ID: 1135665075

View in Genome Browser
Species Human (GRCh38)
Location 16:24328899-24328921
Sequence ATGTGTGTATGTGATGAAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 566
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 508}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135665075_1135665076 -8 Left 1135665075 16:24328899-24328921 CCGACTTCATCACATACACACAT 0: 1
1: 0
2: 2
3: 55
4: 508
Right 1135665076 16:24328914-24328936 ACACACATACACCCTTTCGTAGG 0: 1
1: 0
2: 1
3: 21
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135665075 Original CRISPR ATGTGTGTATGTGATGAAGT CGG (reversed) Intronic
900880101 1:5374865-5374887 ATGTGTGTATGTGTGTATGTTGG - Intergenic
900975158 1:6012106-6012128 ATGGGTGGAGGTGATGAAGGTGG + Intronic
901680711 1:10911117-10911139 GAGTGTGTGTGTGATGAAGAAGG - Intergenic
902111761 1:14084966-14084988 ATGTGTGTATGTGTGTAAATTGG + Intergenic
903026446 1:20432979-20433001 GTGTGTGCATGTGTGGAAGTAGG - Intergenic
903681175 1:25098266-25098288 GTGTGTGTGTGTGTTGGAGTTGG - Intergenic
904117582 1:28174056-28174078 ATGTGTGTCTGTGGTTATGTGGG - Intronic
904598758 1:31662488-31662510 CTGTGTGTGTGTGCTGAGGTGGG - Intronic
904832112 1:33311982-33312004 GGGTGTGCATGTGATGAAGGAGG - Intronic
905410637 1:37765661-37765683 GTGTGTGTGTGTGATGAGGGCGG - Intergenic
905533752 1:38702358-38702380 ATGTGTGTATGGGTTGATGGGGG + Intergenic
905597875 1:39224179-39224201 ATGTGTGTATGGGGGGGAGTAGG - Intronic
905612393 1:39365618-39365640 AATTGTGTATATGATGAAGATGG - Intronic
905676406 1:39828457-39828479 GTGTGTGTGTGTGCTGAGGTGGG - Intergenic
905695520 1:39970661-39970683 ATGTGTGTATCAGATGAGGGAGG + Intergenic
905893114 1:41529322-41529344 ATGTGTGAATGTGAGGGTGTGGG - Intronic
906288270 1:44602648-44602670 ATGTGTGTGTGGGGTGGAGTCGG - Intronic
906861924 1:49370044-49370066 GTGTGTTTATGTGATGATGGAGG - Intronic
907081691 1:51629460-51629482 TTGTGTGGATGTCATAAAGTGGG + Intronic
907338632 1:53717562-53717584 GTGTGTGTATTGGGTGAAGTGGG - Intronic
907872587 1:58456394-58456416 AAGTGGGAAGGTGATGAAGTAGG + Intronic
908142736 1:61203962-61203984 GTGTGTGTATGAGCTGTAGTTGG + Intronic
908545274 1:65155955-65155977 ATGTGTGTGTGTGTGGAAGGTGG - Intronic
908718893 1:67101476-67101498 GTGTGTGTGTGTGATGGAGTAGG + Intronic
908768929 1:67578360-67578382 GTGTGTGTGTGTGTTGAGGTGGG + Intergenic
909308778 1:74118566-74118588 ATGTGTGTGTGGGAGGTAGTGGG - Intronic
909340788 1:74528478-74528500 ATTTGTGTGTGTGTTGGAGTGGG + Intronic
909521092 1:76568578-76568600 ATGGTTGTGTGTGTTGAAGTAGG - Intronic
910011945 1:82475216-82475238 ATGTGTTGATATTATGAAGTAGG - Intergenic
910147105 1:84093305-84093327 CTGTGTGTGTGTGGTGAGGTAGG + Intronic
911207611 1:95107975-95107997 ATATGTTTATGGGATGAGGTTGG + Intergenic
911212034 1:95151593-95151615 ATGTGTGTCTGTGTTGGTGTTGG + Intronic
911469015 1:98293268-98293290 ATGTGTGTATGTGAGAGAGAAGG - Intergenic
912169889 1:107086657-107086679 TTGTGGGAATATGATGAAGTAGG - Intergenic
912267789 1:108175934-108175956 ATCTGTGCATTTGAAGAAGTAGG - Intronic
912938805 1:114026709-114026731 ATCTAGGTAAGTGATGAAGTTGG - Intergenic
913172879 1:116248168-116248190 ATGTGTGTGGGGGATGAGGTGGG - Intergenic
913192608 1:116426286-116426308 GTGTGTGTATGTGGGGAGGTAGG + Intergenic
915808351 1:158878599-158878621 TTGGGTGTGTGTGATGAAGATGG - Intergenic
915854999 1:159373777-159373799 ATGTGTGTGTGTGGTGGGGTGGG - Intergenic
916843110 1:168620701-168620723 ATGTGTGTATGTGTTGTAGGTGG + Intergenic
917810078 1:178650005-178650027 ATGTGTGTAGGTGTTTATGTGGG - Intergenic
917955867 1:180097436-180097458 ATGTGTGTCTGTGAACAGGTAGG + Intronic
918169638 1:181984339-181984361 AGGTGTGCATGTGATGGAGTGGG - Intergenic
918373638 1:183886495-183886517 ATCTGTGTATGTGACATAGTGGG + Intronic
918994883 1:191744535-191744557 TTGTGTGTGTGTGTTGGAGTTGG + Intergenic
920027654 1:203012139-203012161 GTGTGTGTGTGTGATGGAGTGGG - Intronic
920027662 1:203012226-203012248 GTGTGTGTGTGTGATGGAGTGGG - Intronic
920231426 1:204472918-204472940 ATGTGTGTTTGTGATTAGGTTGG + Intronic
920247486 1:204599503-204599525 GTGTGTGTGTGTGATGGAGCAGG + Intergenic
920439881 1:205972788-205972810 GTGTGTGTGTGTGATGGGGTGGG - Intergenic
920507406 1:206526280-206526302 GTGTGTGTGTGTGTTGGAGTTGG + Intronic
920610506 1:207432037-207432059 ATGTGTGATTGAGGTGAAGTAGG + Intergenic
921361915 1:214337953-214337975 ATGAGTGTGTGTGAAGATGTGGG - Intergenic
921778375 1:219129840-219129862 GTGTGTGTATATGTTGAAATTGG - Intergenic
922233334 1:223704885-223704907 ACGTGAGTAGGTGATGGAGTTGG + Intronic
922775276 1:228211668-228211690 ATGTGTGGAGGTGTTGAACTGGG + Intronic
922888252 1:229037130-229037152 ATGTATGTATGTTACGAAGTGGG - Intergenic
923063298 1:230496596-230496618 ATGTGTGTGTGAGATGAAGGAGG + Intergenic
923830593 1:237551065-237551087 GTGTGTGTAAATGATGAAGGTGG - Intronic
923947914 1:238910832-238910854 ATGTGTGTGTGTGATAGAGTAGG + Intergenic
924628539 1:245715629-245715651 ATGTGTGTATGTGCAGAAAGAGG - Intergenic
924823906 1:247520517-247520539 GTGTGTGTGTGTGAAGAGGTGGG - Intronic
1062789992 10:297227-297249 GTGTGTGTATGTGGTGGGGTGGG - Intronic
