ID: 1135663479

View in Genome Browser
Species Human (GRCh38)
Location 16:24316420-24316442
Sequence ATTCTCTGCCTGCTCTAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 170}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135663470_1135663479 16 Left 1135663470 16:24316381-24316403 CCTTCAAGCCCCACCCCAAATGT 0: 1
1: 1
2: 4
3: 77
4: 612
Right 1135663479 16:24316420-24316442 ATTCTCTGCCTGCTCTAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 170
1135663474_1135663479 6 Left 1135663474 16:24316391-24316413 CCACCCCAAATGTCCGGCACACT 0: 1
1: 0
2: 0
3: 5
4: 78
Right 1135663479 16:24316420-24316442 ATTCTCTGCCTGCTCTAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 170
1135663472_1135663479 8 Left 1135663472 16:24316389-24316411 CCCCACCCCAAATGTCCGGCACA 0: 1
1: 0
2: 0
3: 11
4: 130
Right 1135663479 16:24316420-24316442 ATTCTCTGCCTGCTCTAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 170
1135663475_1135663479 3 Left 1135663475 16:24316394-24316416 CCCCAAATGTCCGGCACACTGAG 0: 1
1: 0
2: 1
3: 10
4: 78
Right 1135663479 16:24316420-24316442 ATTCTCTGCCTGCTCTAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 170
1135663473_1135663479 7 Left 1135663473 16:24316390-24316412 CCCACCCCAAATGTCCGGCACAC 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1135663479 16:24316420-24316442 ATTCTCTGCCTGCTCTAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 170
1135663478_1135663479 -7 Left 1135663478 16:24316404-24316426 CCGGCACACTGAGAGCATTCTCT 0: 1
1: 0
2: 1
3: 15
4: 186
Right 1135663479 16:24316420-24316442 ATTCTCTGCCTGCTCTAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 170
1135663476_1135663479 2 Left 1135663476 16:24316395-24316417 CCCAAATGTCCGGCACACTGAGA 0: 1
1: 0
2: 1
3: 6
4: 85
Right 1135663479 16:24316420-24316442 ATTCTCTGCCTGCTCTAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 170
1135663469_1135663479 21 Left 1135663469 16:24316376-24316398 CCTGTCCTTCAAGCCCCACCCCA 0: 1
1: 1
2: 2
3: 54
4: 526
Right 1135663479 16:24316420-24316442 ATTCTCTGCCTGCTCTAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 170
1135663477_1135663479 1 Left 1135663477 16:24316396-24316418 CCAAATGTCCGGCACACTGAGAG 0: 1
1: 0
2: 0
3: 8
4: 112
Right 1135663479 16:24316420-24316442 ATTCTCTGCCTGCTCTAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135663479 Original CRISPR ATTCTCTGCCTGCTCTAAAG TGG Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
902138081 1:14328076-14328098 ATTTTCCGCCTGGTCTATAGTGG - Intergenic
903002362 1:20275383-20275405 ATTCTCTCCCTCCCCTAAAGAGG + Intergenic
905642013 1:39596591-39596613 CTTCTCTGCGTGCTCTGAAAGGG - Intergenic
906024243 1:42659273-42659295 CTTCTTTGCCTGCTCCAGAGGGG + Intronic
908311463 1:62888763-62888785 CTACTCTGCCTGCTCTATAGAGG + Intergenic
908387044 1:63652752-63652774 ATTCACTGCCTGCTCCCCAGAGG - Intronic
909711027 1:78649101-78649123 ATTACCTGCCTGCCCTAAAAAGG - Intergenic
912275023 1:108247229-108247251 ATTCAATGCATTCTCTAAAGTGG - Intergenic
912293199 1:108447122-108447144 ATTCAATGCATTCTCTAAAGTGG + Intronic
