ID: 1135661250

View in Genome Browser
Species Human (GRCh38)
Location 16:24298874-24298896
Sequence CATGATTACATGAAGGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135661247_1135661250 4 Left 1135661247 16:24298847-24298869 CCTCAATTTGCCTTGGGCTGTTT 0: 1
1: 1
2: 2
3: 18
4: 367
Right 1135661250 16:24298874-24298896 CATGATTACATGAAGGATCATGG 0: 1
1: 0
2: 0
3: 18
4: 181
1135661246_1135661250 5 Left 1135661246 16:24298846-24298868 CCCTCAATTTGCCTTGGGCTGTT 0: 1
1: 0
2: 1
3: 17
4: 182
Right 1135661250 16:24298874-24298896 CATGATTACATGAAGGATCATGG 0: 1
1: 0
2: 0
3: 18
4: 181
1135661248_1135661250 -6 Left 1135661248 16:24298857-24298879 CCTTGGGCTGTTTTGCTCATGAT 0: 1
1: 0
2: 1
3: 16
4: 148
Right 1135661250 16:24298874-24298896 CATGATTACATGAAGGATCATGG 0: 1
1: 0
2: 0
3: 18
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135661250 Original CRISPR CATGATTACATGAAGGATCA TGG Intronic
901088055 1:6624071-6624093 CATGATTACATCAAGTCTCTGGG + Intergenic
901724619 1:11231098-11231120 CATGATTACAACAAGTATCACGG + Intronic
902077581 1:13800317-13800339 CTTGATTACATGAAAGAAGATGG + Intronic
903028281 1:20444762-20444784 TATGAGGACAAGAAGGATCAAGG - Intergenic
903797397 1:25940128-25940150 CTTGTTTACATGAAGGGTCCAGG + Intergenic
904011139 1:27391335-27391357 CATGATTCCAGGGAGCATCAAGG + Intergenic
904609624 1:31718241-31718263 CATGAGTCCTTGGAGGATCAAGG - Intergenic
909138515 1:71832793-71832815 CATGATTACATAAGGAATCATGG + Intronic
910054874 1:83021532-83021554 AATGATAACATCAAAGATCACGG + Intergenic
911926637 1:103840932-103840954 CATGATTACCTGCAATATCAGGG + Intergenic
912104816 1:106259016-106259038 CATGATTTCATCTAGGATAATGG + Intergenic
913003988 1:114610204-114610226 CATCGTTAGATGAAGGATGAAGG + Intronic
913186720 1:116375070-116375092 CATGTTTACAGAAATGATCAAGG - Intronic
913249508 1:116900840-116900862 CATCATGGCATCAAGGATCATGG + Intergenic
914822061 1:151112248-151112270 CATCAGTACATGAAGGATATAGG - Intronic
915948884 1:160174472-160174494 CATGATTACATCAGGAAACAAGG + Intronic
917467719 1:175297200-175297222 CATCAGTACATGAAGGATATAGG + Intergenic
919067102 1:192706370-192706392 CATGACATCATGAAGGATAAAGG + Intergenic
919160515 1:193824362-193824384 CATTATTACATGAATAATAATGG - Intergenic
919352256 1:196472328-196472350 CATGATTACTTTAAGTATAAAGG - Intronic
920262833 1:204701193-204701215 CAGGATTAGAATAAGGATCAGGG - Intergenic
923337562 1:232983680-232983702 CATGACTGCATGCATGATCACGG + Exonic
923983116 1:239348786-239348808 CATGATCACATTAAGGCTGAAGG - Intergenic
924396298 1:243624987-243625009 GATGAGTACATGAAGGCTCTAGG - Intronic
924618127 1:245632283-245632305 CATGTTTTCATGTAGGAGCATGG + Intronic
1066438372 10:35414656-35414678 CACGATTACAAGATGTATCACGG - Intronic
1071284382 10:84131129-84131151 GATGATTACATGAAATAACATGG - Intergenic
1071887681 10:89968627-89968649 CATGATGCCATCAAGGATCTAGG - Intergenic
1072290326 10:93959270-93959292 CATAAATACACGAAGGACCAAGG + Intergenic
1073822368 10:107279128-107279150 GATGATGAGTTGAAGGATCATGG - Intergenic