1063678568 10:8163982-8164004 ATGTGTGACTGTGCTGAAGCAGG + Intergenic
1063950749 10:11221025-11221047 ATGTGTGTGTGTGGTGGAATGGG - Intronic
1064750248 10:18521258-18521280 AGGTGTGGATGTCCTGAAGTTGG - Intronic
1067079999 10:43207383-43207405 GTGTGTGTGTGTGTTGACGTGGG - Intronic
1067856463 10:49797631-49797653 TTTTGTATATGTGATAAAGTAGG - Intergenic
1069278774 10:66626908-66626930 GTGTGTGTATGTGTTGGAGATGG - Intronic
1069689328 10:70339503-70339525 ATGTGAGTCTGGGATGAAGCAGG + Intronic
1070273544 10:74982127-74982149 AAATGTTAATGTGATGAAGTAGG - Intronic
1070471777 10:76787553-76787575 ATGTGTGTTTGTGTTGGTGTTGG + Intergenic
1070718639 10:78740818-78740840 ATGTGTGCATTTTATGAGGTGGG + Intergenic
1071377756 10:85027103-85027125 ATATTTGTATGTGATAAACTTGG + Intergenic
1071470225 10:85979035-85979057 TTGTGTGTATGTGGTGGGGTGGG + Intronic
1072198723 10:93139854-93139876 ATGTGTGTGTTTGTTGAGGTGGG - Intergenic
1072293063 10:93983403-93983425 GTGTGTGTATATGATTAATTTGG - Intergenic
1072476887 10:95770271-95770293 GTGTGTGTGTGTGTTGGAGTGGG + Intronic
1074372748 10:112913473-112913495 ATGTGTGTGTGTGTGGATGTGGG + Intergenic
1074705850 10:116130751-116130773 TTTTGTGTATGGTATGAAGTAGG - Intronic
1075299482 10:121309017-121309039 ATGTGTCTATTTGGTGAAGGTGG - Intergenic
1075361519 10:121840065-121840087 ATGTGTATATGTGGTGGAGGAGG - Intronic
1076235518 10:128861175-128861197 TTGTGTGCAGGTGAGGAAGTGGG - Intergenic
1076465083 10:130674654-130674676 ATGTGAGGATGTGAAGAAATGGG - Intergenic
1077773095 11:5242564-5242586 ATGTATGTATGTGATGACTGGGG - Intergenic
1078054391 11:7995409-7995431 TTGAGTGTATGTGCTGAGGTGGG - Intronic
1078856611 11:15210535-15210557 GTGTGTGTGTGTGGTGGAGTGGG + Intronic
1079105844 11:17571978-17572000 GTGTGTGTATATGAGCAAGTAGG + Intronic
1079609101 11:22408437-22408459 ATATGTGTATGTGTTTAAGTTGG - Intergenic
1079619209 11:22532980-22533002 ATGTGTGTTTGTGATGCAAGAGG + Intergenic
1080305307 11:30828703-30828725 GTGTGTGTATGTGGTGGAGGGGG - Intergenic
1081089710 11:38848271-38848293 ATGTGTGTGTATGCTGAGGTAGG + Intergenic
1082126177 11:48433631-48433653 TTGTGTGTCTTGGATGAAGTGGG + Intergenic
1082725625 11:56732212-56732234 AATTTTGTATGTGATCAAGTTGG - Intergenic
1082758715 11:57104714-57104736 GTGATTATATGTGATGAAGTTGG - Intergenic
1082882827 11:58054973-58054995 ATATGTGTGTGTGTTGAACTGGG + Intronic
1083685748 11:64373938-64373960 TTGTGAGTATCTGATGAAATGGG - Intergenic
1085215970 11:74832421-74832443 ATTTGTGTATCTGATAACGTAGG + Intronic
1085825665 11:79844504-79844526 AAGTGTGTGTGTGATGGAGGGGG - Intergenic
1086062760 11:82717366-82717388 AGGTGTGCATGTGAGGAAGTGGG - Intergenic
1086140662 11:83495225-83495247 ATGTGTGTGTCTGTTGGAGTGGG + Intronic
1087022823 11:93620521-93620543 TTTTGTGTATGGTATGAAGTAGG + Intergenic
1087617725 11:100507411-100507433 GTGTGTGTATGTGGAGAAGGGGG - Intergenic
1088580383 11:111310118-111310140 CTTTGTGTATATGAGGAAGTTGG - Intergenic
1088789344 11:113210761-113210783 GTGTGTGTTTGTGATGAAGAGGG - Intronic
1088965135 11:114712624-114712646 TTGTGAGGATGTGAAGAAGTTGG + Intergenic
1089637536 11:119825163-119825185 TTTGGTGTTTGTGATGAAGTGGG + Intergenic
1089719350 11:120398578-120398600 TTGTGTGTGTGTGATAAACTAGG + Intronic
1090334515 11:125953707-125953729 ATGCGTGTGTGTGGTGAGGTGGG + Intergenic
1090933727 11:131323452-131323474 ATGTGTGTTTGTGTTGGGGTAGG + Intergenic
1090964846 11:131589703-131589725 ATGTGTGTATGTGTGGATGCAGG - Intronic
1091072315 11:132579405-132579427 GTGTGTGTGTGTGATGAGGGAGG + Intronic
1092903985 12:13085657-13085679 ATGTGTGTGTGTGTTGGGGTGGG - Intronic
1093271831 12:17072425-17072447 ATTTGTCTATGTGATGAAACCGG + Intergenic
1093499255 12:19793007-19793029 ATTTGTGTATGACATGATGTAGG - Intergenic
1093647474 12:21604267-21604289 ACTTGTGTATGTGTTGAAGAGGG - Intronic
1093815391 12:23539633-23539655 ATGCGTGTATGTAAAGAAATGGG + Intronic
1094765937 12:33594741-33594763 ATGTATGAATGTTTTGAAGTAGG + Intergenic
1095187882 12:39222776-39222798 ATTTGTGTATCTGCTGAAATGGG + Intergenic
1095721639 12:45407592-45407614 ATGCTTGTATGTGCTGAAGTGGG + Intronic
1095822497 12:46493814-46493836 ATGTGTGTGTGTGTTGAGCTTGG + Intergenic
1096056381 12:48655905-48655927 ATGTATGTATGTGTGTAAGTAGG - Intronic
1096095531 12:48933100-48933122 AGGTGTAGATGTGAGGAAGTTGG - Intronic
1096186711 12:49586411-49586433 ATGAGTGTATGGGCTCAAGTGGG + Intronic
1097492560 12:60289420-60289442 ATGTCTGTAGGTGATATAGTTGG + Intergenic
1097671335 12:62542734-62542756 ATGTGTGAATGTCAAGAAGTAGG - Intronic
1097748092 12:63321509-63321531 ATGTCTGTATCTGAGTAAGTAGG + Intergenic
1098164565 12:67680683-67680705 TTGTGTGTATGTGATGTAGTAGG + Intergenic
1098979016 12:76934977-76934999 AGGTGTTTATGTGATGAGATGGG + Intergenic
1099080737 12:78177189-78177211 ATGTCAGAATGTGATGAAGGAGG - Exonic
1099883832 12:88502366-88502388 ATGTGTGTATTTAATGTATTGGG - Intronic
1100357273 12:93843130-93843152 ATGTGTGTTTGTGGTAAGGTAGG + Intronic
1100362518 12:93891592-93891614 ATGTGTGTGTGTGATGGAAGGGG + Intronic
1100468692 12:94872356-94872378 CTGTGTGTGTGTGTTGAAGGGGG - Intergenic
