ID: 1135665188

View in Genome Browser
Species Human (GRCh38)
Location 16:24329635-24329657
Sequence ATGAAGAAAGTGTCACATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 5, 3: 15, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135665185_1135665188 -5 Left 1135665185 16:24329617-24329639 CCTGCATTACCTTTTTTAATGAA 0: 1
1: 0
2: 3
3: 60
4: 351
Right 1135665188 16:24329635-24329657 ATGAAGAAAGTGTCACATTAGGG 0: 1
1: 0
2: 5
3: 15
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135665188 Original CRISPR ATGAAGAAAGTGTCACATTA GGG Intronic
902902770 1:19531320-19531342 TTGAAGGAAGTGTCAAATTGTGG - Intergenic
903079604 1:20798970-20798992 ATGAAGAAAGGGTGACAGTATGG - Intergenic
904013623 1:27404441-27404463 AAGAGGAAAGGGTCACTTTAGGG + Exonic
905094643 1:35459072-35459094 ATGGATAAACTGTCACACTATGG + Intronic
906941755 1:50261726-50261748 AGGCAGAGAGTGTCAGATTAGGG - Intergenic
906976677 1:50581780-50581802 ATGAAGAAAGAGTAAGATTATGG + Intronic
908112103 1:60908163-60908185 AAGAAGAAAGGGTCTCATGAAGG + Intronic
908899851 1:68944140-68944162 ATGAGGAAACTGGAACATTAGGG - Intergenic
909338855 1:74509068-74509090 AAGAAGAAAGTGTCTGAATAAGG - Intronic
910238203 1:85057823-85057845 ATGCAGAAAGTGACAAATTTAGG + Intronic
914788328 1:150853710-150853732 AATAGGAAAGTGTCACATAAGGG + Intronic
914873506 1:151494896-151494918 ATGAAGAAAGAGTGACAGTGTGG + Intergenic
915688665 1:157663698-157663720 ATGAAGAAAGTGCAAAATAATGG + Intergenic
915704222 1:157828311-157828333 ATGAAGAAAGTGTTTCAAGAAGG - Intergenic
915794382 1:158712718-158712740 ATGAAGAAAATGTTACAAAAAGG + Intergenic
919073614 1:192787690-192787712 ATGAACAAAGTGTCAAGTCATGG + Intergenic
919518974 1:198563677-198563699 ATGAGGAAAGTGTCATGTAAAGG + Intergenic
919574909 1:199295787-199295809 ATGAATAAAGTGTTACATAAAGG - Intergenic
919602983 1:199645926-199645948 ATCAAGAAAGCTTCAAATTATGG + Intergenic
921137307 1:212273259-212273281 AAGAAGATAGTATCAGATTATGG - Intergenic
921327892 1:214005818-214005840 ATGAATAAAGTGACAGATTCAGG + Intronic
921842989 1:219847786-219847808 AGGAAGAGAGTATCACATTAAGG + Intronic
922861773 1:228824594-228824616 ATGAAGACATTGTCAGATGAAGG - Intergenic
923010151 1:230082251-230082273 ATGAAGCAGGTGTCACATTTGGG + Intronic
923666566 1:236003519-236003541 ATGAAGAAAGTGTTTCAGGAAGG + Intronic
924075252 1:240327570-240327592 ATGAAGAAAATGTGATATTTTGG + Intronic
1062784647 10:252880-252902 AAGAAAAAAATGTCACATCAAGG - Exonic
1062799163 10:367115-367137 AGGAAGAAAGATTCACATTAAGG + Intronic
1063763634 10:9111103-9111125 ATGAATAAAATTTCACATGAAGG + Intergenic
1063814183 10:9754382-9754404 TTGATGAAAATGTCTCATTAAGG - Intergenic
1065977349 10:30854017-30854039 ATGAATAAAGTATCACATATAGG + Intronic