1073973733 10:109075418-109075440 CATGATTACATGATGGAAATTGG + Intergenic
1074628069 10:115216388-115216410 GGTGAGAACATGAAGGATCAGGG - Intronic
1076184192 10:128433866-128433888 CATGAGTGCATGAAAGATCCAGG + Intergenic
1077995559 11:7449501-7449523 AAAGTTTACATGAAGGATTAAGG + Intronic
1079804698 11:24915349-24915371 CATGATTATATGAGGAACCAAGG - Intronic
1079938016 11:26641988-26642010 CATCAGTCCATGAAGGTTCATGG - Exonic
1080610039 11:33896016-33896038 CCTAATTACTTGCAGGATCAAGG + Intergenic
1080820340 11:35799940-35799962 CATGATGAAATAAAGAATCATGG + Intronic
1081715181 11:45244997-45245019 CATGCTTACACCAAGAATCAAGG - Intronic
1083051566 11:59781641-59781663 GATGAATACATGAAGGAGCTAGG - Intronic
1085435841 11:76500775-76500797 GATGCTTAGATGAAGGAGCATGG + Intronic
1085935037 11:81131241-81131263 CATGATTTTATAAAGGAGCAAGG + Intergenic
1090144154 11:124301453-124301475 CATATTTACATTAAGTATCATGG - Intergenic
1090646709 11:128772386-128772408 AATGATTTCATGAAAGAACACGG - Intronic
1092060654 12:5547812-5547834 CAGGATCACAGGAAGGATGAGGG + Intronic
1092276393 12:7064368-7064390 CATGATGACATGAAGAATTGCGG + Exonic
1095293888 12:40506869-40506891 CATGACATCAGGAAGGATCATGG + Intronic
1095293954 12:40507536-40507558 CATGATTACCTGAAGACTAAAGG - Intronic
1095708533 12:45263653-45263675 CAGGATTACATGAAGAATGGGGG + Intronic
1095828718 12:46559599-46559621 CATGCTTACATGAAGATTCAGGG + Intergenic
1096872796 12:54604674-54604696 TGTGACTACAAGAAGGATCATGG - Intergenic
1097493031 12:60294538-60294560 TAGAATTACATGAAAGATCAAGG - Intergenic
1098557682 12:71838120-71838142 CAAGATTATATGAAGGTTCTAGG + Intergenic
1098616552 12:72532893-72532915 CATGATCATATGAAGGATATTGG + Intronic
1099765560 12:86978654-86978676 CATGATTAACTGAAGGAAAATGG + Intergenic
1101019580 12:100539888-100539910 CTTGATTGCAGGAAGGAGCAGGG + Intronic
1101730006 12:107419140-107419162 CATGATCACATGATGGGCCAGGG + Intronic
1103278802 12:119737068-119737090 CATGTTTACATGATGCATTAAGG - Intronic
1108598068 13:51966799-51966821 GATGAATACATGAAGGAGCTAGG + Intronic
1110224009 13:73100906-73100928 GATGAATACATGAAGGAGCTAGG - Intergenic
1110957761 13:81576915-81576937 CATGATTCCTTTAAGGATCACGG - Intergenic
1111077804 13:83262061-83262083 CATTTGTACATGAATGATCATGG - Intergenic
1111296560 13:86286946-86286968 CATTATTTCAGTAAGGATCATGG + Intergenic
1113823313 13:113231200-113231222 CATCATTACAAGAAGAATCCTGG + Intronic
1115709224 14:36031776-36031798 TTTGATTACATGAGTGATCAAGG + Intergenic
1120573192 14:86147480-86147502 TATGATTAAATTAAGGATCTTGG - Intergenic
1121210108 14:92202141-92202163 CATGATTATGTGAAGGCACAGGG + Intergenic
1121673313 14:95730621-95730643 GAAGATTACATGTAAGATCAAGG + Intergenic
1124782089 15:32645728-32645750 CATGGAGACATGAAAGATCATGG + Intronic
1125777193 15:42226838-42226860 CATGATGACAAAGAGGATCATGG + Exonic
1128189956 15:65682968-65682990 AATAATAACATCAAGGATCATGG + Intronic
1129055202 15:72814420-72814442 CTTGATGACATGCAGGATTAGGG - Intergenic
