ID: 1135664575

View in Genome Browser
Species Human (GRCh38)
Location 16:24325150-24325172
Sequence CTGTGTCTACTGGGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 272}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135664575 Original CRISPR CTGTGTCTACTGGGGGAAGA GGG Intronic
900119862 1:1043967-1043989 CTGTGTCTGCTGGAGGCAGGCGG - Exonic
900173792 1:1283192-1283214 CTGTGCCTACTCGGGGGAGCAGG + Intronic
900691442 1:3982921-3982943 CTGTGGGTACAGGGAGAAGATGG + Intergenic
901811171 1:11767403-11767425 CTGTCCCTGCTGGGGGATGAAGG + Intronic
902239717 1:15080449-15080471 CTGTGGCTGCTGGGGGCTGATGG - Intronic
903682087 1:25103810-25103832 CAGTTTCTACTGGGGTAAGCTGG - Intergenic
904826510 1:33276799-33276821 TCGTGTCCACTGGGGGGAGAAGG - Intronic
904983126 1:34523423-34523445 CTGTGTGTACTGGGGACAGGGGG - Intergenic
905361074 1:37420836-37420858 CTGTGGATACTGAGGGATGATGG - Intergenic
906130201 1:43451303-43451325 CTGTGTCTCCTGCAGGGAGAGGG + Exonic
906200541 1:43957388-43957410 CTCTGTGTGCTGGGGAAAGAGGG - Exonic
906294774 1:44642841-44642863 CTGCGTGTACTTGGGGAAGGGGG + Intronic
906320184 1:44810796-44810818 CTGTGTGTGCTGTGGGAAGAGGG + Intronic
907924692 1:58944488-58944510 GTGTGTGTACTGGGGCAAGGGGG - Intergenic
912485603 1:110025191-110025213 GTATGTGCACTGGGGGAAGAGGG - Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
914406341 1:147377494-147377516 CTGTGGCTCTTGGAGGAAGAAGG - Intergenic
916764499 1:167847218-167847240 CTGTGTCTACTAATGTAAGAAGG - Intronic
919786465 1:201261463-201261485 CTGGAGCTACTGGGGGAAGAGGG - Intergenic
920016743 1:202917217-202917239 CTGTCTCTTGCGGGGGAAGAAGG - Intronic
921388358 1:214594141-214594163 CTGTTTCTAAGGGGGGAAAAGGG + Intergenic
923390866 1:233513768-233513790 CTGTGTCTTCATGTGGAAGAAGG + Intergenic
923786318 1:237072026-237072048 CTGACCCTGCTGGGGGAAGAGGG + Intronic
924273465 1:242359345-242359367 CTGTGGCAACTTGAGGAAGAGGG + Intronic
924825455 1:247533371-247533393 ATGTGTCACCTTGGGGAAGAGGG - Intronic
1062823371 10:551103-551125 CAGTGTCTAGTGAGGGCAGAGGG - Intronic
1064551978 10:16511047-16511069 GTGCGTCTCCTGGTGGAAGAGGG + Exonic
1065324175 10:24536063-24536085 CTGTGTCTACAGGGCTAAAAAGG - Intronic
1065474378 10:26118503-26118525 CTGAGTGGACTGGGGCAAGATGG - Intronic
1066364467 10:34763434-34763456 CTGTGTCCTCTGGGGGAAGGTGG + Intronic
1066365973 10:34777284-34777306 CTGAGTCCACCAGGGGAAGAGGG - Intronic
1066711252 10:38237309-38237331 CTGTGGCAACTTGAGGAAGAGGG - Intergenic
1067074418 10:43166386-43166408 TTGCGTCTCCTGAGGGAAGATGG + Intronic
1067529140 10:47057842-47057864 TTGTGTCAAGTGAGGGAAGAGGG - Intergenic
1069421377 10:68249604-68249626 TTGTGTCTACTAGAGAAAGAAGG + Intergenic
