergenic
1137227916 16:46532649-46532671 CGTGGGAGGGACCCTGTGGGAGG + Intergenic
1140462190 16:75148754-75148776 GGCGGCAGTGACCCTCAGGGCGG + Intronic
1140697288 16:77547649-77547671 GGTGGGCCTGTCCCTGAGGGTGG - Intergenic
1140805245 16:78526805-78526827 GGTGGCAGTGATCTTGAGGGGGG + Intronic
1140879305 16:79183167-79183189 GGTGGCAGGCACCATGAGGCAGG + Intronic
1141414890 16:83863075-83863097 CGTGGGAGGGACCCTGTGGGAGG + Intergenic
1141443516 16:84044038-84044060 GCTGGGATTCACCCTGAGTCAGG + Intergenic
1141663528 16:85454075-85454097 GGAGGGAGCCACCCTGAACGTGG + Intergenic
1141664264 16:85457762-85457784 GGAGGGAGCCACCCTGAATGTGG + Intergenic
1142486108 17:248503-248525 GGTGAGAGTCACCCTAAAGCTGG + Intronic
1142747717 17:1968284-1968306 GGTGGTAGTCACTGAGAGGGTGG - Intronic
1142985019 17:3690356-3690378 GGTGGGTCCCAGCCTGAGGGTGG - Intronic
1143760892 17:9103384-9103406 GGTGGGAGGGACCCAGTGGGAGG + Intronic
1146283305 17:31559076-31559098 GGCGGGAGAGACCCTGACGGCGG - Intergenic
1146702059 17:34969700-34969722 TGTGGGAGGCACCCAGTGGGAGG + Intronic
1147313330 17:39607314-39607336 GGAGGGAGTCAGCTTGAAGGGGG - Intronic
1147562667 17:41518712-41518734 GGGGGGAGTCTCTCTGGGGGAGG - Exonic
1147967940 17:44203936-44203958 TGTGGGAGCCACCCTGTGGGAGG + Intergenic
1148261972 17:46192621-46192643 GCTGGGAGTCGCCCCAAGGGCGG - Exonic
1149652522 17:58284898-58284920 GCTGGGCTTCACCCTGGGGGTGG - Intergenic
1150329843 17:64285901-64285923 GTTGGGAGTGACCCAGTGGGAGG + Intergenic
1150964869 17:69956472-69956494 TGTGGGAGGCACCCGGTGGGAGG + Intergenic
1151784663 17:76269682-76269704 GGTGGCTGTCACCCTTAGTGTGG + Intronic
1152337138 17:79705312-79705334 GGTGGGAGGAACACTGAGGCTGG + Intergenic
1152611389 17:81316488-81316510 GGTTGGAGGGACCCTGAGGCAGG - Intronic
1152861786 17:82700686-82700708 GCTGGGTGTGACCCCGAGGGTGG - Intergenic
1152878316 17:82800993-82801015 GGAGGTAGGCACCATGAGGGCGG + Exonic
1153812167 18:8761841-8761863 TGTGGGAGGGACCCAGAGGGAGG - Intronic
1153888543 18:9490749-9490771 TTTGGGAGTGACCCAGAGGGAGG + Intronic
1156559868 18:38111519-38111541 TGTGGGAGGGACCCTGGGGGAGG + Intergenic
1157004699 18:43568167-43568189 TGTGGGAGGAACCCTGTGGGAGG - Intergenic
1157405105 18:47416125-47416147 AGTGGGAGGCAACTTGAGGGAGG + Intergenic
1157491997 18:48129951-48129973 GGTGGGAGTCAGGAGGAGGGCGG + Intronic
1157565711 18:48677814-48677836 GGTGGGAGTCCCTCTGGGGCAGG - Intronic
1157808718 18:50678047-50678069 GGATGGAGCCAGCCTGAGGGAGG - Intronic
1158013861 18:52761301-52761323 TGTGGGAGGGACCCTGTGGGAGG - Intronic
1158321246 18:56267113-56267135 GGTGGCAATCACCCAGATGGTGG - Intergenic
1159393470 18:67826379-67826401 GGTGGGAGGGACCCCGTGGGAGG + Intergenic
1159629227 18:70730231-70730253 TGTGGGAGGGACCCTGTGGGGGG + Intergenic
1159652441 18:70994562-70994584 GGTGGGAAGGACCCTGTGGGAGG + Intergenic
1159687764 18:71444647-71444669 TGTGGGAGGGACCCTGTGGGAGG + Intergenic
1159799792 18:72883839-72883861 TGTGGGAGGGACCCTGTGGGAGG - Intergenic
1159996771 18:74972089-74972111 TGTGGGAGGGACCCAGAGGGAGG - Intronic
1160256304 18:77250979-77251001 GTTGCGGGACACCCTGAGGGAGG - Exonic
1160331251 18:77993828-77993850 GGTGGGAGGGACCCGGTGGGAGG - Intergenic
1160529906 18:79556819-79556841 GGGGGGAGTCTCCTGGAGGGGGG - Intergenic