1133903886 16:10003175-10003197 CAAAAATAGATGAAGGATCAGGG - Intronic
1135661250 16:24298874-24298896 CATGATTACATGAAGGATCATGG + Intronic
1137389276 16:48067901-48067923 CATGATAGCATGGATGATCAGGG + Intergenic
1143236706 17:5408210-5408232 CAGGATTAAATGAAGTATCAAGG - Intronic
1145852613 17:28116255-28116277 CATCAGTACATGAAGGATATAGG - Intronic
1147347231 17:39808148-39808170 AATGATTACAAGAAGCATCATGG + Intronic
1147567476 17:41546621-41546643 TGTGATTACATTAAGGATCTTGG + Intergenic
1153446863 18:5182831-5182853 CAGGAGTACATGAAGAATCTAGG + Intronic
1156204705 18:34873044-34873066 GAGGATTACATGAAGTATTAGGG + Intronic
1156418370 18:36923290-36923312 CAGGATTATAATAAGGATCATGG + Intronic
1157769226 18:50330297-50330319 AATGTTTACATGAATGTTCATGG - Intergenic
1157999074 18:52595005-52595027 TAAGACTACCTGAAGGATCAAGG + Intronic
1159270455 18:66142391-66142413 CATGAAGACCTGAAGGATCACGG + Intergenic
1159838338 18:73368343-73368365 CATCATAACATGAAGGTACAAGG - Intergenic
1160618381 18:80151187-80151209 CATGAGTATATTAAGGATAATGG + Intronic
1161127597 19:2567252-2567274 CATCACTACAGGAATGATCACGG - Intronic
1162558518 19:11402359-11402381 CAGGAGTACAGGTAGGATCAAGG + Intronic
1165275601 19:34748429-34748451 CATGCTGACATGGAGGATCGTGG - Intergenic
1165321430 19:35087764-35087786 CATTTTTAGATGAAGGAACAAGG - Intergenic
927662923 2:25008116-25008138 TCTGTTTGCATGAAGGATCATGG + Intergenic
927676949 2:25113269-25113291 CATGAGATCATGAAAGATCATGG - Intronic
929892622 2:45930981-45931003 CAGGAGGAAATGAAGGATCAGGG - Intronic
933493925 2:83023790-83023812 TATAAATACATGAAGGAACAAGG - Intergenic
933993111 2:87647797-87647819 CATGCCCACATGCAGGATCATGG + Intergenic
935159576 2:100518080-100518102 CATGAGAACATGAAGGACCAGGG + Intergenic
935417095 2:102830406-102830428 CATGATTAGAGCTAGGATCATGG - Intronic
936300747 2:111303086-111303108 CATGCCCACATGCAGGATCATGG - Intergenic
936806716 2:116342055-116342077 CTTTATTACAAGAAGGTTCATGG - Intergenic
937187816 2:120061883-120061905 CATGCTTACATCAAGAACCAAGG - Intronic
940150200 2:150591811-150591833 CGTGGTTGCATGATGGATCATGG + Intergenic
943229448 2:185229234-185229256 CATGATGACAAGAAGGCACATGG + Intergenic
944032921 2:195259344-195259366 CATGATTACATTTAGTATAAGGG - Intergenic
944511427 2:200469861-200469883 CATGATTACAGAAATGACCAAGG - Intronic
945469048 2:210205958-210205980 CATGATGTTATCAAGGATCAGGG + Intronic
946492894 2:220167159-220167181 CATGTTTGATTGAAGGATCAAGG + Intergenic
946985865 2:225272192-225272214 GATGAATACATGAAGGAGAAAGG - Intergenic
1169354341 20:4894928-4894950 CTAGATTACAGGAAGGAACAAGG - Intronic
1172618078 20:36302816-36302838 CATGATTACATACAGCAACATGG - Intergenic
1173122756 20:40308701-40308723 CATGAAAACATGAAGGAAAATGG + Intergenic
1174204878 20:48831033-48831055 CATGATGTCATCAAGGATCATGG + Intergenic
1177148785 21:17433681-17433703 AATGAATAAATGAATGATCATGG + Intergenic
1177184443 21:17778194-17778216 AATGATTTGATGAAGGATCAAGG + Intergenic