1070550786 10:77489024-77489046 CTCTGCCTAGAGGGGGAAGATGG - Intronic
1070766714 10:79061006-79061028 CTGTGTCCACAGGAGGAAGGGGG + Intergenic
1070788766 10:79177415-79177437 CTTTGTCAACTGGGGGCACAGGG - Intronic
1071336398 10:84604012-84604034 TGGTGTCCACTGGAGGAAGACGG + Intergenic
1071492280 10:86144018-86144040 CAGTGAGTACTAGGGGAAGAAGG - Intronic
1071769662 10:88713053-88713075 CTGTGTCTCCTGTGTGATGATGG - Intergenic
1072623577 10:97096706-97096728 CTGGGTTTGCTGGGGGAAGGGGG - Intronic
1074473216 10:113745888-113745910 GTGTGTGTATTGGGGGAAGCAGG + Intergenic
1074499806 10:114012971-114012993 CTGAGTCTACTGGGGGACCCTGG - Intergenic
1076374122 10:129972408-129972430 GCGTTTGTACTGGGGGAAGACGG + Intergenic
1077046578 11:549350-549372 CTGTGGCTACAGTGGGAACAGGG + Intronic
1077488451 11:2849812-2849834 CTGAGTCCACTGGGGGCAGGAGG + Intergenic
1077524298 11:3055079-3055101 CTGAGTCAACTTAGGGAAGATGG + Intronic
1077774795 11:5258847-5258869 CTGTGGCTACTGTGGGAGGATGG - Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1079173052 11:18114490-18114512 CTGTGGCTGCTGGGGGCAGGGGG + Intronic
1082278565 11:50246629-50246651 CTATGGCCACTGGGTGAAGAAGG - Intergenic
1083276136 11:61598097-61598119 CTGGGTCTGCAGGGGGAAGTGGG - Intergenic
1083632582 11:64103455-64103477 CTGTGTCTCCGGGGGAAAGGAGG - Exonic
1084536598 11:69761023-69761045 GTGTGTGTACTGGGGGAACAGGG - Intergenic
1084585922 11:70062463-70062485 CTGTGTCTACTGGGGGGTGCAGG - Intergenic
1085351487 11:75800787-75800809 CTCAGTCTTCTTGGGGAAGAAGG + Exonic
1085970275 11:81581150-81581172 CTTTCTCTAGTGGGGGATGAAGG - Intergenic
1091240543 11:134049328-134049350 CAGTGCCGTCTGGGGGAAGAAGG + Intergenic
1091312240 11:134582870-134582892 CTGTGTCTGCTCAGGGAAGAAGG - Intergenic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1094110450 12:26856327-26856349 CTTTGTCTGCTGTGTGAAGAAGG + Intergenic
1095133268 12:38568130-38568152 TTCTTTCTACTGGGGGAAGGTGG - Intergenic
1096183477 12:49564052-49564074 CTGTGGCTACTGGAGCTAGAAGG + Intronic
1096981442 12:55729873-55729895 CTTTGTCTTCTGGGATAAGACGG - Intergenic
1098590240 12:72202479-72202501 CTATTTCTACTGTGGGAAGCTGG + Intronic
1099921601 12:88964511-88964533 CTGTGTGTCCAGGGGCAAGAAGG - Intergenic
1101348888 12:103909811-103909833 TAGTGCCTATTGGGGGAAGAGGG - Intergenic
1102254487 12:111407604-111407626 CAGGGCCTACTGGGGGAAGTTGG + Intronic
1105672920 13:22640814-22640836 CTGTGACTATTGAGGAAAGACGG - Intergenic
1105707977 13:22980596-22980618 CTGTGTCTCCTGGAGGAGGCTGG + Intergenic
1109658822 13:65431421-65431443 GTGTGTGTACTGGGGGCAGAGGG + Intergenic
1112025202 13:95405364-95405386 CTGTGTCTTCTGGTGGAGGAGGG + Intergenic