1160956564 19:1695558-1695580 CGTGGGAGGAACCCTGTGGGAGG + Intergenic
1161383643 19:3979763-3979785 GGGAGCAGACACCCTGAGGGGGG - Intronic
1162246260 19:9404141-9404163 TGTGGGAGGCACCCGGTGGGAGG - Intergenic
1163224260 19:15944828-15944850 GGTGGGAGTGATCTTGAGGCTGG + Intergenic
1163727663 19:18931942-18931964 GGTGGGGGTCTCTCGGAGGGAGG + Intronic
1165117513 19:33537838-33537860 TGTGGGAGGAACCCTGTGGGAGG - Intergenic
1166530857 19:43542762-43542784 GGTGGGAAGCAGCCTGAGGCAGG - Intergenic
1166882901 19:45940069-45940091 GGTGGGAGCCATCCTGGGGAAGG - Exonic
1167959604 19:53095251-53095273 GGTGGAAGCCACCGTGAGGTGGG - Intronic
925106554 2:1297172-1297194 GGTGGGAGGGAACCTGAGGCTGG - Intronic
925349356 2:3190096-3190118 GGTGGGAAACACCCTGGGGGAGG - Intronic
925443688 2:3909622-3909644 TGTGGGAGGGACCCAGAGGGAGG - Intergenic
925457141 2:4025554-4025576 GTTGGGAGGGACCCAGAGGGAGG + Intergenic
926346764 2:11954154-11954176 GGTGGGAGGGACCCAGTGGGAGG - Intergenic
927640942 2:24844884-24844906 TGTGGGAGGGACCCAGAGGGAGG + Intronic
928245418 2:29622500-29622522 TGTGGGAGGGACCCAGAGGGAGG - Intronic
928862314 2:35874249-35874271 GGTGGGAGGGACCCGGTGGGAGG - Intergenic
929279933 2:40066649-40066671 GGTGGGAGGGACCCAGTGGGAGG - Intergenic
931374473 2:61695056-61695078 CGTGGCAGCCAGCCTGAGGGCGG - Intergenic
931690534 2:64831514-64831536 AGGGTGAGTCACCCTGGGGGTGG + Intergenic
931941112 2:67253172-67253194 TGTGGGAGGGACCCTGTGGGAGG + Intergenic
934302993 2:91794285-91794307 GCTGGTAGTCACCAGGAGGGAGG - Intergenic
934330267 2:92058471-92058493 GCTGGTAGTCACCAGGAGGGAGG + Intergenic
934759135 2:96843925-96843947 GGTGGGAGGCACCCTGGGACCGG - Intronic
934960285 2:98666969-98666991 GGTGGGAGGGACCCAGTGGGAGG + Intronic
935326293 2:101940657-101940679 TGTGGGAGGGACCCAGAGGGAGG - Intergenic
935787863 2:106565448-106565470 GGTGGGAGTGACCCTGTGGTCGG + Intergenic
936039069 2:109135337-109135359 GGTGGGAATCCCACTGAAGGTGG + Intronic
936772088 2:115925794-115925816 TGTGGGAGGGACCCTCAGGGAGG + Intergenic
937484857 2:122304767-122304789 TGTGGGAGGGACCCTGTGGGAGG - Intergenic
937801147 2:126081693-126081715 GATAGAAGTTACCCTGAGGGTGG + Intergenic
937900148 2:127013748-127013770 GCTGGGAGCCACCCTCAGGCTGG - Intergenic
938923771 2:136019949-136019971 GGTTGGAGTCAGCCTGCCGGAGG - Intergenic
939216067 2:139239962-139239984 GGTGGGAGACACCCTGCAGTAGG - Intergenic
941536133 2:166723990-166724012 AGTGGGAGGGACCCAGAGGGAGG - Intergenic
944250378 2:197575052-197575074 TGTGGGAGTGACCCAGTGGGAGG + Intronic
944392919 2:199237715-199237737 TGTGGGAGTGACCCAGGGGGAGG + Intergenic
944728793 2:202498077-202498099 GGAGGGCCACACCCTGAGGGAGG - Intronic
945857131 2:215082364-215082386 GGTGGGTTTTATCCTGAGGGTGG - Intronic
946181479 2:217951671-217951693 GGTGGGAGCCGCCTTGAGGATGG - Intronic
946562610 2:220929429-220929451 TGTGGGAGGCACCCGGTGGGAGG - Intergenic
946831983 2:223736664-223736686 GGTGGGAGGCACCCGGTGGGAGG + Intergenic
947383919 2:229571555-229571577 GGTGGGAGTCTTCCGTAGGGAGG - Intronic
1169194905 20:3677823-3677845 GGTGGGAGACGCCAAGAGGGTGG - Intronic
1169766274 20:9151421-9151443 GGTGGGAGGGACCCAGGGGGAGG + Intronic
1170076753 20:12427991-12428013 GGTGGGAGGGACCCAGTGGGAGG + Intergenic