1104205286 12:126632706-126632728 AGGTGTGTGTGTGGTGGAGTTGG + Intergenic
1104308840 12:127635496-127635518 ATGGGTGGATGTGAAGAGGTAGG + Intergenic
1104430435 12:128711580-128711602 TCGTGTGCATGTGATGAAATAGG + Intergenic
1104557901 12:129818607-129818629 ATGTGTGTGTGTGGTGTAGGGGG + Intronic
1106245325 13:27944799-27944821 ATGTGGCTATGTGATGACGATGG + Intergenic
1106754856 13:32812293-32812315 ATGTGTGTGTTTGCTGAAGGAGG + Intergenic
1106902135 13:34364841-34364863 ATGTGTGTGTGTGATTGCGTGGG + Intergenic
1106916338 13:34519325-34519347 GTGTATGTATGTGATGGTGTTGG - Intergenic
1106939219 13:34758435-34758457 ATTTGTGTATGGGGTGAGGTAGG + Intergenic
1107021804 13:35759796-35759818 ATGTGTGTATGTGTTGGGGTAGG - Intergenic
1107185063 13:37508205-37508227 TTGTGTGGATGTGGTGAAGAGGG + Intergenic
1107216631 13:37928441-37928463 GTGTGTGTGTGTGATCATGTGGG - Intergenic
1107534535 13:41315159-41315181 ATGGGAGTATTTGATAAAGTGGG + Intronic
1107829748 13:44363989-44364011 GTGTGTGTATGTAAGGAAGGGGG - Intergenic
1108233313 13:48372855-48372877 ATGTGTGTGTATTATGAAGGGGG - Intronic
1108266639 13:48716112-48716134 AATTTTGTATGTGATTAAGTTGG - Intergenic
1108680313 13:52774446-52774468 CTGTGTGTATATGAAGAAGTGGG + Intergenic
1109017969 13:57043890-57043912 TTGTGTGTATGGTATGAAATAGG - Intergenic
1109580739 13:64329761-64329783 ATGTGTGTGTATGGTGAGGTGGG - Intergenic
1110202579 13:72869800-72869822 ATGTGTGTGTGTGTGGAGGTGGG - Intronic
1110387128 13:74926089-74926111 ATGTGTGTGTGTGATGTCTTTGG - Intergenic
1110621152 13:77597209-77597231 ATGTGTGCCTGTGCTGAGGTAGG + Intronic
1110966672 13:81708356-81708378 TTTTGTGTATGTGAATAAGTAGG + Intergenic
1110980700 13:81893620-81893642 ATTTGTGAGTGTGATGAGGTGGG - Intergenic
1111160215 13:84384586-84384608 ATGTGTGCAAGTGATGATGTTGG - Intergenic
1111457218 13:88500201-88500223 GTGTGTGTGTGTGTTGGAGTTGG - Intergenic
1111644987 13:91021525-91021547 ATGTGTGTCTGTGGTGATGGTGG - Intergenic
1112112744 13:96320844-96320866 AGGAGTGTCTGTGAGGAAGTGGG - Intronic
1112149270 13:96739265-96739287 GTGTGTGTGTGTGTTGGAGTGGG + Intronic
1112702109 13:102021782-102021804 ATGTGTGTATCTGATACAGGAGG + Intronic
1112830136 13:103439480-103439502 GTGTGTGTATGTGGTGTGGTGGG + Intergenic
1112851912 13:103716488-103716510 AGGTGGGTATGTGATTAAGGTGG - Intergenic
1112994789 13:105560429-105560451 ATGTGATGATGTGAGGAAGTGGG - Intergenic
1114568468 14:23649255-23649277 ATGTGTGTGTGTGGTACAGTAGG + Intergenic
1114840544 14:26257796-26257818 ATGGGTGAATGGGATGTAGTGGG + Intergenic
1114966200 14:27963818-27963840 CTACGTGTATGTTATGAAGTAGG - Intergenic
1116812412 14:49552089-49552111 ATGTGTGTGTGTTGTGTAGTGGG - Intergenic
1117255526 14:53973307-53973329 AGGGGTGTATGTAATTAAGTGGG + Intergenic
1117386284 14:55216358-55216380 GTGTGTGTGTGTGATGCACTTGG + Intergenic
1117447831 14:55821578-55821600 AAGTATGTATGTCATGAACTAGG - Intergenic
1118247758 14:64127897-64127919 ATGTGTGTATGTGAAAAAATGGG - Intronic
1118331960 14:64822136-64822158 GTGTGTGTATGTGTGGAAGGTGG - Intronic
1118499866 14:66349917-66349939 GTGTGTGTAGTTGATGAAGTAGG - Intergenic
1118630857 14:67701371-67701393 AAATGTATATGTGATTAAGTTGG - Intergenic
1118771910 14:68947936-68947958 ATGTGCGTGTGTGATGAGGGCGG - Intronic
1118776028 14:68974543-68974565 GTGTGTGTGTGTGATGTTGTAGG - Intronic
1118848494 14:69566489-69566511 ATGACTGTATTTGATGAATTGGG + Intergenic
1119382387 14:74237523-74237545 AAGTGTGTGAGTGATGAAGTTGG - Intergenic
1119996714 14:79261631-79261653 GTGTGTGTGTGTGATGGGGTGGG + Intronic
1120966875 14:90175315-90175337 ATGTCTTTTTGAGATGAAGTAGG - Intronic
1121847099 14:97181398-97181420 ATGTGTGTATGTGTACATGTGGG - Intergenic
1121847108 14:97181615-97181637 ATGTGTGTATGTGTACATGTGGG - Intergenic
1122021476 14:98841364-98841386 ATGTGTGTATGTGAATATATGGG + Intergenic
1122209959 14:100167486-100167508 ATGTGTGTGTGTGTTGGGGTGGG - Intergenic
1124465251 15:29933075-29933097 ATGTGTGTGTGTGATGCATGAGG - Intronic
1124493499 15:30172654-30172676 GTGTGTGTGTGTGATGTAGGGGG + Intergenic
1124750035 15:32365671-32365693 GTGTGTGTGTGTGATGTAGGGGG - Intergenic
1124888017 15:33705047-33705069 GTGTGTGTATGTGTTGGGGTAGG - Intronic
1125102181 15:35926852-35926874 TAGTGTGTATGTGAGGGAGTAGG + Intergenic
1125163813 15:36679170-36679192 ATGTGTGTATGGGCTGGGGTGGG + Intronic
1125180691 15:36878763-36878785 GTGTGTGTGTGTGATGGGGTGGG + Intergenic
1125443350 15:39726828-39726850 GTGTGTGTATGTGAAGACCTGGG - Intronic
1126297106 15:47152257-47152279 ATGTGTGTATGTGAAAATATTGG + Intergenic
1126590101 15:50330524-50330546 AAGTGTGTATGAGATGAGGAAGG - Intronic
1126590107 15:50330569-50330591 AAGTGTGTATGGGATGAGGAAGG - Intronic
1126882209 15:53111243-53111265 CTGAGTGTATGTGAGGCAGTGGG - Intergenic
1127078796 15:55354407-55354429 ATAGGTGTATTTGATAAAGTAGG - Intronic
1127180672 15:56413757-56413779 ATCTGTGTATATAATGAAGGTGG - Intronic
1128585061 15:68841478-68841500 ATGGTTGTATGTGGTTAAGTAGG + Intronic
1128652176 15:69425318-69425340 TTTTGTGTATGTGATGGTGTTGG + Intronic
1129754047 15:78085299-78085321 ATGTGTGTATGTGAAGTACTTGG + Intronic