1113336082 13:109377215-109377237 GTGTGTCTGCTGAGGCAAGAGGG - Intergenic
1114526766 14:23371397-23371419 CTGCGAGTACTGGGGGCAGAGGG + Intergenic
1116899527 14:50348518-50348540 CAGAGTCTAGTGAGGGAAGAGGG - Intronic
1117183543 14:53217346-53217368 CTGTGTCTAGTGGGAGAGGGGGG - Intergenic
1118040013 14:61906208-61906230 CTGTGTCTACTGGTGAATGTGGG + Intergenic
1118367631 14:65109228-65109250 CTGTGGCTACTGGTGGAGAATGG - Intergenic
1118773366 14:68957294-68957316 AGGTGTCTCTTGGGGGAAGAGGG - Intronic
1118787703 14:69059820-69059842 ATGTGCCTCCTGGTGGAAGAGGG + Intronic
1120186815 14:81402064-81402086 AGGTATCTACTGGGGGAATATGG + Intronic
1120577708 14:86204263-86204285 CTGGCCCTACTGGGGCAAGAAGG + Intergenic
1120858466 14:89233603-89233625 CTGTGTTTACTGGGAGTGGAGGG - Intronic
1121115202 14:91338447-91338469 CTGTGTGTCCTGGGGGTAGCAGG - Intronic
1122175819 14:99918076-99918098 GTGTGTCTAGTGGAGGTAGAGGG - Intronic
1122635852 14:103129339-103129361 CTCTGGCTGCTGGGTGAAGAAGG + Intronic
1123123861 14:105930480-105930502 CTGTGTTTCCTTGGGGATGAGGG + Intronic
1123166131 14:106326769-106326791 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1123168826 14:106351804-106351826 CTGTTACTCCTGAGGGAAGATGG - Intergenic
1125418189 15:39474978-39475000 CTGTGTCTGCTGGGGCAAAGAGG + Intergenic
1126805080 15:52340054-52340076 CTGTCTCTGCTGGAGTAAGAGGG + Intronic
1128578280 15:68790954-68790976 CTGTGACTTCTGGGGAGAGAGGG - Intronic
1129291061 15:74568043-74568065 CTCTGTCTTCTGGGGGAAGATGG + Intronic
1130520309 15:84656840-84656862 CTGTGTAGACTGGGGGAGAAAGG + Intronic
1130691778 15:86087866-86087888 AAGTGTCTGCTGGGGAAAGATGG + Intergenic
1131406803 15:92171763-92171785 CTGTGCCTAAAGGGGGAGGAGGG - Intronic
1131819180 15:96254753-96254775 CTGTTGCTACTGGTGGAAGAGGG + Intergenic
1132253112 15:100349631-100349653 CTCTGTCTATAGGTGGAAGAAGG + Intergenic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1133305214 16:4804179-4804201 CTGTCTCCACGGGAGGAAGAGGG + Exonic
1135496604 16:22956912-22956934 CTGTGGCTCCTGGGGAGAGAGGG + Intergenic
1135551208 16:23399579-23399601 ATGTGTCTGCAGGGGGGAGAGGG - Intronic
1135664575 16:24325150-24325172 CTGTGTCTACTGGGGGAAGAGGG + Intronic
1136186293 16:28590759-28590781 GTGTGTCTCCTGGGGGAAGAGGG - Exonic
1136188667 16:28602472-28602494 GTGTGTCTCCTGGTGGTAGAGGG - Intergenic
1136191137 16:28615466-28615488 GTGTGTCTCCTGGTGGTAGAGGG - Intronic
1141466906 16:84212271-84212293 CTGTGTCAACAGGGCGAGGAAGG - Intergenic
1141864688 16:86741974-86741996 GTTTGTCTGCTGGAGGAAGAGGG - Intergenic
1143480267 17:7224130-7224152 CTTTGTCCTATGGGGGAAGAGGG - Exonic
1143987404 17:10926714-10926736 CTGATGCTACTGGGAGAAGAGGG - Intergenic
1144783939 17:17821603-17821625 CTCAGTTTACAGGGGGAAGAGGG + Intronic