1066314316 10:34228810-34228832 ATGAAGAGAGTTTCACATGGTGG - Intronic
1066516466 10:36166644-36166666 TTGTAGAATGTCTCACATTATGG - Intergenic
1068476244 10:57530304-57530326 ATAAAGAAAGTCACACACTAAGG - Intergenic
1070294206 10:75145241-75145263 ATGAAGAAATAGACACATAATGG - Intronic
1075456708 10:122589591-122589613 ATGAAGAAAGAGGCAGATTTGGG + Intronic
1077431978 11:2520283-2520305 ATGTGGAAGGTGTCACATCATGG - Intronic
1077965664 11:7129995-7130017 ATCAAGAAATTGTCAGATGAAGG - Intergenic
1079576449 11:22009200-22009222 ATGAAGAAACTGACGCATTTGGG - Intergenic
1080756809 11:35208325-35208347 ATGAAGACAGTTTCACACTCTGG - Intronic
1081237404 11:40661973-40661995 ATGAGGAAGCTGTCATATTAGGG + Intronic
1082911581 11:58382048-58382070 AAAAAGAAAGGGACACATTAAGG + Intergenic
1085720603 11:78909385-78909407 ATGAGGAAACTGACACATAAAGG + Intronic
1086253423 11:84845638-84845660 ATGAAGGAAGTGTTTCAATAGGG - Intronic
1087388761 11:97508001-97508023 ATGAAGGAAGACCCACATTATGG + Intergenic
1087704188 11:101470402-101470424 ATGGATAAAGTGTCATATGAGGG - Intronic
1087711545 11:101559303-101559325 ATGAATACAGTGTAAAATTAGGG - Intronic
1088474875 11:110225151-110225173 ATGAAGAAGGTGTTACAAAAAGG - Intronic
1088641143 11:111874061-111874083 ACGAATAAAGTGTCAGATTTAGG - Exonic
1091113773 11:132995118-132995140 AGGGAGAATGTGTCATATTATGG + Intronic
1091512321 12:1140592-1140614 ATGAATAATGTTTCACATTTAGG - Intronic
1092017663 12:5172675-5172697 ATTAATAAAGTGTCACATTGAGG + Intergenic
1092059754 12:5538761-5538783 ATGAAGAAAGTGTATCAGGAAGG + Intronic
1094099784 12:26749696-26749718 ATGAAGAAAATGGAATATTAAGG - Intronic
1095171462 12:39041011-39041033 ACGAAGTATGTGTCTCATTAGGG - Intergenic
1095220110 12:39601521-39601543 ATGAAGAAGTTGTCTTATTATGG + Intronic
1095567708 12:43645887-43645909 ATGAAGCAACTGTCCCTTTAAGG - Intergenic
1100032670 12:90212034-90212056 AAGAAGAAAGTGACACGTTTGGG + Intergenic
1100201343 12:92300940-92300962 GTGAAGAAAGTGTCTCAAGAAGG + Intergenic
1100341459 12:93683499-93683521 TTGAAGCAAGTGTCAGCTTAGGG - Intronic
1102092126 12:110200051-110200073 AAAAAGAAAGGGTAACATTATGG - Intronic
1103550297 12:121732267-121732289 GTGGAGAATGTGTCACACTAAGG + Intronic
1104240907 12:126988420-126988442 ATGAAGAAAGTGATACAGTTTGG + Intergenic
1105426103 13:20296344-20296366 TTGAAGAAAGTGCCAAATTGTGG - Intergenic
1105458699 13:20564621-20564643 ATAAAGAGAGTGTCACCTTCTGG - Intergenic
1105711350 13:23012210-23012232 TTGAAGAAACTGTGACATGATGG - Intergenic
1106952424 13:34899262-34899284 ATGAAGAAAGTCTCATTTGAGGG - Intergenic
1107628879 13:42321955-42321977 ATGAAAGAACTGTCACATTTTGG - Exonic
1108110382 13:47065200-47065222 ATGAAGAAAGTTTCACTTGCTGG - Intergenic
1108130846 13:47298654-47298676 ATGAAGAAGGGGTCACCTGAAGG + Intergenic