1130702475 15:86198696-86198718 ATGTGTGCATGTGTTGAGGGAGG + Intronic
1131010490 15:89013671-89013693 ATGTGTGTATGTGATTTCTTAGG - Intergenic
1131107789 15:89746546-89746568 CTGTGTGTATGTGTGGAGGTTGG - Intergenic
1133443562 16:5840698-5840720 ATGTGTGTAGGTGAAGCAGAAGG + Intergenic
1133712753 16:8417286-8417308 ATGGGTGTATGTGATGATATAGG + Intergenic
1133769701 16:8860628-8860650 ATGGGGGTACGAGATGAAGTAGG + Intronic
1134382005 16:13736310-13736332 AGTTGTGTATGTCATTAAGTGGG - Intergenic
1134866966 16:17616884-17616906 GTGTGTGTGTGTGTTGGAGTTGG - Intergenic
1135662216 16:24306641-24306663 GTGTGTGTATGTGTTGGGGTAGG - Intronic
1135665075 16:24328899-24328921 ATGTGTGTATGTGATGAAGTCGG - Intronic
1135888778 16:26338225-26338247 ATGTGTTTATGTGACCAAGTGGG - Intergenic
1135888932 16:26339696-26339718 ATGTGTTTATGTGACCAAGTGGG + Intergenic
1137731279 16:50692607-50692629 ATGTGTGTGTGTTGGGAAGTGGG + Intergenic
1138221381 16:55254557-55254579 ATGTGTGTAATATATGAAGTAGG + Intergenic
1138239623 16:55416832-55416854 ATATGTGTGTGTGTTGGAGTGGG - Intronic
1140494558 16:75373232-75373254 GTGTGTGTAAGTGTTGAAATGGG - Intronic
1140584765 16:76276617-76276639 ATGTGTGTATGTGGTGGTGGTGG + Intergenic
1140641583 16:76979460-76979482 ATATGTGTAAGTGCTGAAGAAGG + Intergenic
1140768650 16:78183249-78183271 ATGTGTGTATGTGTTGGGGGCGG + Intronic
1141321188 16:83010527-83010549 ATGTGTGTGTGTGAATGAGTGGG - Intronic
1141323195 16:83031144-83031166 ATGTGTGTATATGGTGCTGTAGG + Intronic
1141391286 16:83666808-83666830 GTGTGTGTATGTGTGGAGGTGGG - Intronic
1143735312 17:8908076-8908098 ATGTGTGCATGTGGTGTGGTAGG - Intronic
1144491079 17:15710392-15710414 ATTTTTGTATATGATGAAATGGG + Intronic
1144563932 17:16344376-16344398 ATATCTGAATGTGGTGAAGTTGG - Intronic
1144910324 17:18675791-18675813 ATTTTTGTATATGATGAAATGGG - Intronic
1145407181 17:22612109-22612131 TTTTGTGTATGTTGTGAAGTTGG + Intergenic
1146380155 17:32322145-32322167 ATGTGTGTATGTGATGGGAAAGG + Exonic
1146576771 17:34001171-34001193 GTGTCTGTATTTGATGATGTAGG + Intronic
1147211541 17:38875077-38875099 GTGTGTGTGTGTGAGAAAGTGGG + Intronic
1148325137 17:46779044-46779066 GTGTGTGTGTGTGATGGGGTAGG - Intronic
1148847806 17:50539418-50539440 ATGTGTTTATTCGATGAAATAGG + Intronic
1150550960 17:66209833-66209855 GTGTGTGTGTGTGTTGAAGGTGG - Intergenic
1150757141 17:67924691-67924713 ATGTATGTATGTTGTCAAGTGGG - Intronic
1151343220 17:73485187-73485209 GTGTGTGTATGTGGAGAGGTGGG + Intronic
1151498994 17:74476967-74476989 GTGTGTGTATGTGGGGAAATTGG + Intronic
1153179037 18:2412116-2412138 TTGTTTGTATGTGTTGAAGGAGG - Intergenic
1153715191 18:7840050-7840072 ATGTGTGTATGGGGTGGGGTGGG + Intronic
1153801199 18:8670815-8670837 ATTTTTGCATGTGATCAAGTTGG - Intergenic
1155344013 18:24840953-24840975 GTGTGTGTTTGGGATGAGGTGGG + Intergenic
1155536003 18:26818974-26818996 GTCTGTGTATTTGAAGAAGTAGG + Intergenic
1156092051 18:33483097-33483119 GTGTGTGTATGTGGAAAAGTTGG - Intergenic
1156099846 18:33579365-33579387 GTGTGTGTGTTTGGTGAAGTTGG + Intronic
1156256922 18:35407398-35407420 TTTTGTGTATGGTATGAAGTAGG - Intergenic
1156673473 18:39499083-39499105 ATGTTTGTATGTGAACAAGCAGG - Intergenic
1157969053 18:52244595-52244617 ATGTGTGTTTGTGCTGATATAGG + Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158386224 18:56995229-56995251 ATGTGTGTTTCTGAGGAAATAGG - Intronic
1159136605 18:64343993-64344015 AGGTGTGTCTGTGAGGATGTTGG - Intergenic
1160118145 18:76101064-76101086 ATGTGTGTATGTGAGTGTGTGGG + Intergenic
1160215557 18:76926418-76926440 ATTTGTGTATGGTATAAAGTAGG + Intronic
1160215597 18:76926873-76926895 ATGTGTATATGGTATAAAGTAGG + Intronic
1167555979 19:50196002-50196024 ATGTGGGTGAGGGATGAAGTGGG - Intronic
1168179733 19:54653195-54653217 ATGTGTGTAAGTGCATAAGTGGG - Intronic
925563922 2:5229101-5229123 CTGTGTGTACATGCTGAAGTTGG - Intergenic
928375405 2:30769501-30769523 ACGTGTGTGTGTGAGGAAGAGGG - Intronic
929337540 2:40768187-40768209 AATTTTGTATGTGATGAAGTGGG - Intergenic
929723958 2:44403689-44403711 ATGTGTGTATGCGTTAAAGATGG - Intronic
930495548 2:52137385-52137407 ATGTGTGTACCTGAAGAGGTTGG + Intergenic
930560701 2:52956880-52956902 ATTTGTTTATGTTTTGAAGTTGG - Intergenic
931069548 2:58629319-58629341 CTGTGTGTATGTGATGGGTTTGG + Intergenic
931189778 2:59989013-59989035 ATATGTGTATCTTATGCAGTTGG - Intergenic
931470278 2:62532343-62532365 ATGTGTGTGTGTGTAAAAGTGGG - Intergenic
931940046 2:67241953-67241975 ATTTGTTTATTTAATGAAGTAGG + Intergenic
933618942 2:84514852-84514874 GTGTGTGACTGTGGTGAAGTGGG - Intergenic
933641151 2:84761761-84761783 GTGTGTGTATGTAATGCTGTTGG - Intronic
934048741 2:88192457-88192479 GTGTGTGTATGTGTGGCAGTGGG - Intergenic
938046856 2:128129320-128129342 CTTTGTGTATGTAATAAAGTAGG + Intronic
938189345 2:129261621-129261643 ATGTGTGTATGTGATTGTATGGG - Intergenic
938928354 2:136064558-136064580 ATGTGGGCATGTGGTGAGGTGGG + Intergenic
939392404 2:141585457-141585479 GTGTGTGTGTGTGATGGGGTGGG + Intronic
941051050 2:160734627-160734649 ATCTGTGTATGTTTTGAAGGTGG + Intergenic
