ID: 1135667878

View in Genome Browser
Species Human (GRCh38)
Location 16:24351281-24351303
Sequence CCACCATGCCTGGCTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1518
Summary {0: 1, 1: 5, 2: 71, 3: 270, 4: 1171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135667878_1135667883 6 Left 1135667878 16:24351281-24351303 CCAGTTTCAGCCAGGCATGGTGG 0: 1
1: 5
2: 71
3: 270
4: 1171
Right 1135667883 16:24351310-24351332 CCTGTAACCCCAGCACTTTTGGG 0: 12
1: 910
2: 5300
3: 5574
4: 4358
1135667878_1135667890 22 Left 1135667878 16:24351281-24351303 CCAGTTTCAGCCAGGCATGGTGG 0: 1
1: 5
2: 71
3: 270
4: 1171
Right 1135667890 16:24351326-24351348 TTTTGGGAGGCCAAAGCGGGTGG 0: 44
1: 2035
2: 29007
3: 124193
4: 176934
1135667878_1135667881 5 Left 1135667878 16:24351281-24351303 CCAGTTTCAGCCAGGCATGGTGG 0: 1
1: 5
2: 71
3: 270
4: 1171
Right 1135667881 16:24351309-24351331 GCCTGTAACCCCAGCACTTTTGG 0: 2920
1: 221507
2: 272433
3: 184695
4: 142229
1135667878_1135667889 19 Left 1135667878 16:24351281-24351303 CCAGTTTCAGCCAGGCATGGTGG 0: 1
1: 5
2: 71
3: 270
4: 1171
Right 1135667889 16:24351323-24351345 CACTTTTGGGAGGCCAAAGCGGG 0: 10
1: 177
2: 589
3: 1867
4: 13794
1135667878_1135667884 9 Left 1135667878 16:24351281-24351303 CCAGTTTCAGCCAGGCATGGTGG 0: 1
1: 5
2: 71
3: 270
4: 1171
Right 1135667884 16:24351313-24351335 GTAACCCCAGCACTTTTGGGAGG 0: 6
1: 646
2: 1361
3: 4042
4: 4256
1135667878_1135667888 18 Left 1135667878 16:24351281-24351303 CCAGTTTCAGCCAGGCATGGTGG 0: 1
1: 5
2: 71
3: 270
4: 1171
Right 1135667888 16:24351322-24351344 GCACTTTTGGGAGGCCAAAGCGG 0: 10
1: 137
2: 411
3: 834
4: 2208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135667878 Original CRISPR CCACCATGCCTGGCTGAAAC TGG (reversed) Intronic
900197337 1:1383185-1383207 CCACCATGCCTGGCTAATTTTGG - Intergenic
900345290 1:2207583-2207605 ACACCATGCCTGGCAGGAGCTGG + Intronic
900664761 1:3807755-3807777 CCACTGTGCCTGGCTGAGACTGG + Intergenic
900807897 1:4779855-4779877 CCACCGTGCCTGGCCTAAAACGG - Intronic
900983896 1:6062023-6062045 CCACCGCGCTTGGCTGACACTGG - Intronic
901166964 1:7228313-7228335 CCACCATGCCCGGCTGAGTCCGG - Intronic
901230476 1:7639264-7639286 CCACCACGCCCGGCCCAAACTGG + Intronic
901281035 1:8035132-8035154 CCACCATGCTCGGCTGAATTAGG + Intergenic
901487170 1:9572322-9572344 CCACCAAGCCCGGCTGACACTGG - Intronic
901498248 1:9635120-9635142 CCACCACGCCTGGCTAAGAGAGG - Intergenic
901738991 1:11330105-11330127 CCACCATGCCCGGCTGGGATGGG + Intergenic
901869439 1:12128985-12129007 CCACCATGCCTGGCTAATTTTGG + Intronic
902152310 1:14453240-14453262 CCACCGTGCCTGGCCAAAATAGG + Intergenic
902176924 1:14657368-14657390 CCACCATGCCTGGCTGGGAGAGG + Intronic
902312264 1:15590214-15590236 CCACCACGCCTGGCCCAATCTGG - Intronic
902320893 1:15664972-15664994 CCACCGAGCCTAGCTGCAACTGG - Exonic
902389890 1:16097236-16097258 CCACCTAGCCTGGCTGATAAGGG - Intergenic
902832564 1:19026670-19026692 CCACCATGCCTGGCCTAAGTGGG + Intergenic
902869696 1:19306717-19306739 CCACCATGCCTGGCCCATCCTGG + Intronic
902894124 1:19467161-19467183 CCACCATGCCTGGCAACTACGGG + Intronic
902895358 1:19476033-19476055 CCACCATGCCTGGCCAAAATTGG - Intronic