1145738926 17:27255786-27255808 ATGTGACTACTGGGGGAAACTGG + Intergenic
1145956868 17:28860717-28860739 CTGTGTCTTCTGTTGGAAGAAGG + Exonic
1146330922 17:31926504-31926526 CTCTGTCTACTGGGAGAGGCTGG + Intergenic
1146720149 17:35118474-35118496 GTGTGTGTACTTGGGGAAGAAGG - Intronic
1146755237 17:35425431-35425453 TAGTGGTTACTGGGGGAAGATGG - Intronic
1146978863 17:37140960-37140982 CAGAGGCTACTGGGAGAAGAAGG - Intronic
1147210456 17:38870023-38870045 CTGTGTTTATTAGGGGAAGGAGG + Exonic
1148518695 17:48247687-48247709 CTGAGTTTACTGGGGGAAAAAGG - Intronic
1148846983 17:50535098-50535120 CTGTGGCTACTGGGGGGAATTGG + Intronic
1149238139 17:54616948-54616970 TGGTGTTTACTGGGGGAAAAAGG + Intergenic
1149902140 17:60490289-60490311 ATGTGACCACTGGGGGAAGCTGG + Intronic
1150333385 17:64312496-64312518 CTGTGTATACTCGGGGACTAAGG + Intergenic
1151905291 17:77044147-77044169 CTGTGTGCACTGTGGGCAGAGGG + Intergenic
1152559632 17:81071532-81071554 CTTTCTCTGCTGGTGGAAGAGGG - Intronic
1153181353 18:2438363-2438385 TTGTGGCTACTGTGGGAAAAAGG + Intergenic
1153871368 18:9323417-9323439 CAGTGTGTATTGGGGGAGGAGGG - Intergenic
1155060425 18:22223511-22223533 CTGTGCGTGCTGGGGGAACAAGG + Intergenic
1156465546 18:37346131-37346153 CTATGTCTGCTGGAGGATGAGGG + Intronic
1157327317 18:46678539-46678561 CTGTGTCTTCTGGGGGTGCAGGG - Intronic
1157788521 18:50508439-50508461 TTGTGTCTTTTGGGGGAACATGG + Intergenic
1158067775 18:53433767-53433789 GTGTGTGTACAGGGGGAAGGTGG - Intronic
1161399483 19:4061020-4061042 CTCTGTCTCCTGGGGGATGGGGG + Intronic
1161690026 19:5726775-5726797 ATGTGACTGCTGGGGGAAGCTGG - Intronic
1161914425 19:7218012-7218034 CTGTCTCCACTGTGGGAGGATGG + Intronic
1162030359 19:7914640-7914662 CTGTGGCCACTGGGGGCAGGGGG - Intergenic
1162312865 19:9917523-9917545 CTGTGTCTGCTTGGGGTGGAGGG + Intronic
1162500216 19:11049131-11049153 CAGTGTCCACTGGGAGGAGAGGG + Intronic
1162580727 19:11528773-11528795 CTGGGTCTCTTGGGGGAAAAAGG + Intronic
1163255943 19:16155930-16155952 CTGTGGCTACTGGCTGCAGAAGG + Intronic
1164978818 19:32596792-32596814 CTGTGCCTACTGGGTTAAGTAGG + Intergenic
1165040164 19:33063380-33063402 CTGTGTCACCTGGGAGAAGGAGG + Intronic
1165310064 19:35024379-35024401 CTGAGTCTACTGGGGCCTGAGGG - Intronic
1166283584 19:41810448-41810470 CTGTGTGTTTTGGGGGAAGGTGG - Intronic
1167384063 19:49153830-49153852 CTGTGTGTCCTGGGGGGTGATGG + Exonic
1202707046 1_KI270713v1_random:31730-31752 CTGTGGCTTCTGACGGAAGAAGG - Intergenic
925036697 2:692558-692580 CTGTCTCTATAGGAGGAAGAGGG + Intergenic
930028248 2:47042954-47042976 CTGTGACTCCTGGGGGAAGCTGG - Intronic
931198153 2:60072764-60072786 CGGTGTCTGCTGGGAGAAGGGGG - Intergenic