941321765 2:164064399-164064421 AAGTGTGTATGTGTCGTAGTGGG + Intergenic
941850396 2:170174343-170174365 GTGTGTGTGTGTGATAAAGCAGG + Intergenic
942200517 2:173566383-173566405 ATCTCTGTTTGTCATGAAGTGGG + Intergenic
942286774 2:174426264-174426286 TTTTGTGTATTTGATGAAGTAGG + Intronic
942442835 2:176053857-176053879 ATGTGTGAAAATGATGAAGCAGG - Intergenic
942743089 2:179202057-179202079 AATTTTGTATGTGATTAAGTTGG + Intronic
942876012 2:180798795-180798817 ATGTGTGTATGTGTTTGTGTGGG + Intergenic
943122411 2:183753311-183753333 ATTTGTGTATGTAATTAATTGGG - Intergenic
943319917 2:186433577-186433599 CTGAGTGCATGTGATGAAGTTGG + Intergenic
943978767 2:194518881-194518903 ATTTGTGTTTGGGAAGAAGTAGG - Intergenic
944355777 2:198786102-198786124 ATCTGTTTATGTGATGGATTAGG + Intergenic
944676640 2:202038392-202038414 ATCTGTACATGTGATAAAGTGGG - Exonic
945372267 2:209033715-209033737 ATTTGTGTATGTGGTGGGGTTGG + Intergenic
945590344 2:211721297-211721319 CTTTGTGTATGTGATACAGTAGG - Intronic
947220281 2:227785123-227785145 ATGTGTGTATGTCTTGGAGTTGG + Intergenic
947400202 2:229724221-229724243 GTGTGTGTGTGTGATTATGTGGG - Intergenic
947725380 2:232395842-232395864 ATTTTTGTATGTGATCAGGTTGG + Intergenic
947730801 2:232430114-232430136 ATTTTTGTATGTGATCAAGTTGG + Intergenic
948015314 2:234684757-234684779 GTTTGAATATGTGATGAAGTTGG - Intergenic
948318951 2:237053666-237053688 ATGTGTGTGTGTGTTTAAGGAGG - Intergenic
1169617543 20:7465968-7465990 ATGTGTATATGGCATGAAATAGG + Intergenic
1170177431 20:13487692-13487714 ATGTATATGTGTGTTGAAGTTGG - Intronic
1170385078 20:15807424-15807446 GTGTGTGTATGTACTAAAGTAGG - Intronic
1171116338 20:22527742-22527764 AAGTGGGGATGTGATGATGTAGG + Intergenic
1171939141 20:31307879-31307901 ATGTTTGTATGTTTTGCAGTTGG - Intronic
1173313872 20:41925775-41925797 GTGTGTGTATGTGGCCAAGTAGG + Intergenic
1173674026 20:44818219-44818241 ATGTGTGTGTTGGATGAAGGTGG - Intergenic
1173708550 20:45135131-45135153 ATCTGTGCATTTGAAGAAGTAGG + Intergenic
1174072271 20:47907728-47907750 GTGTGTGTATGTGGTGAGCTTGG + Intergenic
1174151789 20:48490972-48490994 GTGTGTGTATGTGGTGAGCTTGG - Intergenic
1176658878 21:9614708-9614730 ATGTTTGGATGTGATGATTTGGG + Intergenic
1177785576 21:25667816-25667838 ATGTGTTTATGTACTGAAGGTGG - Intronic
1179076914 21:38130831-38130853 GCGTGTGTGTGTGTTGAAGTAGG + Intronic
1181573345 22:23779587-23779609 ATATGTGTATGTGTCTAAGTTGG - Intronic
1182181116 22:28349146-28349168 GTGTGTGTAACTGATGAACTTGG - Intronic
1183234453 22:36606924-36606946 ATGTGTGTATGTGTTTATATGGG + Intronic
1184320411 22:43737955-43737977 ATGTGTGTGAGTGATGGTGTGGG - Intronic
1185127592 22:49020125-49020147 ATGTGTGTGGGTGAGGAAGAAGG - Intergenic
1185167635 22:49271384-49271406 TTCTGTGGATGTGAAGAAGTTGG + Intergenic
949110918 3:259326-259348 GTGTGTGTGTGTGATATAGTGGG + Intronic
949361703 3:3239181-3239203 ATGTATGTAGGTGTTGAAGCAGG + Intergenic
949615768 3:5752269-5752291 GTGTGTGTATGTGAGAAGGTGGG - Intergenic
950545700 3:13636788-13636810 ATGTGTGTGTATGAGGAAGAGGG - Intronic
950656410 3:14439753-14439775 TTGTGTGTGTGTGAGGAAGCTGG + Intronic
950844768 3:16003997-16004019 ATGTGTCTATGTGTTGGATTAGG + Intergenic
951340062 3:21474534-21474556 TTGTGTGTATCTGATGATCTTGG - Intronic
951577491 3:24128616-24128638 ATGGGTGTGTTTGATGAATTGGG + Intronic
951650582 3:24947466-24947488 ACGTGTGTAAATCATGAAGTTGG + Intergenic
951717522 3:25664807-25664829 GTGTGTGTGTGTGAGGAAATCGG - Intronic
952890752 3:38038831-38038853 GTGTGTGTTTGTGATGATGGCGG - Intergenic
954911418 3:54113962-54113984 TTATGTTTATGTGATGAAGAAGG + Intergenic
955985308 3:64567701-64567723 ATGTGTGTATGGGATGGAGAAGG - Intronic
956454108 3:69403817-69403839 GTGTGTGTGTGTGTTGAGGTGGG - Intronic
956538831 3:70310722-70310744 ATGTGAGGGTATGATGAAGTTGG + Intergenic
956734459 3:72227465-72227487 GTGTGTGTATGTGTGGAGGTGGG - Intergenic
956933796 3:74076636-74076658 GTGTGTGTGTGTGGTGAGGTTGG - Intergenic
957310056 3:78507991-78508013 ATGTGTGTGTGTGAGAGAGTAGG - Intergenic
957320556 3:78624962-78624984 AAGAGTGTATGTGATGAAATTGG + Intronic
958079964 3:88735115-88735137 TGGTGTGTATGTGATGAAAAGGG + Intergenic
958827773 3:99052649-99052671 ATGTATGCATGTAATGAAGAAGG - Intergenic
959365274 3:105450424-105450446 GTGTGTGTATGTGAGGTAGTGGG - Intronic
959384151 3:105680883-105680905 GTGTGTGTATATGTTGAAGTTGG - Intronic
959599291 3:108161361-108161383 ATCTGTGTATGTGAGCATGTTGG + Exonic
960533483 3:118791552-118791574 GTGTGTGTGTGTGTTGAAATGGG - Intergenic
961172514 3:124807986-124808008 ATGTCTGTGTGTTGTGAAGTGGG + Intronic
961315207 3:126030021-126030043 GTGTGTGAATGGTATGAAGTAGG - Intronic
962879006 3:139558717-139558739 ATATATGTATTTAATGAAGTAGG + Intergenic
963076991 3:141356069-141356091 TTGTGTGTGTGTGGTGGAGTGGG + Intronic
964276693 3:155016150-155016172 ATATGTGTGTGTGAGGGAGTAGG - Intergenic
964489451 3:157219736-157219758 GTGTGTGTATGAAATAAAGTAGG - Intergenic
964514144 3:157488973-157488995 GTATGTGCATGTGATGAAGAGGG - Intronic
965754928 3:172015990-172016012 ATATGTGTGAGTGATGAGGTAGG - Intergenic
965791709 3:172395583-172395605 ATGTTAGTTTGTGATAAAGTGGG + Intronic