1170118844 20:12891038-12891060 TGTGGGAGGCACCCAGGGGGAGG + Intergenic
1170437876 20:16349267-16349289 GGTAGGTGGCACCCTGATGGTGG - Intronic
1171217476 20:23362524-23362546 GGTGGGAGGTGCCGTGAGGGCGG + Intronic
1171885747 20:30651506-30651528 GTTGAGTGTCACCCTGAGGGAGG + Intergenic
1172019326 20:31901765-31901787 GGGTGGAGTCACCCTGTGGAAGG - Intronic
1173470508 20:43320052-43320074 GCTGTGATTCACCCTGAGAGGGG + Intergenic
1174212152 20:48888289-48888311 TGTGGGAGAGACCCAGAGGGAGG - Intergenic
1175195525 20:57240840-57240862 TGTGGGAGGCACCCAGGGGGAGG - Intronic
1175527781 20:59647443-59647465 GGTGGAAGGCCCCCTGAGGTTGG + Intronic
1175859449 20:62142732-62142754 GGTGGGGGTCCCCATAAGGGGGG + Intronic
1176911695 21:14573153-14573175 GGTGGGAGTCAGGGTGATGGTGG + Intronic
1177339639 21:19783127-19783149 TGTGGGAGGCACCCGGTGGGAGG - Intergenic
1177411765 21:20738794-20738816 GGTGGGAGGCACCTGGTGGGAGG + Intergenic
1177450807 21:21262979-21263001 TGTGGGAGTGACCCGGTGGGAGG - Intronic
1177857277 21:26413730-26413752 GGTGGGAGGGACCCGGTGGGAGG + Intergenic
1178224363 21:30698919-30698941 TGTGGGAGTGACCCAGTGGGAGG - Intergenic
1179235459 21:39541531-39541553 TGTGGGAGGGACCCAGAGGGAGG - Intergenic
1179256861 21:39724417-39724439 TGTGGGAGGGACCCTGTGGGAGG + Intergenic
1179656929 21:42851441-42851463 GGAGGGATTCACACTGAGGTCGG - Intronic
1179776221 21:43664927-43664949 GGTGGGAGGGACCCAGTGGGAGG - Intronic
1180255923 21:46627488-46627510 GGTGGGAGGGACCCTGTGGGAGG - Intergenic
1180337792 22:11594731-11594753 GGTGGCAGTGAGGCTGAGGGAGG - Intergenic
1180421375 22:12817378-12817400 GGCAGGAGTCACACTGAGGAAGG - Intergenic
1180791679 22:18578281-18578303 GGTGGGCGTCAGCCTGTCGGGGG - Intergenic
1180976878 22:19853593-19853615 GGAGGAACTCACCCTGAGGGGGG - Intronic
1181230057 22:21417028-21417050 GGTGGGCGTCAGCCTGTCGGGGG + Intergenic
1181248592 22:21517838-21517860 GGTGGGCGTCAGCCTGTCGGGGG - Intergenic
1181424740 22:22827246-22827268 TGTGTGATTCATCCTGAGGGTGG - Intronic
1182074176 22:27483793-27483815 GGTGGGAGTCACTTAGAGAGGGG + Intergenic
1182098317 22:27640649-27640671 GGTGGGAATATCCCTGAGAGTGG - Intergenic
1182330038 22:29545249-29545271 TGTGGGAGGGACCCAGAGGGAGG - Intronic
1182742124 22:32575436-32575458 GGTGGGGGTCTTCCAGAGGGCGG + Intronic
1182854879 22:33508251-33508273 GGTGGGTGTCACCCTGGGCAAGG + Intronic
1183025824 22:35065435-35065457 AGAGGGACTCACCCTGAGAGAGG - Intergenic
1183244062 22:36680087-36680109 GGTGGCAGTGATCCTGAAGGTGG - Intronic
1183330892 22:37220840-37220862 GGTGGGAGGAACCCAGTGGGAGG - Intergenic
1183988292 22:41581405-41581427 GCTGAGAGGCACCCTCAGGGAGG + Intronic
950429924 3:12944836-12944858 GCTGGGAGGCACCGTCAGGGAGG + Intronic
951706954 3:25553256-25553278 GATGGGAGCCTCCTTGAGGGAGG + Intronic
952535419 3:34304315-34304337 GGGTGGGGTCACCATGAGGGTGG + Intergenic
953832890 3:46316961-46316983 TGTGGGAGGCACCCAGTGGGAGG + Intergenic
954538734 3:51380156-51380178 GGGGGGTATCACCCAGAGGGTGG - Exonic
954732477 3:52676327-52676349 TGTGGGAGGGACCCAGAGGGAGG + Intronic
955666123 3:61350663-61350685 GGAGGGGCTCAGCCTGAGGGAGG + Intergenic
956140523 3:66142150-66142172 ATTGGGAGTCACCCAGAGGCTGG - Intronic
956185552 3:66559132-66559154 TGTGGGAGGGACCCAGAGGGAGG - Intergenic