902970508 1:20044777-20044799 GCACCCTGCCAGGCTGAATCAGG - Intronic
903040142 1:20523318-20523340 CCACCATGCCTGGCCTCAGCTGG + Intergenic
903198007 1:21708007-21708029 CCACCATACCTGGCTGATGTTGG - Intronic
903231179 1:21923117-21923139 CCACCGTGCCCGGCTGAGTCTGG - Intronic
903252893 1:22069461-22069483 CCACCACGCTTGGCCGAAACAGG + Intronic
903270763 1:22186827-22186849 CCACCATGCCTGGCCTCACCTGG + Intergenic
903481502 1:23656870-23656892 TCACCATGCCTGGCCAAAGCTGG + Intergenic
903497974 1:23783740-23783762 CCACCACGCCTGGCCCATACTGG + Intronic
903581048 1:24371298-24371320 CCACCGTACCCGGCTGATACTGG - Intronic
903599831 1:24529263-24529285 CCACCATGCCTGGCCACACCTGG - Intronic
903609019 1:24596528-24596550 CCACCATGCCTGGCTAATTTTGG - Intronic
903626997 1:24738023-24738045 CCACCATGCCTGGCTAATTTTGG + Intergenic
903640502 1:24856723-24856745 CCACCGTGCCCGGCCCAAACTGG + Intergenic
903847460 1:26286984-26287006 CCACCACGCCAGGCTGAGGCAGG + Intronic
904190535 1:28739586-28739608 CCACCATGCCCGGCTGAGTCAGG + Intronic
904228974 1:29050960-29050982 CCACCACGCCTGGCTGATAAAGG + Intronic
904250435 1:29220101-29220123 CCACCATGCCTGGCCATGACTGG - Intronic
904583836 1:31567989-31568011 CCACTATGCCTGGCCAAAAGTGG - Intergenic
904682222 1:32237246-32237268 CCACCATGCCTGGCTAATTTTGG + Intergenic
904844662 1:33401037-33401059 CCACCATGCCTGGCCCAAGATGG - Intronic
904940892 1:34164497-34164519 CCAGCGTGCCTGGCAGAATCAGG + Intronic
905332868 1:37219223-37219245 CCACCATGCCTGGCTAATTTTGG - Intergenic
905615678 1:39396165-39396187 CCACCATGCCCGGCTAAGATGGG - Intronic
905672111 1:39798664-39798686 CCACCATGCCTGGCCAGAGCAGG - Intergenic
905736110 1:40327285-40327307 CCACCGTGCCTGGCCGAGATCGG + Intergenic
905858774 1:41332310-41332332 CCACCATGCCTGGCCTTGACTGG - Intergenic
906023077 1:42648225-42648247 CCACCATGCCTGGCCTTAAGAGG + Intronic
906095370 1:43219804-43219826 CCACCATGCCTGGCTAGAGATGG - Intronic
906224197 1:44107390-44107412 CCACCGCGCCTGGCTGAGACTGG + Intergenic
906466065 1:46080546-46080568 CCACCATGCCCAGCTTAAAATGG + Intronic
906801018 1:48736994-48737016 CCACCATGCCTGGCTGTCACTGG - Intronic
906925892 1:50116186-50116208 CCATGAAGCTTGGCTGAAACTGG + Intronic
907090579 1:51721084-51721106 CCACCACACCTGGCTGAAATTGG + Intronic
907195488 1:52683216-52683238 CCACCATGCCTGGCCAAAATGGG - Intergenic
907874841 1:58475447-58475469 CCACTGTGCCTGGCTGAATTAGG + Intronic
907944671 1:59124580-59124602 CTACCCTGCCTGGGTCAAACAGG + Intergenic
908005574 1:59724189-59724211 CCACCATGCCTGGCCAACACGGG - Intronic
908100454 1:60785870-60785892 CCACCATGCCCGGCTGCACCTGG - Intergenic
908151411 1:61306426-61306448 CCACCATGCCTGGCTAATTTTGG + Intronic
908221330 1:62009795-62009817 CCACCAGGCCTGGCCAAAAGTGG - Intronic
908236963 1:62156239-62156261 CCACCATGCCTGGCCTACATTGG - Intronic
908256822 1:62309943-62309965 CCCACAGGCCTGGCTGACACAGG + Intronic
908377296 1:63556733-63556755 CCACCGCGCCTGGCTGAAGAAGG - Intronic
908548061 1:65181537-65181559 CCACCATGCCTGGCTAATTTTGG + Intronic
908581328 1:65520281-65520303 CCACCATGCCTGGACTTAACCGG + Intronic
908645005 1:66268380-66268402 CCACCATGCCTGGCCGAAGAGGG - Intronic
908822320 1:68101260-68101282 GCACCATGCCTGGCAGAGAGGGG + Intronic