1109434258 13:62277953-62277975 AATAAGAAAGTGGCACATTTAGG - Intergenic
1109485453 13:63012403-63012425 AAGAAGAATGTGTCAAATAATGG + Intergenic
1109792798 13:67271403-67271425 ATCAAGAAAGTGACATTTTAGGG + Intergenic
1109956502 13:69574451-69574473 ATGAAGAAACTGAGACATTGGGG + Intergenic
1110418958 13:75283254-75283276 ATAATGAGAGTGTCACATCATGG + Intergenic
1110668014 13:78140884-78140906 GTGAAGAAAATGGCACATTCAGG + Intergenic
1110934486 13:81269661-81269683 ATGAACAAACTGTCACTTGAGGG - Intergenic
1112961370 13:105131451-105131473 ATGAAGAAAAAGCCACATTTTGG - Intergenic
1113454738 13:110440197-110440219 ATAAATGAAGTGTCACAGTATGG - Intronic
1113681727 13:112249203-112249225 AGGAACAAAGGGTCCCATTATGG - Intergenic
1115333959 14:32226975-32226997 ATGAAGATAGTGCAGCATTAGGG + Intergenic
1116777408 14:49196696-49196718 ATGAAGAAAGGTGCACATTTAGG - Intergenic
1118891746 14:69915776-69915798 CTGAGGAAAGTGTCCCATGATGG - Intronic
1120376499 14:83714427-83714449 AGGAAGATAGTGACCCATTATGG - Intergenic
1120520584 14:85523244-85523266 AAGAAGACATTGTCACTTTATGG + Intergenic
1121396447 14:93627892-93627914 AAGAAGAAGGTGCCACATTCTGG - Intronic
1121748061 14:96318341-96318363 CTGAAGAAACTGTCTCATAAAGG + Intronic
1122868102 14:104618698-104618720 AAAAAGAGAGTGCCACATTAAGG - Intergenic
1124007038 15:25802737-25802759 TGGAAGAAAGTGTCAGATGAGGG - Intronic
1124611244 15:31210529-31210551 CTGAAGAATGTCTCACATTCTGG - Intergenic
1124881313 15:33645456-33645478 AGGAAGAAAGTGGGGCATTAAGG - Intronic
1125580851 15:40784532-40784554 ATGAGGAAACTGTGACATAAGGG + Intronic
1129131203 15:73498227-73498249 ATGAGGAAAAAGTCACATCAAGG - Intronic
1129856255 15:78827455-78827477 ATGAAGTAACTGTCCCATTCTGG - Intronic
1131315919 15:91337341-91337363 ATGAAAAAAGAGTCAAATCATGG - Intergenic
1131578504 15:93616447-93616469 ATTAAGATAGTCTCAAATTAAGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133519270 16:6541489-6541511 ATGACAACAGTGTCACATCAGGG + Intronic
1135665188 16:24329635-24329657 ATGAAGAAAGTGTCACATTAGGG + Intronic
1135837721 16:25842177-25842199 TTGAAGAAAAGGTCACCTTAAGG + Intronic
1139698356 16:68691636-68691658 ATGAAGAAAGTTTGAGAATACGG - Intronic
1140031389 16:71342001-71342023 AGGAAGAAGGTGTCACACTGTGG + Intergenic
1140697198 16:77546932-77546954 ATGAATGAAGTGTCACATTAAGG + Intergenic
1142313964 16:89331522-89331544 CTGAAGAAAATGGCACATTTAGG + Intronic
1143261735 17:5604420-5604442 ATGAAGAAAGTGATTCATTATGG - Intronic
1143525664 17:7470704-7470726 ATAAATAAAATGTCAGATTATGG + Intronic
1143940292 17:10533877-10533899 CTTAAGAAAGGGACACATTATGG + Intronic
1146589861 17:34119540-34119562 TTGAAGAATGAGTCACATTCAGG - Intronic
1151017994 17:70579031-70579053 AGGACGAAACAGTCACATTAGGG + Intergenic