931251867 2:60538777-60538799 GTGTGTGTAATGGGGAAAGAGGG + Intronic
935708585 2:105877555-105877577 CTGTGTCTCCAGATGGAAGAGGG - Intronic
936428281 2:112437073-112437095 CTCTGTCTACTGGGGCCACAGGG + Intergenic
937024389 2:118685838-118685860 CTGTGTCTCCTGATGGATGATGG - Intergenic
937316876 2:120937391-120937413 CTGTGCCTCCTGGAGGTAGAAGG - Intronic
938392732 2:130917636-130917658 CTGTGTTCACTGGGGGAGGGGGG - Intronic
938725251 2:134103136-134103158 CTGTCTCTGCTGGGGGAGGCAGG - Intergenic
940154699 2:150643201-150643223 GTGTGTGTGCTGGGGGAGGATGG - Intergenic
942344667 2:174989909-174989931 CTGTTTGTACCAGGGGAAGAAGG - Intronic
942428234 2:175881747-175881769 CTGGGTCTACTTGGGGTGGAGGG + Intergenic
942662581 2:178281994-178282016 CTGTGTGTACTCCGGGAAGCAGG - Intronic
943680035 2:190758729-190758751 CTTTGACTCCTGGTGGAAGAAGG - Intergenic
945044617 2:205770865-205770887 CTGTGTCCCCTGGGGAAGGATGG - Intronic
945085717 2:206130141-206130163 CTGTTTCTCCTGGGAGCAGATGG - Exonic
946044998 2:216813542-216813564 CAGTGTCTTTTGGGGGAATACGG + Intergenic
946476071 2:220007652-220007674 CTGTGTCTTTTGGTGGCAGAAGG + Intergenic
947589735 2:231378785-231378807 CTGGGTTTACTGAGGGAAGGTGG + Intergenic
947670998 2:231935201-231935223 CTGTGTCTCCTGGGGGCACAAGG + Intergenic
948556540 2:238815076-238815098 CTATGTCTACTTGGAGATGATGG - Intergenic
948754307 2:240150248-240150270 CTGTCTCCCCTGGGGGAAGGAGG + Intergenic
1168928020 20:1598829-1598851 CTATGTCTACTGGAAGCAGAAGG - Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1170267163 20:14479323-14479345 CTGTGTCTTCTGGTAGGAGAGGG + Intronic
1172097347 20:32466925-32466947 CTGTGCCTCCTGGTGGGAGAGGG + Intronic
1173667040 20:44770462-44770484 CTGTGTGTATTGGGGGAAACTGG + Intronic
1175140812 20:56859307-56859329 CTGTGTCTCCTGGGGGAGGTGGG + Intergenic
1176373971 21:6078138-6078160 CTCTGTCTACTGGGGCCACAGGG - Intergenic
1177570610 21:22881407-22881429 CAGTTTGTACTGGGGGAAAAAGG - Intergenic
1179560176 21:42210795-42210817 CTGTGTGTGCTTGGTGAAGAAGG + Intronic
1179749506 21:43460105-43460127 CTCTGTCTACTGGGGCCACAGGG + Intergenic
1181307752 22:21926686-21926708 CCAAGTCTACTGGGGGAAGAGGG + Intronic
1181322749 22:22021264-22021286 CTCTGTCTGTTGGGGGGAGATGG - Intergenic
1182895451 22:33855660-33855682 CTGTGGTTCCTGGGGGCAGAGGG - Intronic
1183501132 22:38180101-38180123 GTGTGTGTGCTGGGGGAAGTAGG - Intronic
949516065 3:4807966-4807988 AAGTGTCTACTGGGGCAAGGTGG - Intronic
950427987 3:12934981-12935003 CTGTGTCTTGTGGGGGATGCAGG - Intronic
952883544 3:37999450-37999472 CTGGGTTAGCTGGGGGAAGATGG + Intronic
953356156 3:42257791-42257813 CTGCGTCTACTGAGGGCAAAGGG - Intergenic
954639992 3:52092154-52092176 CAGTGTTTACTGGGGCAAGGAGG + Intronic