956337051 3:68175888-68175910 GGTGGGAGGGACCCAGTGGGAGG + Intronic
956379122 3:68647325-68647347 GGTGGGAGGGACCCGGTGGGAGG + Intergenic
956735875 3:72237780-72237802 GGTGAAACTCACCCTGTGGGAGG - Intergenic
957144927 3:76412236-76412258 TGTGGGAGTAACCCAGGGGGAGG - Intronic
957161655 3:76617921-76617943 TGTGGGAGTTACCCAGTGGGAGG - Intronic
957757654 3:84510726-84510748 GGTGGGAGGGACCCAGTGGGAGG + Intergenic
957760568 3:84549787-84549809 GGTGGGAGGGACTCTGTGGGAGG + Intergenic
958018530 3:87969835-87969857 TGTGGGAGGGACCCAGAGGGAGG + Intergenic
959071158 3:101703380-101703402 GGAAGGACTCACCCTGAAGGTGG + Intergenic
959446648 3:106448695-106448717 GGTGGGAGTGACTCAGTGGGAGG + Intergenic
959934563 3:112015501-112015523 GATGGGAGTCTCCATGGGGGGGG - Intergenic
960172120 3:114474144-114474166 TGTGGGAGAGACCCAGAGGGAGG - Intronic
960263930 3:115598748-115598770 TGTGGGAGGCACCCAGGGGGAGG + Intergenic
960333676 3:116391916-116391938 GTTGGCAGTCACCCTGATGGAGG - Intronic
961754927 3:129121848-129121870 AGTGGGTGCCAGCCTGAGGGCGG - Intronic
961828374 3:129610649-129610671 CGTGGGAGCAACCCTGCGGGGGG + Intergenic
962460771 3:135610611-135610633 CGTGGGAGGCACCCAGTGGGAGG + Intergenic
964025011 3:152062442-152062464 GATGGGTGTTACCATGAGGGTGG - Intergenic
964107738 3:153056914-153056936 GGTGGGAGGGACCCGGTGGGAGG - Intergenic
964505292 3:157392430-157392452 GGTGGGAGGGACCCGGTGGGAGG - Intronic
964783784 3:160371359-160371381 GGTGGGAGTGGACCAGAGGGTGG - Intronic
965038985 3:163481849-163481871 TGTGGGAGGGACCCTGAGAGAGG + Intergenic
966419741 3:179725939-179725961 GGTGGGAGGGACCCTGTGGGAGG - Intronic
966720907 3:183061917-183061939 GGTGGGAGGGACCCGGCGGGAGG + Intronic
966966035 3:184995041-184995063 GGTGGGAGGGACCCAGTGGGAGG - Intronic
967055334 3:185825089-185825111 GGGGGGAGCCAGGCTGAGGGTGG - Intergenic
967462430 3:189761991-189762013 TGTGGGAGACACCCTGTGGAAGG - Intronic
967554429 3:190837727-190837749 AGTGGGATTAACCTTGAGGGGGG - Intergenic
967920489 3:194610556-194610578 GGTGGGAGGCAAGGTGAGGGAGG - Intronic
968029305 3:195469369-195469391 TGTGGGAGGAACCCTGTGGGAGG + Intergenic
968287735 3:197518353-197518375 GGGGGGGGTCGGCCTGAGGGGGG - Intronic
968287812 3:197518622-197518644 GGGGGGGGTCGGCCTGAGGGGGG - Intronic
968287829 3:197518675-197518697 GGGGGGGGTCAGCCTGAGGGGGG - Intronic
968287845 3:197518728-197518750 GGGGGGGGTCGGCCTGAGGGGGG - Intronic
968547633 4:1206891-1206913 GGTGGGAGACACATGGAGGGTGG + Intronic
968597214 4:1491729-1491751 CGAGGGAGACACCCTGATGGTGG - Intergenic
968778360 4:2559679-2559701 GGTGGAAGACATCCAGAGGGAGG - Intronic
969538762 4:7772855-7772877 GGGCGGAGTCACCCTGGGGCTGG - Exonic
969579296 4:8054691-8054713 GGTGGGAGCCAGCCTTGGGGAGG + Intronic
971119774 4:23690289-23690311 GGTGGGAGGGACCCAGTGGGAGG + Intergenic
971497516 4:27282848-27282870 GTTGGGTGTCATCTTGAGGGTGG - Intergenic
972400456 4:38697276-38697298 GTGGGGAGTCACGCTGAGGCAGG - Exonic
972748743 4:41967953-41967975 GGTGGGAGTGACCTGGTGGGAGG + Intergenic
972898480 4:43653936-43653958 TGTGGGCCTCACCCTGAGGTAGG - Intergenic
973369394 4:49233751-49233773 GTTGAGTGTCACTCTGAGGGAGG + Intergenic
973391643 4:49561665-49561687 GTTGAGTGTCACTCTGAGGGAGG - Intergenic
973897062 4:55423818-55423840 GGTGGGAGTCCAGGTGAGGGAGG - Intronic