1151197414 17:72441484-72441506 GCAAAGAAAGTGTCATATTATGG - Intergenic
1153506021 18:5799328-5799350 ATGAAGAAATTCTCACCTAATGG + Intergenic
1155906060 18:31452725-31452747 ATGAAGAAACTGAAAGATTAAGG + Intronic
1156657063 18:39301092-39301114 TTGCATAAAGTGTCACAATAGGG - Intergenic
1157688468 18:49661830-49661852 ATGCAGCAAGTGTCTCATGAAGG + Intergenic
1157780144 18:50431019-50431041 ATAAGGAGAGTGTCACATTGGGG - Intergenic
1158426316 18:57342737-57342759 ATCGAGAAAGTGTCATTTTATGG + Intergenic
1159217201 18:65408488-65408510 AGGAAGAAAGTTTCACCTTTAGG + Intergenic
1159310689 18:66704209-66704231 ATGAAGAAGGTGACAAATTGTGG + Intergenic
1159813234 18:73042204-73042226 ATTAAGAAAATGTCTCATTGTGG - Intergenic
1160133447 18:76250501-76250523 ATTAAGAAAATGTGCCATTAGGG - Intergenic
1162442563 19:10701918-10701940 TGGAAGAAAGTGTCAGGTTAGGG - Intronic
1162634199 19:11953801-11953823 TTGAAGAAAGTGTGATGTTATGG - Intronic
1162647188 19:12058442-12058464 ATGATGTTTGTGTCACATTAAGG - Intergenic
1163597497 19:18228701-18228723 ATGGAGAAAGAGTCACAGCAAGG + Intronic
1165104384 19:33460462-33460484 CTGGGGAAAGTGTCACATCATGG - Intronic
1166728391 19:45042921-45042943 ATGCAGAAAGTTTCAGATTTTGG - Intronic
925056090 2:858427-858449 ATGAGGAAAGTGTAACCTCAGGG - Intergenic
927249447 2:20984615-20984637 ATGAAGAATCTGTCACGTTTTGG + Intergenic
927815329 2:26210791-26210813 ATGAAGAAAGCTTCACAATGGGG - Intronic
928512864 2:32017633-32017655 AAAAAGAAACTCTCACATTATGG + Intronic
928666249 2:33553240-33553262 AAGAAGAATGTGTCACTTGAGGG - Intronic
931802173 2:65769119-65769141 ATGGAGAATGTGACACATTAAGG - Intergenic
932431428 2:71676409-71676431 ATGAAGAAAATTCCACAATACGG - Intronic
933857528 2:86430264-86430286 ATGAACAAATTTTCACATTTTGG + Intergenic
934914680 2:98291519-98291541 ATGCATAAAGGGTCATATTAAGG + Intronic
935130749 2:100259129-100259151 AAGAAGGAAGGGTCACCTTAAGG + Intergenic
936125398 2:109785161-109785183 CTGAAGAGAGTGTAACATTGGGG + Intergenic
936219295 2:110586307-110586329 CTGAAGAGAGTGTAACATTGGGG - Intergenic
936468017 2:112771081-112771103 ATGAAGAGAGTCCCAGATTAAGG - Intergenic
936666864 2:114607059-114607081 AGGAAGAAGGTATCAAATTAAGG - Intronic
936939044 2:117864069-117864091 ATGAAGGAAGGGATACATTAAGG + Intergenic
937667441 2:124502953-124502975 ATGAAGAAAATAATACATTACGG + Intronic
938927458 2:136057368-136057390 ATGAGGAAAATGTCACAAAAGGG + Intergenic
939688328 2:145227059-145227081 AGGAAGAAAGTGGCAGATTGAGG - Intergenic
941471857 2:165897852-165897874 ATGAAGAAAGTCTTTCATTGTGG + Intronic
941552419 2:166933786-166933808 ATGAAGATAGTGTGATATTTGGG + Intronic
943539013 2:189188196-189188218 GTGAAGAAAATGTCATATAATGG - Intergenic
943883108 2:193172822-193172844 ATAAAGCAAGTATCACAATAAGG - Intergenic