954680802 3:52344962-52344984 CTCTTGCTACTGGAGGAAGAAGG - Intronic
958706385 3:97661971-97661993 CAGTATATACTGGGGGAAGAGGG - Intronic
958860065 3:99435668-99435690 CTGTTTCCACTCGTGGAAGAAGG - Intergenic
960374335 3:116879787-116879809 TAGTGTCTCCTTGGGGAAGAAGG - Intronic
960447015 3:117761635-117761657 GTGTGTCTTATGGGGGGAGAGGG + Intergenic
960876302 3:122298401-122298423 ATGTGTCCACTGGGGGAGGCAGG + Intergenic
961393213 3:126568995-126569017 CTGTGTCCCCTGGAGGCAGAGGG + Intergenic
961643064 3:128376910-128376932 CTCTGTCACCTGGGGGAAGAAGG + Intronic
962066812 3:131990473-131990495 TTGTGTTTACTGGGGGCAGGGGG - Intronic
963968237 3:151398335-151398357 TTCTGTCTAGTGGGGGAAGTTGG + Intronic
964695468 3:159503011-159503033 CAGTGTCTCCTGGGGAGAGAAGG - Intronic
965774569 3:172215270-172215292 CTGTCCCCACTGGGAGAAGAGGG + Intronic
968275812 3:197439560-197439582 CAGTGTCCACTGGAGCAAGAAGG - Intergenic
969274616 4:6127127-6127149 CTCTTTCTTCTGGGGGAAAATGG + Intronic
971363500 4:25957784-25957806 CAGTGTCTACTGAGTGAATATGG - Intergenic
972404783 4:38735286-38735308 CTGTGGCTACTTGGGAAAGCAGG + Intergenic
975147062 4:70980143-70980165 GAGTGTGTACAGGGGGAAGATGG - Intronic
975943763 4:79679915-79679937 CATTGACTAATGGGGGAAGATGG - Intergenic
976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG + Intergenic
976541363 4:86280932-86280954 TTGGGACTACTGGGGGAAGGAGG + Intronic
977390158 4:96399020-96399042 CTGTGTGGACAGGGGAAAGAAGG - Intergenic
978204460 4:106063792-106063814 CTGTGTCTTCATGTGGAAGAAGG - Intronic
979988877 4:127350409-127350431 CTGTGTCTTTTGTGGGAACATGG + Intergenic
982263636 4:153518342-153518364 CTGTGTCCACCAGGGGTAGAAGG + Intronic
982865250 4:160501968-160501990 CTCTGGCTGCTGTGGGAAGAAGG + Intergenic
985173600 4:187177573-187177595 CTGTGTGTGGTGGGGGAAGTTGG - Intergenic
985701838 5:1378167-1378189 CTGTGTCCACTGGGGGACCTCGG - Intergenic
987341702 5:16945050-16945072 CTGTGGCCACTGGTGGGAGAGGG + Intergenic
990274962 5:54185458-54185480 CTAAGTCCAGTGGGGGAAGATGG - Intronic
990334779 5:54761846-54761868 CTGTGTCTTCAGGGGGAAGAAGG + Intergenic
990877751 5:60505419-60505441 CTCTGTCTTCTGGATGAAGAAGG + Intronic
991988197 5:72311314-72311336 GTGTGTATACAGGGGGAAGGAGG + Intronic
993907222 5:93636490-93636512 CTGTGTCTTCACAGGGAAGAAGG - Intronic
994381841 5:99080269-99080291 CTCTGTGTACTGGGGGAAAGAGG - Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
995962733 5:117863136-117863158 CTATGTCTACTGAGGGAACTAGG - Intergenic
996537007 5:124587985-124588007 GTGTGCATGCTGGGGGAAGATGG - Intergenic
1001407672 5:171487314-171487336 CTTGGCCTCCTGGGGGAAGAAGG + Intergenic
1001707729 5:173753821-173753843 CTGCGTCAACTGGGGGAAGGTGG - Intergenic