974343296 4:60642011-60642033 TGTGGGAGGCACCCCGTGGGAGG - Intergenic
974495156 4:62616348-62616370 TGTGGGAGGGACCCAGAGGGAGG - Intergenic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
974843253 4:67322294-67322316 GGAGGGAGGGACCCAGAGGGAGG + Intergenic
975046097 4:69806581-69806603 TGTGGGAGAGACCCTGTGGGAGG + Intergenic
975345922 4:73292811-73292833 GGTGGGAGTGAGGCTGTGGGAGG - Intergenic
978260652 4:106753355-106753377 GCTAGGAGTCACCCTCAGGAGGG - Intergenic
979592189 4:122493329-122493351 GGTGGCAGTGAGGCTGAGGGAGG + Intergenic
980720278 4:136686733-136686755 TGTGGGAGGCACCCAGAGGGAGG - Intergenic
981844992 4:149157262-149157284 TGTGGGAGGCACCCAGTGGGAGG - Intergenic
982026642 4:151258604-151258626 TCTGGGATTCAGCCTGAGGGTGG - Intronic
982849388 4:160293515-160293537 TGTGGGAGACACCCAGGGGGAGG - Intergenic
984922642 4:184779199-184779221 TGTGGGAGGGACCCTGGGGGAGG + Intronic
984946330 4:184971444-184971466 TGTGGGAGGCACCCAGCGGGAGG + Intergenic
985201558 4:187489665-187489687 GGTGGGAGGAACCCAGTGGGAGG + Intergenic
985509275 5:303043-303065 CGTGGAAGTCTCCCTGAGGAAGG + Intronic
985664928 5:1177180-1177202 GGTGGGAGCCACGCTGTGGGTGG - Intergenic
986069034 5:4264368-4264390 GGCGGCAGTCAGCCTGAGGAAGG - Intergenic
986933955 5:12859506-12859528 CGTGGGAGGCACCCAGTGGGAGG + Intergenic
987586973 5:19867867-19867889 TGTGGGAGGGACCCTGTGGGAGG + Intronic
988035860 5:25826184-25826206 GGTGGGAGTAACTCAGTGGGAGG - Intergenic
988128981 5:27079117-27079139 TGTGGGAGGGACCCTGGGGGAGG - Intronic
988355026 5:30162534-30162556 TGTGGGAGAAACCCTGTGGGAGG - Intergenic
988422771 5:31026503-31026525 TGTGGGAGGCACCCAGTGGGAGG + Intergenic
990075594 5:51842939-51842961 TGTGGGAGGAACCCTGCGGGGGG - Intergenic
990729687 5:58795032-58795054 TGTGGGAGACACCCGGTGGGAGG + Intronic
992215699 5:74522917-74522939 TGTGGGAGTGACCCAGTGGGAGG + Intergenic
993331358 5:86604462-86604484 TGTGGGAGGGACCCTGTGGGAGG - Intergenic
993854488 5:93056504-93056526 TGTGGGAGGGACCCTGTGGGAGG - Intergenic
995416785 5:111921777-111921799 TGTGGGAGGGACCCGGAGGGAGG + Intronic
995526573 5:113055006-113055028 GGGGCGAGTCACCCCTAGGGAGG - Intronic
995913972 5:117220917-117220939 TGTGGGAGGGACCCTGTGGGAGG + Intergenic
996490229 5:124086100-124086122 TGTGGGAGGTACCCAGAGGGAGG + Intergenic
996889444 5:128400876-128400898 GGTGGGAGGGACCCAGAGGGAGG + Intronic
997430177 5:133832433-133832455 GATGGCAGTCATTCTGAGGGAGG + Intergenic
997812083 5:136980467-136980489 TGTGGGAGGGACCCTGTGGGAGG + Intronic
998406551 5:141877851-141877873 GGTGGGGGTCTCCCGGAGGACGG - Intronic
998987418 5:147776255-147776277 CGTGGGAGGGACCCAGAGGGAGG + Intronic
999319585 5:150605236-150605258 GGTGGGGCTCTCCCTGAGGCTGG + Intronic
999393779 5:151213661-151213683 GGTAAGAGTAGCCCTGAGGGAGG + Intronic
999602421 5:153282088-153282110 TGTGGGAGGAACCCTGTGGGAGG - Intergenic
999962878 5:156775993-156776015 GGTGGGAGAGACCCCGTGGGAGG - Intergenic
1000611098 5:163375758-163375780 AGTGGGAGGCACCCAGTGGGAGG + Intergenic
1000774878 5:165407154-165407176 TGTGGGAGGGACCCAGAGGGAGG + Intergenic
1002320310 5:178371566-178371588 GGTGACAGTGCCCCTGAGGGAGG - Intronic
1006408010 6:33856351-33856373 GGTGGGAGTCACTCTTGGAGAGG - Intergenic