944818155 2:203400840-203400862 AAGAAGATAGTCTCATATTAAGG + Intronic
945680470 2:212907538-212907560 ATGAAGAAAATGTGAAAATAAGG - Intergenic
946912756 2:224482696-224482718 ATGAATAAAGTGTAATACTAGGG + Intronic
947310722 2:228798797-228798819 ATGAAGAGAGACTCACATTTTGG + Intergenic
947965974 2:234281830-234281852 GTGAAGAAAGTTGCGCATTAAGG - Intergenic
948157036 2:235791869-235791891 GTGAAGTAAGTGTCACCTTTGGG + Intronic
948364710 2:237447239-237447261 ATGAAGACAGCATTACATTATGG + Intergenic
1170247760 20:14242524-14242546 ATAAAGAAATTCTCACATTGAGG + Intronic
1170795452 20:19542984-19543006 TTAAAGAAAGGGTTACATTAAGG + Intronic
1170868108 20:20178284-20178306 ATGAAGAAAATGTATCATAAAGG - Intronic
1171120064 20:22560661-22560683 ATGAAGAAAGGGTTCCATTTAGG - Intergenic
1172384489 20:34524199-34524221 ATGAAAAAAGAGCCACATTAAGG - Intronic
1173995776 20:47337545-47337567 ATTAAGGAAGTGTCAAAGTAGGG - Intronic
1175175249 20:57107823-57107845 ATGAAGACAGGGTCACACTCAGG + Intergenic
1177130862 21:17253370-17253392 ATAAGGAAAGTATCACATTGTGG - Intergenic
1177797373 21:25793125-25793147 ATGAAGAAAGTGCTTCATCATGG - Intergenic
1178081445 21:29070665-29070687 ATGAATAAAGTATAACATTTTGG + Intronic
1179485544 21:41708081-41708103 AGGAAGAAAGTGACACAGGATGG - Intergenic
949373121 3:3356599-3356621 ATGAAGAAATAGTAACAGTAGGG + Intergenic
950145306 3:10645742-10645764 ATGAAGAAATTGGGACCTTAGGG - Intronic
950879087 3:16307407-16307429 ATGAAGAAAGTGTTTCATAGAGG + Intronic
950914193 3:16627074-16627096 ATTCAGAAAGTGACACACTAGGG - Intronic
952025294 3:29073330-29073352 ATGAGGAAAGAGACACATTGAGG - Intergenic
952291812 3:32024077-32024099 ATCAAGACAGTGTGATATTAGGG - Intronic
954268577 3:49489663-49489685 TGGAAGAAAATGTCACACTAGGG - Intronic
956475595 3:69616936-69616958 ATGAAGAAACTGAGATATTATGG + Intergenic
957607560 3:82422341-82422363 ATGAAGATAGTGCCTCCTTATGG - Intergenic
958023031 3:88018752-88018774 ATGAAGAAAGAGTTAAATTTAGG + Intergenic
958052779 3:88369483-88369505 AGGTAGAAAGTGTAACATTGTGG + Intergenic
958989438 3:100825246-100825268 AGGAAGTTAGAGTCACATTAAGG + Intronic
959455732 3:106558641-106558663 ATCAAGAGATTGTCAAATTAGGG - Intergenic
960519516 3:118638926-118638948 ATGAAGAAAATGTCACCTTATGG - Intergenic
960827403 3:121804682-121804704 ATGAAGAAAATTCCACATTGAGG - Intronic
962024272 3:131530667-131530689 ATGGAGAACTTGTCAAATTATGG - Intergenic
962048049 3:131781878-131781900 TTCAAGAAATTGTCACAGTAGGG - Intronic
962304789 3:134276257-134276279 ATGTTTAAAGTGACACATTACGG + Intergenic
963262610 3:143207987-143208009 AAAATGCAAGTGTCACATTAAGG + Intergenic
963999031 3:151745827-151745849 ATCCAGAAATAGTCACATTAAGG - Intronic
964704911 3:159607803-159607825 ATGGAGAAAGCATTACATTATGG - Intronic