908983556 1:69988280-69988302 CCACCATGCCTGGGTGAGTGTGG - Intronic
909360176 1:74750409-74750431 CCACCATGCCTGGCTAATTTTGG - Intronic
909463414 1:75944845-75944867 CCACCACACCTGGCTTAAATAGG - Intergenic
909613417 1:77577904-77577926 CCACCGTGCCCGGCCGAAACTGG + Intronic
910178106 1:84452908-84452930 CCACCGTGCCTGGCCGAATGTGG - Intergenic
910401040 1:86838475-86838497 CCACCATGCTTGGCTTCTACTGG - Intergenic
910414917 1:86987359-86987381 CCACCATGCCTGGCCCAACTAGG + Intronic
911128227 1:94361535-94361557 CCACCACACCTGGCCAAAACTGG + Intergenic
911645205 1:100330277-100330299 CCACCACGCCTGGCTGCTAAAGG - Intergenic
912356365 1:109057348-109057370 CCACCATGCCCGGCCGGAAATGG - Intergenic
912361930 1:109102312-109102334 CCACCGCGCCTGGCTGGAAGGGG + Intergenic
912407679 1:109454189-109454211 CCACCATGCCTGGCCCACATAGG + Intergenic
912493141 1:110073407-110073429 CCACCATGCCTGTCTAAGATTGG + Intronic
912572813 1:110637041-110637063 CCACCATGCCTGGCTAATTTGGG - Intergenic
913006383 1:114636510-114636532 CCACCATGCCTGGCTAATTTTGG - Intronic
913310673 1:117488481-117488503 CCACCATACCCGGCTGCAAATGG + Intronic
914734524 1:150402677-150402699 CCACCGCGCCCGGCTGAAACGGG - Intronic
914828690 1:151154929-151154951 CCACCATGCCCAGCCGAGACAGG + Intergenic
915124234 1:153652156-153652178 CCACCATGCCCAGCTGATAGTGG - Intergenic
915178610 1:154038630-154038652 CCACCATGCCCAGCAGACACAGG + Intronic
915286132 1:154853654-154853676 CCACCATGCCCGGCTGAGAGTGG - Intronic
915403282 1:155639951-155639973 CCACCATGCCTGGCTGGCCCTGG - Intergenic
915424469 1:155813142-155813164 CCACCGTGCCTGGCTGAGAATGG - Intronic
915434430 1:155892942-155892964 CCACCACACCCGGATGAAACTGG + Intergenic
915491860 1:156254594-156254616 CCACCATGCCTGGCTAATTTTGG + Intronic
915705313 1:157838061-157838083 CCACCACGCCTGGCCTAATCTGG + Intronic
915950232 1:160185396-160185418 CCATCATGCCTGGCTATCACTGG + Intronic
916537077 1:165713614-165713636 CCACAATGCCTGGCCGAATGTGG - Intergenic
916559287 1:165919130-165919152 GCCCCAAGCCTGGCTGACACAGG - Intergenic
916720964 1:167484487-167484509 CCACCGCGCCTGGCTGAACAGGG - Intronic
916907808 1:169307730-169307752 CCACCGCGCCTGGCTTAAAATGG - Intronic
916943461 1:169700422-169700444 CCACCACACCTGGCCAAAACAGG + Intronic
917692554 1:177484156-177484178 CCACCATGCCTGTCCGATGCTGG - Intergenic
918052836 1:180989769-180989791 CCACCACGCCTGGCTGAGCTTGG + Intronic
918272117 1:182912152-182912174 CCACCGTGCCTGGCGGAATCTGG - Intronic
918450545 1:184653596-184653618 CCACCATGACTGGCTGCAATTGG - Intergenic
918952684 1:191160291-191160313 CCACCATGCCCGGCTGCACCTGG - Intergenic
919069562 1:192736556-192736578 CCACCATGCCTGGCTGAGACTGG + Intergenic
919104188 1:193128590-193128612 CCACCATGCCTGGCCTAGGCTGG + Intronic
919201060 1:194356119-194356141 CCACCATGCCTGGCAATAATTGG + Intergenic
919406644 1:197193248-197193270 CCACCGTGCCTGGCTGTGCCAGG - Intronic
919876810 1:201875300-201875322 CCACCATGCCTGGCTATAAATGG - Intronic
919932639 1:202231261-202231283 TGACCATGCCTGGCTGAGCCTGG + Intronic
920005686 1:202832225-202832247 CCACCATGCCTGGCTGCTACTGG - Intergenic
920130518 1:203728568-203728590 CCACCATGCCTGGCCGACTGGGG - Intronic