915191947 1:154158438-154158460 CCACTCTGACTGCTCTAAAGAGG + Intronic
915640237 1:157219071-157219093 ATCCTTTGACTTCTCTAAAGAGG - Intergenic
918445020 1:184608943-184608965 GTTCTCTGCCTTCTAGAAAGAGG + Intronic
919792397 1:201300522-201300544 ATTCTCTCTGGGCTCTAAAGGGG - Intronic
919799088 1:201341350-201341372 TTTTTCTGCCTGCTTTCAAGAGG + Intergenic
920507608 1:206527535-206527557 ACTGTCTGCCTGCTCTGAATTGG - Intronic
922239464 1:223746117-223746139 ATCCACTTGCTGCTCTAAAGTGG - Intronic
923082340 1:230670191-230670213 ATACTCTGGCTGCTCAGAAGTGG - Intronic
923979052 1:239299795-239299817 TATTTCTGCCTGCACTAAAGAGG - Intergenic
1063581356 10:7310513-7310535 ATTCTCTATCTGTTCTAATGAGG + Intronic
1066474214 10:35728933-35728955 ATTTTTTGCCTGCTCTATTGTGG - Intergenic
1070385837 10:75923693-75923715 TTTCTCTGCTTGTTCTAAATAGG + Intronic
1071413782 10:85422165-85422187 ACTCTATGACTGCTCTAAAGCGG - Intergenic
1074726137 10:116311869-116311891 ATTCTCTTACAGTTCTAAAGGGG - Intergenic
1076101930 10:127788762-127788784 CTTCTCTGCCTCCTATGAAGTGG + Intergenic
1076195132 10:128512370-128512392 ATTCTCTCCCTGGTGAAAAGTGG - Intergenic
1078346333 11:10552747-10552769 ATGCTCTGCTTCCTCAAAAGTGG - Intergenic
1080099553 11:28443752-28443774 ATTCTCTACATACTCTCAAGTGG - Intergenic
1081311022 11:41572586-41572608 ATTCTCTGAATGCTGTACAGAGG - Intergenic
1081595824 11:44458775-44458797 ATTCTCTGCTTCCTCTTAGGTGG + Intergenic
1081748778 11:45492507-45492529 ATTGTCTGCTTTCTCTAAAGTGG + Intergenic
1082803178 11:57429274-57429296 ATTCAGTGCCTGCTCTCAAGGGG + Intergenic
1085910576 11:80820232-80820254 ACTCTGTGGCTGCTCTCAAGAGG + Intergenic
1086583570 11:88426512-88426534 ATACTCTGCCTCCTATAAAGGGG + Intergenic
1086626150 11:88956265-88956287 ATTCTCTGACTGCTCTACTTTGG - Intronic
1088082638 11:105937698-105937720 AAACTTTGCCTCCTCTAAAGAGG + Intronic
1088565934 11:111173151-111173173 ATTCTCTGACTGGTCAAATGAGG + Intergenic
1090046058 11:123334738-123334760 ATCCTCTGCTTACTCGAAAGTGG + Intergenic
1094426686 12:30323406-30323428 AGTCTCTGCCTGCACTCAAAAGG - Intergenic
1095952828 12:47790898-47790920 CTGCTCTGTCTGCTCTTAAGTGG - Intronic
1096531414 12:52244880-52244902 ATTCTGCGCCTGCTCTCAACTGG + Intronic
1097626582 12:62009441-62009463 ATCTTCTGTCCGCTCTAAAGAGG - Intronic
1105031132 12:132884637-132884659 TCTCTCTGCCTCCTCTTAAGAGG - Intronic
1105270769 13:18873536-18873558 AATACCTGCCTTCTCTAAAGGGG + Intergenic
1106038781 13:26069772-26069794 ATCCTCTGGCTGCTCTGAGGAGG + Intergenic
1107445733 13:40469085-40469107 ATCCTCTGCCTCCTCTAAGACGG - Intergenic
1108592969 13:51926732-51926754 ATCCTCTGAATGCTCTAAGGTGG + Intergenic
1110949979 13:81473926-81473948 CTTCTCTGTCTTCTCTAAACAGG - Intergenic
1112253669 13:97807663-97807685 ATTCTCTGCTTGCTCCAATGGGG + Intergenic
1112451924 13:99520387-99520409 ATGCTCTGCCTCCTTTACAGAGG + Intronic
1113313477 13:109154982-109155004 ATTCTGTCCCTGCCATAAAGGGG - Intronic
1118902273 14:69996473-69996495 ATTCTCTGCATGTAGTAAAGTGG + Intronic
1119647661 14:76359988-76360010 ATTTTCTGACTTCTGTAAAGGGG + Intronic