967984801 3:195086814-195086836 ATGCATGTAGGTGATGAAGGGGG + Intronic
968065372 3:195755885-195755907 GTGTGTGTAAGTGGTGAAGGAGG + Intronic
968490411 4:887940-887962 ATGTGTGCATGTGAGGGAATGGG - Intronic
969061035 4:4435067-4435089 ATGTGTGTGTGTGATGGGGAGGG + Intronic
969240459 4:5893560-5893582 TTGTGTGTTTGTAATGAACTCGG - Intergenic
969443338 4:7230022-7230044 ATGTATGAAGGAGATGAAGTTGG + Intronic
970279638 4:14440276-14440298 ATGTGTGTATGTGATGGAAGTGG - Intergenic
970738380 4:19201404-19201426 GTGTGTGTATGTGACAAAGGAGG - Intergenic
970807648 4:20054897-20054919 AAGTGTGAATGTGAAGAAGGAGG - Intergenic
970898676 4:21133227-21133249 CATTGTGTATGTGAGGAAGTAGG - Intronic
971221884 4:24716551-24716573 ATCTGTGTATTTGAAGAAGTAGG + Intergenic
971314470 4:25555883-25555905 GTGTGTGTGTGTGTTTAAGTCGG + Intergenic
971478177 4:27091274-27091296 ATGTGTGTATTTGCTCAGGTGGG + Intergenic
971688204 4:29798452-29798474 AAGTGAGAAAGTGATGAAGTTGG - Intergenic
973699256 4:53520584-53520606 AAGTGTGTATGTGATGTGATGGG + Intronic
974043636 4:56879089-56879111 AAGTGTGTCTGTGGTGAAATGGG + Intergenic
974070043 4:57115006-57115028 AGGTGAGTATGTGGAGAAGTGGG + Intergenic
974104417 4:57453679-57453701 ATCTGTGCATTTGAAGAAGTAGG + Intergenic
974584223 4:63850828-63850850 ATGTGTGTATTTGAGAAAGGGGG + Intergenic
974664379 4:64938645-64938667 ATACGTGTATGTGAAGAAGTTGG + Intergenic
974701006 4:65446721-65446743 ATGTGTGTATGTGTTGTGGAGGG + Intronic
974872982 4:67666510-67666532 ATGTGTGTATATGTTTAAATAGG - Intronic
974921581 4:68247804-68247826 TTTTGTGTACATGATGAAGTGGG + Intergenic
974937762 4:68428779-68428801 GTGTGTGTGTGGGAGGAAGTGGG + Intergenic
975009056 4:69325762-69325784 ATGTGATGGTGTGATGAAGTGGG + Intronic
975072843 4:70163653-70163675 ATGTGTGTATGTGATCAGGGTGG - Exonic
975980611 4:80154314-80154336 ATGTGTGTATGTGATACCGTGGG + Intergenic
976997676 4:91455815-91455837 ATGTGTGTATGTGGAGGAATGGG + Intronic
977133902 4:93277731-93277753 ATGTGTGAAAGGGGTGAAGTGGG - Intronic
977258014 4:94761449-94761471 GTGTGTGTGTGTGTTGAAGGGGG + Intronic
977546614 4:98389527-98389549 ATGTGAGTATATAATGAATTTGG + Intronic
977622302 4:99151154-99151176 AATTTTGTATGTGATTAAGTTGG + Intronic
978309925 4:107375913-107375935 GTGTGTGTGTGTGAAGAAGGGGG - Intergenic
980039955 4:127927864-127927886 GTGTGTGTCTGTGAAGAAATAGG + Intronic
980145784 4:128982289-128982311 AAGTGTGCATGAGATGAAATGGG + Intronic
980335017 4:131460909-131460931 ATATATGTATATGAAGAAGTGGG - Intergenic
980427839 4:132649325-132649347 ATATGTGTATGTGTTTATGTTGG + Intergenic
980843058 4:138290076-138290098 ATGTGATTATATAATGAAGTTGG + Intergenic
982175306 4:152700579-152700601 ATGTGAGTCTGGGATGGAGTTGG - Intronic
983737805 4:171085632-171085654 GTGTGTGTGTGTCAAGAAGTTGG + Intergenic
984231054 4:177099553-177099575 ATGTGTGTATGTATATAAGTAGG - Intergenic
984333715 4:178360196-178360218 ATGTTTGTATATCATGAAGCTGG + Intergenic
984822856 4:183898254-183898276 ATGTGTGTGTGGGCTGAAGCAGG + Intronic
985255905 4:188069880-188069902 ATGTTTGTATTGGATGAAGAGGG - Intergenic
985315736 4:188657261-188657283 CTGTGTATATGTGGTGAAATGGG - Intergenic
985416446 4:189740720-189740742 ATGTTTGGATGTGATGATTTGGG - Intergenic
987280070 5:16404687-16404709 ATGTGTGTAAGTGATGACATGGG + Intergenic
987990739 5:25208118-25208140 ATGTGTGTATGTGAATGTGTGGG - Intergenic
988001512 5:25355484-25355506 GTTTGTGTATGTTAGGAAGTGGG + Intergenic
988646843 5:33104519-33104541 GTGTGTGACTGTGAAGAAGTTGG + Intergenic
988700726 5:33671923-33671945 GTGTGTGTATGTGAGTATGTGGG - Intronic
988780752 5:34519536-34519558 ATATGTGTCTGTCATGAATTCGG - Intergenic
988847829 5:35146938-35146960 ATGTGTGTGTGTGGTGAAGTGGG - Intronic
989992105 5:50779168-50779190 GTGTGTGTATGTGTGGTAGTAGG - Intronic
991942874 5:71870658-71870680 AAGTTTTTATGTCATGAAGTTGG - Intergenic
992515019 5:77482693-77482715 ATGTGTATATGTTATGATTTAGG + Intronic
993276465 5:85866072-85866094 AGGTGTGTAGGTCATGAGGTTGG + Intergenic
994815408 5:104580319-104580341 ATGTGTGTTTGTGATGAGACAGG + Intergenic
994914350 5:105954494-105954516 GTGTGTGTGTGTGATACAGTAGG - Intergenic
995783285 5:115800851-115800873 ATGTGTGTATGTATTGATATAGG - Intergenic
996771568 5:127092137-127092159 ATGTGAGTAAATGATGAAGGTGG - Intergenic
996907996 5:128623796-128623818 ATGTCTGCATGTGAGGATGTGGG - Intronic
996980273 5:129483551-129483573 ATGTGTGTGTGTGAAGAAGGAGG + Intronic
996994838 5:129683226-129683248 ATGTGTGTATGTGGGGGAGGGGG + Intronic
997008467 5:129848559-129848581 ATGTGAGTGTGTGATAAAATAGG - Intergenic
997202155 5:132017291-132017313 GTGTGTGTATGTGGTGAGGGGGG + Intergenic
998034519 5:138903288-138903310 ATGTGTTTATGTGCTTAAGTTGG + Intronic
998374817 5:141683200-141683222 CTGTTTGTATGAGAGGAAGTTGG + Intergenic
999208889 5:149870579-149870601 CTGTGTGCATGGGATGAAGGAGG + Intronic
1000086037 5:157888096-157888118 ATTTGTATATGCTATGAAGTAGG + Intergenic
1000383373 5:160649039-160649061 TTGTGTGTGTGTGATAAAGAGGG - Intronic
1000604259 5:163311607-163311629 ATGTGTGTATGTTATGGGGAGGG - Intergenic