1007289337 6:40773479-40773501 GGTGGGAGGGACCCAGTGGGAGG - Intergenic
1007889148 6:45270371-45270393 TGTGGGAGGCACCCAGTGGGAGG + Intronic
1007941772 6:45788197-45788219 GGTGGCTGCCACCCTGAGAGGGG + Intergenic
1008357609 6:50573100-50573122 CGTGGGAGGGACCCAGAGGGAGG - Intergenic
1008680219 6:53864154-53864176 GCAGAGAGTCACCCAGAGGGGGG - Intronic
1008705418 6:54152588-54152610 TGTGGGAGGGACCCAGAGGGAGG - Intronic
1008825045 6:55683996-55684018 GGTGGGAGGGACCCGGTGGGAGG + Intergenic
1009230265 6:61053118-61053140 GGTGGCAGTGAGGCTGAGGGAGG - Intergenic
1009396403 6:63204986-63205008 TGTGGGAGAGACCCAGAGGGAGG - Intergenic
1009410599 6:63361364-63361386 GGTGGCAGTGAGGCTGAGGGAGG - Intergenic
1009503612 6:64448289-64448311 GGTGGCAGTGAGCCTGGGGGAGG + Intronic
1009772348 6:68160005-68160027 TGTGGGAGGGACCCGGAGGGAGG + Intergenic
1010676288 6:78748359-78748381 TGTGGGAGGCACCCAGGGGGAGG + Intergenic
1010884497 6:81218951-81218973 TGTGGGAGGAACCCTGTGGGAGG + Intergenic
1010973804 6:82290915-82290937 TGTGGGAGGGACCCAGAGGGAGG - Intergenic
1012683086 6:102208474-102208496 TGTGGGAGGAACCCAGAGGGAGG + Intergenic
1013048782 6:106512209-106512231 GGTGGGCGTGACCCTTGGGGCGG - Exonic
1013874373 6:114805617-114805639 GGTGGCAGTGAGCCTGGGGGAGG - Intergenic
1014186676 6:118442763-118442785 GGTGAGAGAGACCCAGAGGGAGG - Intergenic
1014407652 6:121070262-121070284 TGTGGGAGGCACCCGGTGGGAGG + Intergenic
1015308432 6:131736532-131736554 TGTGGGAGGGACCCTGTGGGAGG - Intronic
1016437465 6:144051864-144051886 CGTGGGAGTAACCCAGTGGGAGG - Intronic
1016864814 6:148755548-148755570 TGTGGGAGGAACCCTGTGGGAGG + Intronic
1018416366 6:163605462-163605484 GGTGGGAGGGACCCCGTGGGAGG + Intergenic
1018909363 6:168093160-168093182 GGTGGGAGGGACCCGGTGGGAGG - Intergenic
1019534487 7:1521708-1521730 TGTGGGAGGGACCCTGTGGGAGG - Intergenic
1019543504 7:1561689-1561711 GGTGGGTGTCAGCCTGAGGAGGG - Intergenic
1019940978 7:4290860-4290882 TGTGGGAGTTACCCTGTGGGAGG + Intergenic
1020145194 7:5637009-5637031 AGTGGGAGTTAGCGTGAGGGTGG - Intronic
1020170160 7:5838885-5838907 GGTGGGAGCCACCGGAAGGGAGG - Intergenic
1021356793 7:19659840-19659862 GGAGGGCCACACCCTGAGGGAGG + Intergenic
1022879967 7:34576217-34576239 GGTGGCAGTCAGTCTGAGGGAGG + Intergenic
1022974344 7:35543911-35543933 TGTGGGAGCCTCCCTGAGGCTGG - Intergenic
1023784048 7:43687911-43687933 TGTGGGAGGGACCCAGAGGGAGG + Intronic
1024666501 7:51552004-51552026 GGAGGGAGGGACCCAGAGGGAGG + Intergenic
1024721336 7:52140187-52140209 TGTGGGAGTGACCTTGTGGGAGG - Intergenic
1024914772 7:54486949-54486971 TGTGGGAGAGACCCTGTGGGAGG - Intergenic
1024982149 7:55166628-55166650 GGTGGGAGTCACAGTGGTGGTGG + Intronic
1024982158 7:55166669-55166691 GGTGGGAGTCACAATGGTGGTGG + Intronic
1024982226 7:55167047-55167069 GGTGGGAGTCACAATGTTGGTGG + Intronic
1024982243 7:55167147-55167169 GGTGGGAGTCACAATGGTGGTGG + Intronic
1024982260 7:55167238-55167260 GGTGGGAGTCACAATGGTGGTGG + Intronic
1024982272 7:55167288-55167310 GGTGGGAGTCACAATGGTGGTGG + Intronic
1024982283 7:55167338-55167360 GGTGGGAGTCACAATGGTGGTGG + Intronic
1024982294 7:55167388-55167410 GGTGGGAGTCACAGTGGTGGTGG + Intronic
1024982313 7:55167488-55167510 GGTGGGAGTCACAATGGTGGTGG + Intronic