1177562089 21:22769100-22769122 CATGATTCCATAAAGCATAAGGG + Intergenic
1177685333 21:24428856-24428878 CAAGCTGACATGGAGGATCAAGG + Intergenic
1180558322 22:16595409-16595431 GATGAATACATGAAGGAGCTAGG - Intergenic
1181296733 22:21846230-21846252 CAAGAGTACATAAGGGATCAGGG - Intronic
1181976432 22:26734001-26734023 CATGATTAAGTTAAGGATCTAGG - Intergenic
1184584929 22:45441510-45441532 CCTGGTTACAGGAGGGATCATGG + Intergenic
950680590 3:14582503-14582525 CTAGATTACAGGAAGGATTAAGG + Intergenic
951186397 3:19718733-19718755 AATGAATAAATGAAGGAACAGGG - Intergenic
952762638 3:36928252-36928274 CATGATTTCATGAAGCAACGTGG + Intronic
953085483 3:39661816-39661838 CATGAATACATGCAGCAACAGGG + Intergenic
954014431 3:47674243-47674265 CATGACTCCATGAAGGAATAAGG - Intronic
956017551 3:64899867-64899889 CATGATTGCCTGAAGGAAAAGGG - Intergenic
957816413 3:85304254-85304276 CTTGATTACATGAAGGAGTACGG - Intronic
960708102 3:120500759-120500781 TTTGATTGCATGAAGGATAAGGG + Intergenic
967073232 3:185980425-185980447 AATGGATAAATGAAGGATCAAGG - Intergenic
969683838 4:8657834-8657856 CATGAATAAATGAATGAACAGGG - Intergenic
970273630 4:14373272-14373294 CATGATTAAATAAAGTAACAAGG - Intergenic
973611842 4:52643416-52643438 CATAAGTAAATGAATGATCATGG - Intronic
973960338 4:56103616-56103638 CATTATTCCATAAAGGATAAGGG + Intergenic
974831117 4:67190932-67190954 CATGATTACATTAAACAACATGG + Intergenic
976035684 4:80817495-80817517 CATGATGACATAAGGGACCAAGG - Intronic
977005322 4:91561489-91561511 AATGACTACATGAGGGATCAGGG - Intronic
977351066 4:95888237-95888259 CATACATACATGAAGGAACATGG - Intergenic
979058972 4:116030540-116030562 CATGATGGCATGAAGGAGAAGGG - Intergenic
979383536 4:120036579-120036601 GTTGAGTAAATGAAGGATCAAGG + Intergenic
981648469 4:147027471-147027493 CATGATTAAGTGAAGCACCAAGG - Intergenic
982451723 4:155560717-155560739 CATAAAGACATGAAGAATCAGGG + Intergenic
983527420 4:168773399-168773421 CATGATTAAATAAAGGAGCATGG - Intronic
983590184 4:169400247-169400269 CATGACTAAATGAAGAATCTTGG + Exonic
984660052 4:182363252-182363274 CATACTCACATCAAGGATCAAGG - Intronic
986460773 5:7969538-7969560 CTTGATTAAATCAAGGATAAAGG + Intergenic
986910385 5:12548648-12548670 AATGATTACATGTGGGATCTAGG - Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
989216570 5:38910299-38910321 CAGTATTACATGAATTATCAGGG + Intronic
990075012 5:51833275-51833297 CATGATGACAGGCAGGATAATGG - Intergenic
990170422 5:53042487-53042509 GATGATTACTTGCAGAATCAAGG + Intronic
991616997 5:68507390-68507412 CATCATTAAATCAAAGATCAAGG - Intergenic
992623219 5:78613893-78613915 ACTGATTATATGAAGGATAATGG + Intronic
992786642 5:80176376-80176398 CATAACTATATGAAGGATTATGG + Intronic
994268174 5:97742790-97742812 CAAGATTACATGAAAATTCATGG - Intergenic
995326954 5:110900891-110900913 CATGCTTAGATGAATGGTCATGG + Intergenic
999982965 5:156975558-156975580 CATGTTTCCATTGAGGATCATGG - Intergenic
1000139214 5:158385167-158385189 CATGATTGCATGACAGAACATGG - Intergenic
1008454733 6:51696516-51696538 GATGATTACATAATGGATCAGGG - Intronic