1000618208 5:163453903-163453925 ATCTGTTTATCTGATTAAGTTGG + Exonic
1003415461 6:5903613-5903635 ATATGTGTAACTGAAGAAGTAGG + Intergenic
1004194469 6:13490689-13490711 ATGTGTGTGTGTGTTGGGGTGGG - Intergenic
1004557475 6:16713582-16713604 GTGTGTGTATATGAAGAAGGGGG + Intronic
1006410712 6:33871798-33871820 ATCTGTTTCTGTGATGATGTTGG + Intergenic
1006697735 6:35945669-35945691 AAGTGTGAATGAGATGTAGTTGG - Intronic
1006959326 6:37912060-37912082 GTGTGTGTGTGTGATGGTGTAGG + Intronic
1007302801 6:40880916-40880938 GTGTGTGTTTGTGTTGGAGTGGG - Intergenic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1008450088 6:51641183-51641205 ATGTGAGTGAGTCATGAAGTAGG - Intronic
1008788063 6:55194745-55194767 ATGTGTGTTTGTCATTCAGTAGG + Intronic
1008832029 6:55776354-55776376 AAGTGTTTATGTATTGAAGTGGG - Intronic
1009786819 6:68350981-68351003 ATGAATGAGTGTGATGAAGTTGG - Intergenic
1010090469 6:71974261-71974283 ATGTGTGTATGTGGTTTCGTGGG + Intronic
1011135660 6:84097208-84097230 ATGTGTGTGTGTGGTGGGGTAGG + Intergenic
1011485020 6:87832277-87832299 GTGGGTGTAGGGGATGAAGTGGG + Intergenic
1012276014 6:97276562-97276584 ATGTGTGTGAGTGATGAATTTGG - Intronic
1014104725 6:117548556-117548578 ATGTGTGTGTGTGATCCAGTAGG + Intronic
1014370032 6:120594488-120594510 ATGTGTGCATGAGAGAAAGTGGG + Intergenic
1014392351 6:120878152-120878174 AAGAGTGTATGTGATGAAGAAGG - Intergenic
1015028133 6:128561913-128561935 ATGTGTATATGGTATGAATTTGG - Intergenic
1015084435 6:129271831-129271853 ATGTGTAGATGTGATCAAGTAGG + Intronic
1015187848 6:130438918-130438940 ATGTGGGTATGTGAAGAACAGGG + Exonic
1016591385 6:145748262-145748284 TTTTGTGTATGATATGAAGTAGG - Intergenic
1016862466 6:148734606-148734628 ATGTGTGTGTGTGTTGGAGATGG - Intergenic
1016951090 6:149581014-149581036 ATGTGTGTATGCGAGGTAGCGGG - Intronic
1017073239 6:150595126-150595148 ATGTGTGTGTGTGGTGGAGGTGG - Intergenic
1017610510 6:156181294-156181316 ATGTGTGTGTGTGATCTATTTGG - Intergenic
1018378858 6:163239819-163239841 ATGTGAGTGTGTGTAGAAGTAGG - Intronic
1018791132 6:167148626-167148648 ATGTGTGTTTAAGATGAAGATGG + Intronic
1018898212 6:168035892-168035914 GTGTGTGGATGTGATGAGGGAGG - Intronic
1019229820 6:170550708-170550730 TTGTGTGTTTGTGATGATTTTGG - Intronic
1019264725 7:107975-107997 ATGTGTGCATGTGCTCAGGTTGG - Intergenic
1021434987 7:20603911-20603933 ATGTGTGTGTGTGCTGGGGTTGG - Intergenic
1021559287 7:21953503-21953525 GGGTGTGTGTGTGATGAAGTGGG - Intergenic
1022448264 7:30488368-30488390 AGGTGAGTATGCCATGAAGTTGG - Intergenic
1023517429 7:41015896-41015918 ATGTATGTGTGTGTGGAAGTAGG + Intergenic
1024129739 7:46338561-46338583 ATCTGTTTATGTGATGGAGTAGG + Intergenic
1025640493 7:63362902-63362924 ATGTATGTATGTGATGTTGCTGG + Intergenic
1025642206 7:63385191-63385213 ATGTATGTATGTGATGTTGCTGG - Intergenic
1026669545 7:72376855-72376877 TTTTGTATATGTTATGAAGTAGG + Intronic
1027500311 7:78941719-78941741 GTGTGTGTGTGTGATGAAATAGG - Intronic
1028795988 7:94905221-94905243 ATGTGTGTATGTGAATCATTGGG - Intergenic
1028878101 7:95846655-95846677 GTGTGTGTGTGTGACGAAGGGGG + Intronic
1028953448 7:96662771-96662793 TTTTGTGTATGATATGAAGTAGG - Intronic
1029449759 7:100634169-100634191 GTGTGTGTGTGTGTTGACGTCGG - Intronic
1029976392 7:104838690-104838712 ATGTGTCTATGGTATGAAATTGG - Intronic
1030369288 7:108678820-108678842 GTGTGTGTGTGTGATGTAGAAGG - Intergenic
1031974927 7:128087575-128087597 ATGTGTGGATGTGTTGCTGTTGG + Intronic
1032178361 7:129652326-129652348 ATGTGTGTATATGTTCATGTGGG + Intronic
1032367353 7:131312493-131312515 AATTTTGTATGTGATAAAGTTGG - Intronic
1032675275 7:134124378-134124400 GTGTGTGTATGTGTTGGAGCAGG - Intergenic
1034060368 7:148081840-148081862 ATGAATGTATGTGAGAAAGTGGG + Intronic
1035120039 7:156559402-156559424 ATGTGTGTAAAGGATGAATTTGG + Intergenic
1036225082 8:6951053-6951075 AGGTGTGTATGTGATGGGGCCGG - Intergenic
1036538824 8:9682428-9682450 ATTTGTGTAGGAGATGAAGCAGG - Intronic
1038397068 8:27254596-27254618 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397087 8:27254674-27254696 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397093 8:27254710-27254732 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397099 8:27254746-27254768 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397121 8:27254831-27254853 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397127 8:27254867-27254889 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397133 8:27254901-27254923 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038397139 8:27254931-27254953 GTGTGTGTAGGGGATGGAGTGGG + Intronic
1038460210 8:27709782-27709804 ATCTGGCTAAGTGATGAAGTAGG - Intergenic
1039129180 8:34242272-34242294 ATGTGTGTGTGTGAGCAAGAAGG + Intergenic
1039203790 8:35126508-35126530 AAGTGTGTATGTGTTGGGGTGGG - Intergenic
1039672886 8:39623486-39623508 ATGTGTGCATGTGGTGAAAAGGG - Intronic
1041751666 8:61267422-61267444 ATGTGTGTATGTATTGGAGATGG - Intronic
1041760801 8:61364051-61364073 AAGTGAGTATGTGATTAACTTGG - Intronic
1042164398 8:65931317-65931339 ATGTGTGTTTGTGGTGGAGATGG + Intergenic