1120168738 14:81227916-81227938 ATTCCCTGCTGGCTCTGAAGAGG + Intergenic
1121467925 14:94127990-94128012 ATTCTCTGTCTCCTCCACAGGGG - Exonic
1122460924 14:101894074-101894096 TTTCTCTGACTGCTCTTAACTGG + Intronic
1123688271 15:22816015-22816037 ATTTTCTTCCTGATCTTAAGGGG - Intronic
1129753069 15:78079456-78079478 ACTCTCTGCAGGCCCTAAAGTGG + Intronic
1131982108 15:98004275-98004297 CCTCTCTGCCTGTTCTAAATGGG - Intergenic
1135461426 16:22646851-22646873 AGGGTCTGCCTGATCTAAAGAGG - Intergenic
1135663479 16:24316420-24316442 ATTCTCTGCCTGCTCTAAAGTGG + Intronic
1136249421 16:28994225-28994247 CTTCTCTGTCTGCTCTTAAGCGG - Intergenic
1136249578 16:28995399-28995421 CTTCTCTGTCTGCTCTTAAGTGG - Intergenic
1137559732 16:49494966-49494988 ATTTTCTTCCTTCTCTAAAGGGG - Intronic
1137650302 16:50114351-50114373 ATTTTCTCCTTGCTTTAAAGAGG + Intergenic
1138495318 16:57405378-57405400 AGTCTCTGCCTGATGTAATGTGG + Intronic
1147450737 17:40502342-40502364 ACTCTCTCCCTGTTCTAGAGGGG + Intergenic
1147818602 17:43228397-43228419 ATTCCCTTCCTGCTCCAGAGAGG + Intergenic
1147831885 17:43303099-43303121 ATTCCCTTCCTGCTCCAGAGAGG + Intergenic
1148562893 17:48616340-48616362 ACTCTCTGCTTGCTGAAAAGGGG + Intronic
1151020314 17:70608758-70608780 ATTCTCTGCTTCCTTTACAGTGG + Intergenic
1153626722 18:7028374-7028396 TTTCTCTGCCTGCTGTTAGGAGG - Intronic
1154530775 18:15342609-15342631 ATTCTGAGACTTCTCTAAAGGGG + Intergenic
1156067207 18:33158189-33158211 TTTCTGTGCCTTCCCTAAAGGGG + Intronic
1156906078 18:42353618-42353640 ATCCTCTACATTCTCTAAAGTGG - Intergenic
1158818292 18:61129277-61129299 CCTCTCTGCCTGCTCTGCAGAGG + Intergenic
1162541747 19:11300833-11300855 AATCTCTGTCTGCACAAAAGGGG - Intronic
1162940140 19:14004607-14004629 AGTCCCTGCCTCCTCTAAAAAGG + Intronic
1167407099 19:49318156-49318178 ATTCTTTGCCTGTTCTTATGAGG - Intronic
926358592 2:12064236-12064258 ATTCTCTGCATGCTCTGACCAGG + Intergenic
926913518 2:17872765-17872787 AGTTTCTGCCTGCTGAAAAGTGG - Intergenic
926992033 2:18690361-18690383 GTTCTGTGCCAGCTCTGAAGGGG - Intergenic
927884133 2:26708047-26708069 ACTCTCTACTTCCTCTAAAGTGG - Intronic
929065729 2:37973196-37973218 AGACTCTGCCTGTTCTAAAAAGG - Intronic
938529868 2:132174076-132174098 ATTCTGAGACTTCTCTAAAGGGG + Intronic
941144620 2:161828835-161828857 ATCCACTGCATGCTCTAGAGAGG - Intronic
941206736 2:162582418-162582440 ACTTTCTGCCAGTTCTAAAGTGG - Intronic
942387527 2:175458177-175458199 TTTTTCTGCCTGCTCAAAAAAGG - Intergenic
942402699 2:175620574-175620596 ATTCTCTGACTGATCTAAAATGG + Intergenic
945617306 2:212088313-212088335 ATTCCCAGACTCCTCTAAAGTGG - Intronic
1172799763 20:37567608-37567630 ATTCTCTGGCAGCCCTGAAGGGG + Intergenic
1173299268 20:41786433-41786455 CTTCATTGCCTGCTCTACAGTGG - Intergenic
1174668443 20:52282859-52282881 ATTCTCTGTCGGCTCTAGAAAGG - Intergenic
1175023832 20:55880519-55880541 ATTCCCTGCCAGCTCTGCAGAGG + Intergenic
1176766635 21:13025856-13025878 ATTCTGAGACTTCTCTAAAGGGG - Intergenic
1176976892 21:15332707-15332729 ATTCTCTTCCTGCCCACAAGAGG - Intergenic
1178165340 21:29968428-29968450 ATTCTTTGTCTGTTCTAATGGGG - Intergenic