964733804 3:159895331-159895353 ATGCAGAATGTGTCATATCAGGG - Intronic
965258829 3:166453038-166453060 AAGAAGAAAGTATCTCATAAAGG - Intergenic
965803584 3:172518849-172518871 ATGAAGAAAGTGACACCTTCAGG + Intronic
966042124 3:175504419-175504441 CTCCAGAAAGAGTCACATTAGGG - Intronic
966181487 3:177192848-177192870 ATGAAGAAACAAACACATTAGGG + Intronic
967173967 3:186846016-186846038 ATGAGGAAACTGACAGATTAAGG - Intronic
970811010 4:20093991-20094013 GTGAAGAAAGGGCCAAATTATGG - Intergenic
970856502 4:20655193-20655215 ATGAAGTATGTTTCACACTAGGG + Intergenic
971419490 4:26462421-26462443 ATGAAGAAAATGTAACAGTGTGG - Intergenic
971479794 4:27104237-27104259 ATGAAGGAAGTGTCAGAAGAAGG - Intergenic
971733311 4:30414338-30414360 ATGAAGAAATTGTAAGATTAGGG + Intergenic
971764454 4:30811745-30811767 GTGATGAAAGTGTCCCATCAAGG + Intronic
971845975 4:31917891-31917913 ATGAAGCAAATGTTAGATTAGGG + Intergenic
976445615 4:85127465-85127487 ATTAGGAGAGAGTCACATTAGGG + Intergenic
977149562 4:93493140-93493162 ATGTTGAATGTGTCACATTTTGG + Intronic
977177446 4:93834570-93834592 ATTAAGAAACACTCACATTACGG - Intergenic
977468046 4:97406483-97406505 ATATAGAAAGTTTAACATTATGG + Intronic
979040442 4:115785153-115785175 ATGAAGAAATTGACATATAAAGG - Intergenic
979589127 4:122458189-122458211 ATGAAGAAAAGGTCAGATTAGGG + Intergenic
979718688 4:123872318-123872340 ATGAAGAAAGTGGCAGGTTAAGG - Intergenic
979848409 4:125546083-125546105 ATGTAGTAAGAATCACATTAAGG - Intergenic
981559948 4:146036915-146036937 ATGAATAAATTGTGAGATTATGG + Intergenic
981723171 4:147821718-147821740 ATGAAGACTGAGTCATATTATGG - Intronic
981865605 4:149415131-149415153 ATGATGAAACTGTGACATGATGG - Intergenic
982763068 4:159311456-159311478 ATGAAGAAAGTATCCCCTTGAGG + Intronic
984516405 4:180746797-180746819 AAGGAGAAAGTGTCAGAGTAGGG - Intergenic
986892862 5:12330472-12330494 ATGAACAAAGTGTCAGTTTGAGG + Intergenic
987269189 5:16287738-16287760 ATAAAGAAAGTGTCTCAAGAAGG + Intergenic
988560355 5:32275294-32275316 ATGAAGACAGGGCCTCATTAGGG + Intronic
988642146 5:33051407-33051429 GTGAACAAATTTTCACATTATGG + Intergenic
988661613 5:33276361-33276383 ATGAGGAAACTGTCACAGTGAGG + Intergenic
992734921 5:79709388-79709410 GTAAAGAAAGTGTTACATGATGG + Intronic
993374723 5:87136936-87136958 ACTAAGAAATTGTCACATTTGGG - Intergenic
993590336 5:89787596-89787618 AGTAAGAAAGAGTCATATTAAGG + Intergenic
993632698 5:90305709-90305731 AAAAAAAAAGTGTCAGATTAGGG + Intergenic
994057492 5:95434638-95434660 ATGAAGAAATTGACAAATTGTGG - Intronic
995103511 5:108345601-108345623 AAGAAGAAATTTTCCCATTAAGG + Intronic
995163966 5:109015471-109015493 ATCAAGAAGCTGTCACATAATGG - Intronic
996479600 5:123959734-123959756 TTGTAGAATGTGTCACAATATGG - Intergenic