1042657299 8:71113760-71113782 ATGTGTGTGTGTGTTGGGGTGGG + Intergenic
1042767669 8:72343938-72343960 ATGTGTGTGTGTGATGGGGTGGG + Intergenic
1043909765 8:85849453-85849475 TTTTTTGTGTGTGATGAAGTTGG - Intergenic
1044220255 8:89662330-89662352 ATGTGTGTGTGTGTTGTAGTGGG - Intergenic
1045639116 8:104227689-104227711 ATGTCCATATGTGATGAATTTGG + Intronic
1045779452 8:105846947-105846969 GTGTGTGTGTGTGATGGAGGCGG + Intergenic
1045941987 8:107749973-107749995 ATGTATGTTTGTGCTGATGTAGG + Intergenic
1047249436 8:123170600-123170622 ATGTGTGTGTGTGGTGCAGGGGG + Intergenic
1047686519 8:127310294-127310316 CTGTGAGTATGTGATGAGATGGG + Intergenic
1048471104 8:134704823-134704845 GTTTGTGTATGGTATGAAGTAGG - Intronic
1048504398 8:135007628-135007650 ATGTGTTAATTTGATGAAGGTGG + Intergenic
1048774611 8:137932080-137932102 ATGTGTTTATGTGGAGAAGGCGG + Intergenic
1050076473 9:1870952-1870974 ATGTGTTTGTGTGATGGGGTAGG + Intergenic
1050115843 9:2262630-2262652 ATGTGTATAAATGATCAAGTAGG - Intergenic
1050432447 9:5575277-5575299 ATGTGTGTGTGTGTTGCAGGGGG - Intergenic
1050565574 9:6878744-6878766 ATGTATGTGTGTGATGAGGAAGG + Intronic
1051287155 9:15509680-15509702 AAGTGCGTATGTGATTAAATTGG - Intronic
1051906521 9:22101657-22101679 GTGTGTGTGTGTGTTGAAGAGGG - Intergenic
1054829937 9:69613094-69613116 ATTTGTGTGTGTGATCAAGTTGG + Intronic
1054848565 9:69822282-69822304 ATGAATGAATGGGATGAAGTCGG - Intronic
1055521380 9:77084370-77084392 GTGTGTGTGTGTTATGAAGAGGG + Intergenic
1055596283 9:77868238-77868260 ATGTTTGTATTGGATGGAGTAGG - Intronic
1055913791 9:81379700-81379722 GTGTGTGTGTGTGTTAAAGTTGG - Intergenic
1056471884 9:86913231-86913253 TTTTGTGTAAGTTATGAAGTAGG - Intergenic
1056740857 9:89254248-89254270 ATGTGTGTATGTGGTGAGTGTGG + Intergenic
1056740859 9:89254305-89254327 ATGTGTGTATGTGACGAGTATGG + Intergenic
1057373960 9:94501373-94501395 ATTTTTGTATGTGGTGAAATAGG + Intergenic
1057581189 9:96289221-96289243 ATGTGTGTGTGTATGGAAGTGGG + Intronic
1057704004 9:97385102-97385124 ATGTGTGTATGTGTTGGGGCGGG - Intergenic
1059127035 9:111699091-111699113 GTGTCTATATGTGATGAAGTGGG + Intronic
1059590873 9:115660140-115660162 ATGTCTGTTTGTGATGATGAAGG + Intergenic
1059604139 9:115815057-115815079 ATGTGTGTATGTAAAGCACTTGG + Intergenic
1059677320 9:116551672-116551694 ATGTGTGTTTGTGTTGTAGGGGG - Intronic
1059764508 9:117371078-117371100 TTTTGGGTATATGATGAAGTAGG - Intronic
1059935128 9:119302726-119302748 TTGTGTGTGTGTTTTGAAGTAGG - Intronic
1060755443 9:126209130-126209152 ATGTGTGTGTGTGTTGGAGTTGG - Intergenic
1203636624 Un_KI270750v1:118315-118337 ATGTTTGGATGTGATGATTTGGG + Intergenic
1185742850 X:2547744-2547766 ATGTGTGTATGTGTGTATGTGGG + Intergenic
1185957624 X:4508967-4508989 ATTTTTATTTGTGATGAAGTAGG + Intergenic
1186314451 X:8354121-8354143 ATGTGGGTAGGTCATGAAGCTGG - Intergenic
1186651560 X:11567004-11567026 GTGTTTGTCTGTGATGATGTGGG - Intronic
1186726449 X:12364133-12364155 ATGTGTGTGTGTGTGGCAGTGGG - Intronic
1186782913 X:12931131-12931153 ATGTGTGTAGGTGCTGAGATGGG - Intergenic
1187384513 X:18835349-18835371 AATTTTGTATGTGATCAAGTTGG + Intergenic
1188435629 X:30155151-30155173 ATTTCAGTGTGTGATGAAGTAGG + Intergenic
1188547628 X:31326647-31326669 GTGTGTGTATGTGATTATGATGG - Intronic
1189260325 X:39674047-39674069 GTGTGTGTATGTGGACAAGTGGG - Intergenic
1189536821 X:41943809-41943831 AATTGTATATGTGATGAAATGGG + Intergenic
1189889092 X:45580549-45580571 ATCTGTGTATTTTAAGAAGTAGG + Intergenic
1190106295 X:47563203-47563225 CTGTGTGTATGTGCAGATGTAGG - Intronic
1190869316 X:54411874-54411896 ATGTTTTTAGGCGATGAAGTGGG - Intergenic
1190960817 X:55245313-55245335 ATCTGTTTATGTGATAAATTAGG - Intronic
1191165645 X:57387865-57387887 ATGTGTGTATCTGAGGAGGGAGG + Intronic
1192205655 X:69094408-69094430 ATGTGTGTATGTGATGGTATGGG - Intergenic
1192990791 X:76454116-76454138 ATGTGTTTGTGTGCTGAAATAGG + Intergenic
1193498781 X:82246229-82246251 GTTTGTATATGTGATGAAGGAGG + Intergenic
1194277678 X:91907065-91907087 TTGTCTGTATGGCATGAAGTTGG - Intronic
1194610928 X:96043423-96043445 AGGTGTGTACCTCATGAAGTTGG - Intergenic
1194780004 X:98012280-98012302 ATATATGTATGATATGAAGTAGG + Intergenic
1196961041 X:121001777-121001799 AATTTTGTATGTGATCAAGTTGG - Intergenic
1197122900 X:122913480-122913502 GTGTGTGCATTTGAGGAAGTAGG + Intergenic
1197216404 X:123870942-123870964 GTGTGTGTGTGTGAGGGAGTCGG + Intronic
1197466819 X:126814933-126814955 GTGTGTGTGTGTGGTGAAATGGG - Intergenic
1198146568 X:133863594-133863616 GTGTGTGTGTGTGTTGATGTTGG - Intronic
1198435912 X:136616788-136616810 GTGTGGGTATGTGAGGGAGTGGG - Intergenic
1198554394 X:137777314-137777336 GTGTGTGTGTGTGTAGAAGTGGG + Intergenic
1198707668 X:139466508-139466530 ATGTGTATATGTGCTGATATAGG - Intergenic
1199782907 X:151079992-151080014 ATGTGTGGATGTGTTGAAGGGGG + Intergenic
1199953755 X:152726011-152726033 AGGTGTGTATGTGAGCAGGTTGG + Intergenic
1200114144 X:153762778-153762800 ATGTGTGTGTGTGTTGGGGTAGG + Intergenic
1200342588 X:155413829-155413851 TTTTGTGTATGTTGTGAAGTAGG - Intergenic
1200595020 Y:5129142-5129164 TTGTCTGTATGGCATGAAGTTGG - Intronic