1024982323 7:55167529-55167551 GGTGGGAGTCACAGTGGTGGTGG + Intronic
1024982334 7:55167579-55167601 GGTGGGAGTCACAGTGGTGGTGG + Intronic
1025610401 7:63072129-63072151 GGTGGGAGTGAGCCTGGGGCAGG - Intergenic
1026687500 7:72523920-72523942 TGTGGGAGGGACCCTGTGGGAGG + Intergenic
1027481178 7:78698874-78698896 TGTGGGAGTGACCCAGTGGGAGG - Intronic
1029423796 7:100484574-100484596 GATGGGAGACACCCTGAGTTGGG - Intronic
1029731113 7:102438934-102438956 GGTGGGAGCCAGGCTAAGGGTGG - Exonic
1030629912 7:111884570-111884592 TGTGGGAGACACCCTGAGAGAGG + Intronic
1030711271 7:112752735-112752757 TGTGGGAGGGACCCTGTGGGAGG + Intergenic
1030915304 7:115304658-115304680 TGTGGGAGTTACCCAGTGGGAGG + Intergenic
1031435249 7:121725043-121725065 GGTGGCAGTGAGGCTGAGGGAGG - Intergenic
1032057710 7:128697150-128697172 GTTGGGATTCACTCTGAGTGGGG + Intergenic
1033663589 7:143420965-143420987 TGTGGGAGACACCCAGTGGGAGG - Intergenic
1034540166 7:151753023-151753045 GGTGGGTGCCCACCTGAGGGCGG + Intronic
1034718234 7:153263630-153263652 GGTGGGAGGGACCCAGTGGGAGG - Intergenic
1034812080 7:154141341-154141363 GATGGGAGTCGCACTGAGGAGGG - Intronic
1035245548 7:157560230-157560252 GGTGGGAGACCCCTTGAAGGTGG + Intronic
1035788920 8:2286031-2286053 GCTGGGAGTGTCCCTCAGGGCGG - Intergenic
1035803885 8:2435674-2435696 GCTGGGAGTGTCCCTCAGGGCGG + Intergenic
1035835956 8:2751959-2751981 TCTGGGAGCCACCCTGAGGAGGG + Intergenic
1036635695 8:10548413-10548435 GGTGGCAGCCACCGGGAGGGTGG - Intronic
1036798787 8:11774453-11774475 GGTGGGAGGTACCCAGTGGGAGG - Intronic
1037906508 8:22718778-22718800 GGTGGGGGGCAGTCTGAGGGCGG + Intronic
1038212934 8:25536639-25536661 GGTGGTAGTCTCTCTGAGGAGGG + Intergenic
1038660788 8:29494936-29494958 TGTGGGAGACACACTGAGGTAGG - Intergenic
1038888276 8:31690006-31690028 CGTGGGAGGGACCCTGTGGGAGG + Intronic
1039137516 8:34342247-34342269 TGTGGGAGGCACCTTGTGGGAGG + Intergenic
1040945206 8:52876988-52877010 GGTGGGAGGGACCCAGTGGGAGG - Intergenic
1041097258 8:54362047-54362069 GGGTGGAGTGAGCCTGAGGGAGG + Intergenic
1041262447 8:56033539-56033561 GGTAAGAGTCACCCTGAACGGGG - Intergenic
1041431596 8:57787321-57787343 TGTGGGAGGGACCCTGCGGGAGG + Intergenic
1043123457 8:76360425-76360447 GGTGGGAGTGAGGCTGGGGGAGG + Intergenic
1043289741 8:78582489-78582511 TGTGGGAGGGACCCAGAGGGAGG - Intronic
1043678201 8:82988194-82988216 GGTGGGAGGAACCCAGTGGGAGG + Intergenic
1043740035 8:83800308-83800330 TGTGGGAGGGACCCAGAGGGAGG - Intergenic
1044714501 8:95088200-95088222 GGTGAGAGGCAGCCTGTGGGAGG - Intronic
1045506264 8:102780952-102780974 GGTAGGAGACAGCCTCAGGGAGG + Intergenic
1045716789 8:105056300-105056322 TGTGGGAGGGACCCTGTGGGAGG + Intronic
1046264445 8:111813476-111813498 TGTGGGAGGGACACTGAGGGAGG - Intergenic
1048773366 8:137919263-137919285 GGTGGGAGGGACCCTGTGGGAGG + Intergenic
1049523692 8:143109086-143109108 GGTGAGAGTCCCAGTGAGGGAGG + Intergenic
1051043707 9:12848136-12848158 GGTGGGAGGGACCCAGTGGGAGG - Intergenic
1051727502 9:20103125-20103147 GGTGGCAGCCAGGCTGAGGGAGG + Intergenic
1054850419 9:69841887-69841909 CATGGGAGACACCCTGTGGGAGG - Intronic
1055655577 9:78447452-78447474 GGTGGGAGGGACCCAGTGGGAGG - Intergenic
1056882261 9:90407278-90407300 GGTGGGAGTGGACATGAGGGAGG - Intergenic