998560701 5:143169181-143169203 ATGTAAAAGATGTCACATTAGGG - Intronic
998814994 5:146004613-146004635 ATGAAAAAAGTGTCTCTCTATGG + Intronic
1000189003 5:158890221-158890243 ATTAAGTAAGTGTAACATTTAGG - Intronic
1001219485 5:169887527-169887549 CTGGAGAAAGTTACACATTATGG + Intronic
1001759056 5:174192576-174192598 TTGCAGAAAGTGTCACTGTAAGG - Intronic
1002412908 5:179097775-179097797 AGGAAGAAACTGCCACATTTGGG + Intergenic
1003129384 6:3382244-3382266 GGGAAGAAAGTGTCAGATGAAGG + Intronic
1004403279 6:15308454-15308476 ATGAAGAAAGCATTACATTTAGG - Intronic
1008051729 6:46906960-46906982 GTGAAGAAATGGTCACAGTAGGG + Intronic
1008058486 6:46971433-46971455 CTGAACATAGTGTCATATTAAGG - Intergenic
1008126645 6:47676578-47676600 ACTAAGAAAGTGTCACATAGTGG - Intronic
1008203347 6:48620129-48620151 ATAAAGAAAGTTTAAAATTAAGG + Intergenic
1009429261 6:63548185-63548207 ATGCAGAAAGTGTTATAGTAGGG - Intronic
1011180569 6:84615202-84615224 ATGAAGAAAGAGAAAGATTAGGG - Intergenic
1011353568 6:86450155-86450177 ATGAAGGAAGTTCCACATCAGGG - Intergenic
1013831511 6:114278343-114278365 ATGCAGAAAATGTAACCTTAAGG - Intronic
1014986977 6:128023358-128023380 ATGAAGAAAATTTGACTTTAGGG - Intronic
1015380926 6:132567872-132567894 ATGAAGAATGTTTCACACTCTGG + Intergenic
1016168647 6:140979630-140979652 ATGAAGAATGTGTGACTTTTAGG - Intergenic
1016282732 6:142436823-142436845 ATGAAGACTGTTTCTCATTATGG + Intronic
1016726895 6:147381675-147381697 ATGAATAACGTGTCATTTTATGG - Intronic
1018290302 6:162286189-162286211 ATGTATAAAATGCCACATTAGGG + Intronic
1019571483 7:1714691-1714713 AAGAAGAAAGTCTCAGATCAGGG - Intronic
1020757928 7:12227086-12227108 ATGCAGAAATTCTCACATTTTGG + Intronic
1020967692 7:14892537-14892559 ATGAATAAATTTACACATTAAGG + Intronic
1022538685 7:31115031-31115053 ATGGAAAAAGTGTCTCAATAGGG - Intergenic
1023407175 7:39846656-39846678 ATAAACAAAGAGTAACATTAAGG - Intergenic
1025971411 7:66329586-66329608 ATGAACAAAGTGTCATATACTGG - Intronic
1026772923 7:73213495-73213517 ATGAAGAAAATGTCACATGAAGG - Intergenic
1027013786 7:74766891-74766913 ATGAAGAAAATGTCACATGAAGG - Intergenic
1027074252 7:75179141-75179163 ATGAAGAAAATGTCACATGAAGG + Intergenic
1029792630 7:102861353-102861375 ATGCAGAATGTCTCACATTCTGG + Intronic
1029847867 7:103431507-103431529 ATAGAGAAAGGGTCTCATTATGG + Intronic
1030788354 7:113691240-113691262 ATAAAGAAAGTGTGATATTGGGG + Intergenic
1030866971 7:114711790-114711812 ATGTGGAAATTGTGACATTAGGG - Intergenic
1031133832 7:117863720-117863742 ATGAAGTAAGTGCCAAATGAAGG + Intronic
1031234711 7:119159899-119159921 AGTAAGATAGTGTCACATTGTGG + Intergenic
1031832611 7:126646025-126646047 AGAGAGAAAGTGTTACATTAAGG + Intronic
1033722458 7:144075840-144075862 AAAAAGAAAGTGTCATATTTAGG + Intergenic