1178310229 21:31524033-31524055 GTACTCTGCCTGCTCTGCAGGGG + Intronic
1178911897 21:36681462-36681484 ATGCTCTGCCAACTCCAAAGAGG + Intergenic
1178970877 21:37175740-37175762 ATTCTCTGCCGGCGGAAAAGTGG + Intronic
1179470167 21:41605081-41605103 ATGCTGTGCCTGCTCTGAACTGG - Intergenic
1181925476 22:26355216-26355238 CTTCTTTGCCTGCTTTTAAGTGG - Intronic
1182710397 22:32319077-32319099 ACTCTCTGCCTGCCTTTAAGTGG + Intergenic
1183093881 22:35540978-35541000 CTTCTCCGCCTGCCCCAAAGGGG - Exonic
1183192828 22:36332604-36332626 ATTCTCTGCCTCCTATAAGTGGG - Intronic
1183340656 22:37279090-37279112 ATTCTCTTCATGGTCCAAAGTGG - Intergenic
1184547501 22:45181476-45181498 AAGCTTTGCCTGCTCTCAAGTGG + Intronic
1185279779 22:49965110-49965132 CCTCTCTGCCTGCTCTCCAGGGG - Intergenic
950000162 3:9650229-9650251 GTTGTCTTCCTGCTCTATAGGGG - Intronic
954193904 3:48984656-48984678 CTGCTCTGCCTGCCCTAGAGTGG - Exonic
956002138 3:64740915-64740937 ATTTTCTTCTTGCTCTAAACAGG - Intergenic
956065955 3:65397418-65397440 TTGCTATGTCTGCTCTAAAGAGG + Intronic
956358161 3:68416812-68416834 ATTGCCTGCCTACTCTCAAGGGG - Intronic
957277656 3:78109649-78109671 TTTGTCTGCCTGCTTTAAATTGG + Intergenic
958647593 3:96892145-96892167 ATTCTCTGCCTCCTATGATGTGG - Intronic
958792755 3:98670823-98670845 ATTTTTTTCCTGCTCTAAAGAGG + Intergenic
959988196 3:112600282-112600304 CTTCTCTGCCTGCTCATTAGAGG + Intergenic
963683240 3:148407750-148407772 AACTTCTGCCTGCTCGAAAGTGG - Intergenic
966961732 3:184946499-184946521 ATTATCTGCCTGTTCAAAAACGG - Intronic
968430266 4:554296-554318 ATTCTGTGCCTCCTCCACAGTGG + Intergenic
969479402 4:7440020-7440042 ATTCTCTGCATTTTCTGAAGGGG - Intronic
971713757 4:30149991-30150013 ATACTCTTCCTGCTCTCCAGTGG + Intergenic
973800626 4:54474292-54474314 ATTCTCTCAGTTCTCTAAAGTGG - Intergenic
975225251 4:71864233-71864255 ATTTTTTGCCTGCTATAAATCGG - Intergenic
978347352 4:107785928-107785950 ATTCTCTGTCATCTCTAAAAGGG + Intergenic
980324842 4:131328973-131328995 ATTCCCTGCATGCACTAAGGAGG + Intergenic
981017256 4:139987093-139987115 CTTTTCTGCCTGGTCTACAGTGG - Intronic
981084083 4:140665406-140665428 ATCCTTTGCCTGCTCTTAATTGG - Intronic
981791537 4:148542522-148542544 ATGCTATCCCTGCTCTGAAGTGG + Intergenic
982923812 4:161309683-161309705 ATACTATGCCTGCTCTATTGAGG - Intergenic
985579784 5:690533-690555 ATTCTCTGCGTCCTCTGCAGGGG + Intronic
985594630 5:782592-782614 ATTCTCTGCGTCCTCTGCAGGGG + Intergenic
988818153 5:34854553-34854575 ATCCTCTAACTGCTTTAAAGTGG + Intronic
989298776 5:39863756-39863778 ATTATCTGGCTGATCTTAAGAGG - Intergenic
991166572 5:63570135-63570157 TTTCTATCCCTGCTCTGAAGAGG - Intergenic
992158223 5:73975450-73975472 AGTTTCTGCCTGCGCTGAAGGGG + Intergenic
992501899 5:77351395-77351417 ATTCCCAGTGTGCTCTAAAGGGG + Intronic
993223228 5:85130829-85130851 ATTCTCTACTTTCTTTAAAGAGG - Intergenic
994238861 5:97396501-97396523 ATTCTCTTCCTGCTGCAGAGAGG + Intergenic
995541457 5:113190237-113190259 GTTCACAGCCTGCTCTAAACTGG + Intronic
999498400 5:152123130-152123152 TGTTTCTGCCCGCTCTAAAGAGG - Intergenic