1057260572 9:93580833-93580855 GGTGGCAGCCACCCTGGAGGGGG + Intronic
1058174383 9:101721143-101721165 TGTGGGAGGGACCCAGAGGGAGG + Intronic
1058940994 9:109812450-109812472 GATAGGAGTGAGCCTGAGGGTGG + Intronic
1059759672 9:117325972-117325994 TTAGGGAGTTACCCTGAGGGAGG + Intronic
1059990231 9:119858372-119858394 TGTGGGAGGGACCCTGTGGGAGG - Intergenic
1060449248 9:123721589-123721611 CGTGGGAGCAACCCTGTGGGAGG + Intronic
1061021825 9:128020736-128020758 GGTGGGGGACACCCTGGGGGCGG - Intergenic
1061402367 9:130375551-130375573 GGTGGGAGCCACTGTGATGGGGG - Intronic
1062615934 9:137395653-137395675 GGTGGGAGGGGCCCTGGGGGGGG + Intronic
1185457068 X:316569-316591 GGTGGGGGTCACCCAGGAGGAGG + Intronic
1185597358 X:1315105-1315127 GGTGGGAGTCACACTGTGGGGGG + Intergenic
1185691386 X:2157895-2157917 TGTGGGAGGGACCCTGTGGGAGG + Intergenic
1186062029 X:5719414-5719436 GGTGGGAGGGACCCAGTGGGAGG - Intergenic
1186620598 X:11236349-11236371 GGTGGGAGGGACCCAGTGGGAGG - Intronic
1186704499 X:12127498-12127520 GGTGGGAGGGACCCAGTGGGAGG - Intergenic
1186836298 X:13441858-13441880 GGTGGGAGGGACCCAGTGGGAGG - Intergenic
1187220096 X:17317148-17317170 TGTGGGAGGGACCCTGTGGGAGG - Intergenic
1187663359 X:21574629-21574651 GGTGGGAGGGACCCAGTGGGAGG - Intronic
1187790070 X:22941155-22941177 GGTGGAAGTGACACTGAGTGTGG + Intergenic
1188098598 X:26053487-26053509 TGTGGGAGGGACCCAGAGGGAGG + Intergenic
1191598591 X:62975482-62975504 TGTGGGAGGGACCCAGAGGGTGG - Intergenic
1191697815 X:64007381-64007403 GGTGGGAGGGACCCAGTGGGAGG - Intergenic
1191987631 X:66999894-66999916 TGTGGGAGTAACCCAGTGGGAGG - Intergenic
1192955828 X:76069220-76069242 GGTGGCAGCCAGGCTGAGGGAGG + Intergenic
1193229967 X:79032291-79032313 GGTGGCAGTGAGGCTGAGGGAGG - Intergenic
1193614682 X:83672393-83672415 TGTGGGAGGGACCCAGAGGGAGG + Intergenic
1194288383 X:92038723-92038745 CGTGGGAGGAACCCAGAGGGAGG + Intronic
1194335289 X:92639468-92639490 GGTGGGAGAGACCCAGTGGGAGG + Intergenic
1194736767 X:97521553-97521575 GGTGGGAGGGACCCAGTGGGAGG + Intronic
1196419615 X:115508385-115508407 GGAGGGCCACACCCTGAGGGAGG + Intergenic
1196797778 X:119515989-119516011 GGTGGGTGTCAGCCTGGGGCAGG + Intergenic
1196833166 X:119791924-119791946 GGCGGGACTAACCCTAAGGGAGG + Intergenic
1197128252 X:122972908-122972930 TGTGGGAGGGACCCTGTGGGAGG + Intergenic
1197281058 X:124536528-124536550 GGGGGCACTCACCCTGAGGTAGG + Intronic
1199182635 X:144876629-144876651 GGTAGGAGGCACCCAGTGGGAGG - Intergenic
1199950305 X:152700967-152700989 AGTTGAAGTCACCCTGGGGGAGG + Exonic
1199952584 X:152717241-152717263 AGTGGAAGTTACCCTGGGGGAGG + Exonic
1199955182 X:152736296-152736318 AGTGGAAGTCACCCTGCGGGAGG + Exonic
1199957099 X:152751207-152751229 AGTGGAAGTTACCCTGGGGGAGG - Exonic
1199959373 X:152767494-152767516 AGTTGAAGTCACCCTGGGGGAGG - Exonic
1199991263 X:152988939-152988961 GGGGGGGGCCACACTGAGGGAGG - Exonic
1200605904 Y:5263288-5263310 CGTGGGAGGAACCCAGAGGGAGG + Intronic
1200643758 Y:5756502-5756524 GGTGGGAGAGACCCAGTGGGAGG + Intergenic
1201249282 Y:12039799-12039821 GGTGGCAGTGAGGCTGAGGGAGG + Intergenic
1201684302 Y:16683623-16683645 GGTGGCAGTAAGGCTGAGGGAGG + Intergenic
1202019725 Y:20451816-20451838 GGTGGGAGGGACCCAGGGGGAGG + Intergenic