1009283767 6:61786067-61786089 ACTGATTACATGAGGTATCAGGG - Intronic
1009286482 6:61825380-61825402 CATGATTAGATGCAGAATTATGG - Intronic
1014550080 6:122779846-122779868 GATGAGTACATGAAGGCTCTAGG + Exonic
1019038236 6:169080690-169080712 CATGACTACATAAAGGTTCATGG - Intergenic
1026172934 7:67970522-67970544 TATGATTACTTGAAGCCTCATGG - Intergenic
1026278081 7:68897758-68897780 CATTATTAAATGAAGCATCAAGG + Intergenic
1027277962 7:76581447-76581469 CACAATTTCATGAAAGATCAAGG + Intergenic
1027462299 7:78469817-78469839 GATGATTACAGGAAAGATGAGGG - Intronic
1028222137 7:88210176-88210198 AAGGATTAAATGAAAGATCAAGG + Intronic
1028538593 7:91916909-91916931 CATAATTTCAAGAAAGATCATGG + Intergenic
1030819026 7:114074082-114074104 CTTGATTGCATATAGGATCATGG + Intronic
1033674383 7:143524263-143524285 AATAATTACAAGAAGAATCATGG + Intergenic
1033697452 7:143805184-143805206 AATAATTACAAGAAGAATCATGG - Intergenic
1034035241 7:147812838-147812860 AATGAGCACATGATGGATCAAGG + Intronic
1034618993 7:152442600-152442622 GATGAATACATGAAGGAGCTAGG + Intergenic
1036499346 8:9298981-9299003 CATGATTAGCTGATGGGTCAGGG + Intergenic
1037124302 8:15326866-15326888 AATGATGACACCAAGGATCAAGG - Intergenic
1041695845 8:60735193-60735215 AATGATGACAGGAAGGATCTAGG + Intronic
1041988962 8:63961894-63961916 CATGATAACATGAACCATGATGG - Intergenic
1043330112 8:79105892-79105914 CCTGATTACATAGAGCATCAAGG + Intergenic
1043542633 8:81280653-81280675 GATGAATACATGAAGGAGCTAGG + Exonic
1046605630 8:116368688-116368710 GATGAATACATGAGGGTTCAGGG - Intergenic
1047624363 8:126640927-126640949 CATGATTTCATAGAGCATCAAGG + Intergenic
1052201065 9:25780925-25780947 CATAATTACATGAAGGGACGTGG + Intergenic
1054822682 9:69539156-69539178 GGTGATCACATGAAGGCTCATGG + Intronic
1056860706 9:90178436-90178458 CATCATTACATAAATGACCAAGG + Intergenic
1058850399 9:109006477-109006499 CAGGATTATGTTAAGGATCAAGG + Intronic
1059811908 9:117864638-117864660 CTGGATTACATCAAGGCTCAAGG - Intergenic
1060755879 9:126213033-126213055 ATTGATTACAGGAAGGATGAGGG + Intergenic
1061332468 9:129904279-129904301 CATGATTTCAGGAAGGATGTGGG - Intronic
1185766668 X:2731285-2731307 CATGGTTTCTTGAAGGACCAGGG - Intronic
1186718240 X:12276028-12276050 CCTTATTACAGGAAGGAGCAAGG - Intronic
1187598592 X:20801801-20801823 CATGATTACATGTAGGCTGTAGG - Intergenic
1189205150 X:39231593-39231615 CATGATTACATCTAGCATAACGG + Intergenic
1190472261 X:50794294-50794316 CATCATTCTCTGAAGGATCACGG - Intronic
1192617392 X:72641721-72641743 CATAATTCCATGAAGGAAAAAGG - Intronic
1193231448 X:79051623-79051645 CATGATAACATGGTGGCTCATGG + Intergenic
1197136532 X:123066755-123066777 GATAATTACATGTTGGATCATGG - Intergenic
1197175910 X:123485695-123485717 CAGGATTACATCAAGGCTCAGGG + Intronic
1197992862 X:132336713-132336735 CATTATTACATGAAGAAAAATGG - Intergenic
1198053679 X:132973158-132973180 AATGACCACATGAAGGAACAAGG - Intergenic
1199844559 X:151681239-151681261 GATGATTATATGATGGATCATGG - Intergenic