1033813138 7:145040982-145041004 TTAAAGAAATTTTCACATTAGGG + Intergenic
1034515768 7:151577960-151577982 TTAAAAAAAGTGTTACATTATGG + Intronic
1035885118 8:3283282-3283304 ATAAAGAAAGTGTCAGACTGGGG + Intronic
1037069927 8:14631559-14631581 ATGAATAAAGTCTCAGATTGAGG + Intronic
1038169938 8:25121881-25121903 ATAAGGAATGTGTCACATGAAGG - Intergenic
1039196389 8:35036219-35036241 CTGGAGAAAGAGTCACATTAAGG + Intergenic
1039219888 8:35318698-35318720 ATAAAGAAAGTGTAATATAATGG - Intronic
1041628671 8:60060361-60060383 ATCAAGAAAGCAGCACATTATGG + Intergenic
1043199226 8:77342092-77342114 AAGAAGAAAGTATCACTTTGTGG + Intergenic
1043213489 8:77553993-77554015 AAGAAGAAAATGACACATAATGG + Intergenic
1044070529 8:87754458-87754480 ATGAATATAGTGTCATATAAAGG + Intergenic
1044829957 8:96237431-96237453 ATGAAGAAATTGTGACAGCATGG - Intergenic
1045617297 8:103932852-103932874 ATAGAGATAGGGTCACATTACGG - Intronic
1046740387 8:117821477-117821499 ATTTAGAAATTGTCAGATTAAGG - Intronic
1046790999 8:118321956-118321978 AAGAAGAATGTGGCACATTGAGG - Intronic
1047918918 8:129612733-129612755 ATGGAGAAATTGTCACATCCAGG + Intergenic
1050302492 9:4273933-4273955 ATGAACAAAGCTGCACATTATGG - Intronic
1051136180 9:13924328-13924350 AGGAAGAAAGATTAACATTAAGG + Intergenic
1052038941 9:23716028-23716050 ATGTAGAAAATCTCACATAACGG + Intronic
1052380966 9:27770547-27770569 ATGTACAAAGTGTCATATTTTGG + Intergenic
1052584314 9:30406091-30406113 TGGATGAAAGTATCACATTATGG - Intergenic
1054946499 9:70801817-70801839 AATAAGAAAGTGGCACTTTAAGG + Intronic
1055418005 9:76105163-76105185 ATGAAGAAAATGTGGCATAATGG + Intronic
1060163555 9:121389300-121389322 ATGAAGTTAGTGTCACAAAAGGG + Intergenic
1061735353 9:132652599-132652621 ATGAAGAAAGGGACAAAATAAGG + Intronic
1186000132 X:5000256-5000278 ATGAAGCACATGCCACATTAAGG + Intergenic
1187621375 X:21060074-21060096 ATGAACATATTTTCACATTATGG - Intergenic
1188773120 X:34178880-34178902 ATGAAGAAAGAGAAAAATTACGG - Intergenic
1189682172 X:43527930-43527952 AGGAAGCAAGTGTGACGTTATGG - Intergenic
1189954768 X:46266341-46266363 ATCAACAAAATGTCACACTAGGG + Intergenic
1190137305 X:47808478-47808500 AAGAGGAAAGGGTCACTTTAGGG - Intergenic
1191626073 X:63273043-63273065 ATGAAGAGAGAGTCCCCTTATGG - Intergenic
1193674902 X:84438188-84438210 AAGAATAAAATGACACATTAGGG - Intronic
1196425611 X:115566346-115566368 AAGAAGAAAGTATCACATGTAGG - Intronic
1198174267 X:134139949-134139971 ATGAAGTATGTGGCACATAATGG + Intergenic
1198176192 X:134158162-134158184 ATGTAGTAAGTGCCATATTAGGG - Intergenic
1198534340 X:137572638-137572660 ATGGAGAAAGTGGTAAATTATGG - Intronic
1201324703 Y:12743605-12743627 ATGCAGAAAGTTTCAGATTTTGG + Intronic
1201564619 Y:15353341-15353363 ATGAAGACAGTGTGACATGGAGG + Intergenic