1001813984 5:174652110-174652132 ATGTGTCTACTTGGTGAAGCTGG + Intergenic
1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG + Intronic
1002783643 6:385047-385069 CTGTGTGTACTGATGGAAAATGG + Intergenic
1003260137 6:4509613-4509635 CTGACCCTACTGGGGGAACAGGG - Intergenic
1004002524 6:11608215-11608237 CTTTGTGTACTTGGGGAACAAGG + Intergenic
1005020497 6:21413473-21413495 CTGTGTCTCCTGGGGTTTGATGG - Intergenic
1005108573 6:22252664-22252686 CTGTGTCTACCTGGGGCAGATGG + Intergenic
1006714795 6:36110272-36110294 CTGAGTCAACTGGAGCAAGAAGG + Exonic
1007098160 6:39227277-39227299 CTTTGTTTAGAGGGGGAAGAGGG - Intronic
1007214421 6:40226298-40226320 CTGTGTATATTGGGAGAAGCGGG + Intergenic
1007865944 6:44971020-44971042 CTGTGTATCCTTGGGGAGGATGG - Intronic
1007928460 6:45668987-45669009 CTGTGGCTGATGGGGGATGAGGG - Intergenic
1008502601 6:52198897-52198919 CTGAGAATACAGGGGGAAGAGGG + Intergenic
1008750305 6:54725139-54725161 CTGAGGCCAGTGGGGGAAGAAGG + Intergenic
1009569948 6:65371771-65371793 GTGTGTGTAATGGGGGAAGTGGG + Intronic
1014131530 6:117839874-117839896 CAGTGTCTACAGGGGGAAAAGGG + Intergenic
1014145008 6:117987503-117987525 CTGGGTGTCCTGGAGGAAGAGGG - Intronic
1016521458 6:144951341-144951363 CTGTGGATACTGAGGGATGATGG - Intergenic
1017071068 6:150576039-150576061 CAGTGTCTACACGAGGAAGATGG + Intergenic
1019217071 6:170451024-170451046 CCGTGTCTCCTGGGAGGAGAAGG - Intergenic
1020103512 7:5408871-5408893 CTCTGTTTACTAGGGAAAGATGG + Intronic
1020168098 7:5823652-5823674 CTGGGTCTCTAGGGGGAAGAAGG + Intergenic
1020701692 7:11492110-11492132 GTGTGTCAAGTGGGGGCAGATGG - Intronic
1021122425 7:16811928-16811950 CTCTGTATAATGGGGGAAAATGG + Intronic
1023912946 7:44568218-44568240 GTATGTCTGCCGGGGGAAGAGGG + Exonic
1024901672 7:54324853-54324875 ATGTTACTACTGGGGGAAGTTGG + Intergenic
1025093457 7:56081134-56081156 CTATGGCCACTGGGTGAAGAAGG - Exonic
1025777065 7:64569329-64569351 CTGGGTCTCGTGGGGGCAGAAGG - Intergenic
1026131982 7:67628590-67628612 CTGTGACTACTAGGTGTAGAAGG + Intergenic
1030014619 7:105206205-105206227 GTGTGTGTGCTGGGGGAGGAGGG + Intronic
1032007713 7:128317000-128317022 CTGTATGTCCTGGGGGAAGATGG + Intronic
1032765923 7:134993511-134993533 CTGTGTAGTCCGGGGGAAGAAGG - Exonic
1033237168 7:139647238-139647260 CCTTGTCTACTGGGGTGAGAGGG + Intronic
1033560704 7:142527768-142527790 CTTTGTCTCCTGGGAGCAGATGG + Intergenic
1035108852 7:156463821-156463843 AGGTGTCACCTGGGGGAAGAGGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035655500 8:1302048-1302070 CTGTGTGTGCTGGGGGAAAAGGG + Intergenic
1037086857 8:14862798-14862820 CTGTGTCTAGAGGGGAAAGCAGG - Intronic
1039208664 8:35186177-35186199 CAGTCTCAACTGGGGGCAGAAGG + Intergenic