999809436 5:155114099-155114121 ATTCTCTGCCTCCATTAAAGAGG - Intergenic
1003762314 6:9193603-9193625 TTTCTCTTCCTGCTTGAAAGGGG - Intergenic
1007535402 6:42583194-42583216 AATCTCTGCCTTCTCTCAAATGG + Intronic
1009675815 6:66819212-66819234 ATTCAGTGCCTGTTATAAAGTGG - Intergenic
1009974286 6:70656575-70656597 AATCTCTGCCTATTCTAAGGTGG + Intergenic
1010852438 6:80794606-80794628 CTTCTCTGTCTGCTTTCAAGAGG - Intergenic
1011149620 6:84255996-84256018 ATTCTGTGTCTGATATAAAGTGG - Intergenic
1013486990 6:110606711-110606733 CTTCTCTCCCTCCTCTATAGAGG - Intergenic
1014289027 6:119536983-119537005 ATTCTTTGCATGTTCAAAAGAGG + Intergenic
1014672329 6:124320986-124321008 ATACGCTGCCTGCTCTTATGTGG - Intronic
1017932669 6:158972406-158972428 GTTCTCTGCCAGCTCTGTAGGGG - Intergenic
1021058134 7:16076282-16076304 CTTCTCTCCCTGCTATACAGGGG + Intergenic
1021921880 7:25494060-25494082 ATTCTCTGCTTCCTTTCAAGAGG + Intergenic
1022805685 7:33819968-33819990 AAGCTCTGCCTGTTATAAAGTGG - Intergenic
1024376502 7:48644741-48644763 ATACTATACCTGCTCCAAAGTGG - Exonic
1030855920 7:114557435-114557457 ATGCTCTGAATGCTCTAAATAGG + Intronic
1031881209 7:127200597-127200619 GTTCTCTGCAGGCTCTAGAGAGG + Intronic
1032101190 7:128979322-128979344 ATGCTCTTCCAGTTCTAAAGAGG - Intronic
1033010810 7:137620480-137620502 CTTTTCTGCCTTCTCTAAACCGG - Intronic
1034115288 7:148578696-148578718 ATCCAGTGCCTCCTCTAAAGTGG + Intergenic
1036975525 8:13406783-13406805 ATTCTTAGTCTGCTTTAAAGAGG - Intronic
1037588798 8:20295991-20296013 ATTATATTCCTGCTGTAAAGAGG - Intronic
1038191563 8:25325750-25325772 TTTTTCATCCTGCTCTAAAGTGG - Intronic
1041653522 8:60325290-60325312 TCTCTCTACCTGCTCGAAAGGGG + Intergenic
1045784398 8:105903584-105903606 ATTCTCACACTGCTATAAAGTGG + Intergenic
1049839793 8:144763608-144763630 GTTCTCTGGCTGCTCTATGGCGG + Intergenic
1050200239 9:3137668-3137690 ATAGTCTGCCTGCACTAAAGGGG + Intergenic
1050245246 9:3682403-3682425 CTTCTCTGCCAGATCTAAATTGG - Intergenic
1053708474 9:40780350-40780372 ATTCTGAGACTTCTCTAAAGGGG + Intergenic
1054418383 9:64901145-64901167 ATTCTGAGACTTCTCTAAAGGGG + Intergenic
1055833360 9:80409264-80409286 CTTCTCTGCCTGATACAAAGAGG - Intergenic
1056323333 9:85457198-85457220 ATTCTAAAACTGCTCTAAAGAGG - Intergenic
1056933701 9:90899268-90899290 AATTTCTGCCTGTTCTAAGGAGG + Intergenic
1060220635 9:121762395-121762417 ATTCTCTGAATACACTAAAGCGG - Intronic
1060709605 9:125845551-125845573 ATTCCCTGCCTGCCCTACAAGGG + Intronic
1061590669 9:131595609-131595631 CTTCACTGCCTGCCCTCAAGGGG - Intronic
1189559871 X:42181539-42181561 ATTATCTGTCTGCACAAAAGAGG + Intergenic
1190940446 X:55035290-55035312 TTTCTCTGCCTGCTGAATAGGGG - Intergenic
1191802550 X:65097461-65097483 ATTTTCTGCCTTTTCTAAAATGG - Intergenic
1192192220 X:68998098-68998120 ATTCTGGGCCTGCTCCCAAGTGG - Intergenic
1193272227 X:79543166-79543188 GTTCTCTGCATACTCCAAAGGGG + Intergenic
1193968892 X:88025588-88025610 ATGCTCTGCCTCCTTTAAGGTGG - Intergenic
1197346921 X:125335471-125335493 ATTCTGTGACTGTTCTAAGGTGG + Intergenic
1197447773 X:126572160-126572182 ATCCACTGCCTGATCTAAGGTGG + Intergenic