1039595129 8:38785059-38785081 AAGTGTCTACAGGGGGAAGCAGG - Intronic
1039702991 8:39980344-39980366 ATGTGTCCCCTGGGGAAAGAAGG - Intronic
1039756011 8:40523694-40523716 GTTTCTCTACTGGGGGAACATGG + Intergenic
1041020584 8:53634182-53634204 ATGTGTCTAGTGGGGGAAACTGG - Intergenic
1045571775 8:103375060-103375082 CTGCTTCTCCTTGGGGAAGAGGG + Intronic
1045594969 8:103644027-103644049 CTGTATCTAATAGGGGGAGAAGG - Intronic
1045795213 8:106035813-106035835 CTACGTGTACTGGGGCAAGAAGG - Intergenic
1047439936 8:124868657-124868679 TTGTGTCTAATTGGGGAAGAAGG - Intergenic
1047598984 8:126407658-126407680 CGATTTCTACTGGGGGTAGAAGG - Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1048878018 8:138851998-138852020 ATGTCTCTACTTGGGGAAGGGGG + Intronic
1051475795 9:17507823-17507845 CTGTGTCTGCTGAAGAAAGAAGG - Intergenic
1051784739 9:20729993-20730015 CTTTGTTTTCTAGGGGAAGAGGG + Intronic
1052074770 9:24127581-24127603 CTGTGTGTACTGGGGTGAAAAGG + Intergenic
1059338965 9:113586676-113586698 CTGAAGCTACTGGTGGAAGAGGG - Intronic
1059438076 9:114288443-114288465 CTGTGTCCACAGGGGGAGCAGGG + Exonic
1061219590 9:129242555-129242577 CTGAGGCTACTGGGAGGAGAAGG + Intergenic
1061544833 9:131298621-131298643 CTATGTGCACTGCGGGAAGAGGG - Intronic
1061648035 9:132022188-132022210 ATGTTTCTACTGGGGGAAGAAGG + Intronic
1185877472 X:3712805-3712827 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185894024 X:3843052-3843074 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185899142 X:3881476-3881498 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185904259 X:3919905-3919927 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1187955064 X:24509477-24509499 ATGTGTGTGTTGGGGGAAGAGGG - Intronic
1189230018 X:39444878-39444900 CTGGGCCTGCTGGGGGATGAGGG + Intergenic
1190945472 X:55089194-55089216 CTGTGGCTTCTGAGGGAAAAGGG + Intronic
1192168089 X:68838508-68838530 CTGGGCCTACTGGGTGGAGATGG - Intronic
1192223143 X:69211022-69211044 CTGTGGCAGCTGGGGGGAGATGG - Intergenic
1192261455 X:69508147-69508169 CTGGGTCTTTTGTGGGAAGAAGG + Intronic
1194249977 X:91562729-91562751 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic
1195159140 X:102154592-102154614 CTGTATCTGATGAGGGAAGAAGG - Intronic
1196420681 X:115517575-115517597 TTATCTCTACTGGGGGAAAACGG - Intergenic
1198074308 X:133180128-133180150 CTGTGTTAAGTGGGGAAAGAAGG - Intergenic
1199549611 X:149044356-149044378 CTGTGTCTCCTGAGGGAAGGAGG + Intergenic
1199693607 X:150328002-150328024 CTGAGGTTACTCGGGGAAGAAGG - Intergenic
1199938857 X:152604504-152604526 CTGTGTCATATGGGGGCAGAAGG + Intergenic
1200568940 Y:4803978-4804000 CTGTGTCTCTGGGTGGAAGAGGG + Intergenic