920537462 1:206747907-206747929 CCACCATGCCTGGCCTAAACTGG + Intergenic
920569107 1:207002894-207002916 CCACCTGGCCTGGCTGAGAGTGG - Intergenic
920595314 1:207263425-207263447 CCACCGTGCCTGGTTGAAAAGGG + Intergenic
920675119 1:208033181-208033203 CCACCAGGTCTGGCTGTACCTGG + Intronic
920914587 1:210249927-210249949 CCATCGTGCCTGGCCTAAACAGG - Intergenic
921633717 1:217466510-217466532 CCACCATGCCTGGCTAAAAATGG + Intronic
921870848 1:220138183-220138205 CCACCATGCCTGGCCAACACAGG - Intronic
922161292 1:223080673-223080695 GCTCCATGCCTGGCTCACACAGG + Intergenic
922290625 1:224206355-224206377 CCACCATGCCTGGCTAATTCTGG + Intergenic
922435484 1:225601231-225601253 CCACCGTGCCTGGCCGTAATTGG - Intronic
922440276 1:225650561-225650583 CCACGGTGCCTGGCCGAAAGTGG - Intronic
922641193 1:227233644-227233666 CCACCGTGCCTGGCCCAAAATGG - Intronic
922814790 1:228440811-228440833 CCACTGTGCCTGGCTGAAGTCGG + Intergenic
922905962 1:229173980-229174002 CCATCGTGCCTGGCTGAAGCTGG - Intergenic
922992430 1:229925775-229925797 CTACCATGCCTGGCTGACTGCGG + Intergenic
923173422 1:231438812-231438834 CCACCATGCCCAGCTGGAATAGG + Intergenic
923389117 1:233496259-233496281 CCATCATGCCTGGCTGGTATAGG + Intergenic
923404754 1:233648852-233648874 CCACCATGCCTGGCCAACAAAGG + Intronic
924222022 1:241887332-241887354 CCACCTTGCCTGGCCTACACTGG + Intronic
924234322 1:241987957-241987979 CCACCATGCCCGGCTGTAGGTGG - Intergenic
924290409 1:242530179-242530201 CCACCATGCCTGGCCGGCACTGG + Intergenic
924320530 1:242843991-242844013 CCACCATGCCTGGCTAATTTTGG + Intergenic
924546715 1:245034446-245034468 CCACCATGCCTGGCTAATTTTGG - Intronic
924758077 1:246959711-246959733 CCACCGTGCCTGGCCCAAAATGG + Intronic
924826639 1:247546646-247546668 CCACCGCGCCCGGCTGAAAATGG + Intronic
1063030529 10:2229838-2229860 CCACCATACCTGGCTAATTCAGG + Intergenic
1063590828 10:7394148-7394170 CCACCATGTCTGGTAGAGACGGG + Intronic
1063701192 10:8386931-8386953 CCACCATGCCTGGCCTATGCAGG + Intergenic
1064055461 10:12093468-12093490 CCACTGTGCCAGGCTGAAATTGG + Intronic
1064269532 10:13852394-13852416 CCACCATGCCTGGTAGAGACAGG + Intronic
1064577559 10:16761567-16761589 CCACCGTGCCCGGCTGAGAATGG - Intronic
1064612177 10:17114954-17114976 CCACCGTGCCCGGCCGAAATGGG - Intronic
1064642281 10:17426947-17426969 CCACCATGCCTGGCTAATTTTGG - Intronic
1064741905 10:18442435-18442457 CCACCACGCCTGGCCGAATCTGG + Intronic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1065037170 10:21651355-21651377 CCACCATGCCTGGCCGTATTTGG + Intronic
1065216134 10:23450628-23450650 CCACTATGCCTGGCTACATCTGG + Intergenic
1065311597 10:24421291-24421313 CCATCATGCCTGGCTGTAAGTGG + Intronic
1065655036 10:27939583-27939605 CCACCATGCCTGGCTAATGTAGG - Intronic
1065697421 10:28392570-28392592 CCACCACTCCTGGCTGCTACTGG - Intergenic
1065708522 10:28493449-28493471 CCACCACGCCCGGCTGACAATGG - Intergenic
1065831486 10:29618518-29618540 CCACCATGCCTGGCCCAGCCTGG + Intronic
1065856270 10:29832762-29832784 CCACCAGGCCTGGCCCAAAATGG + Intergenic
1065977306 10:30853707-30853729 CCACCATGCCTGGCCATAAATGG - Intronic
1066085032 10:31967994-31968016 CCACCATGCCCGGCTGAGGCTGG - Intergenic
1066253592 10:33656940-33656962 CCACCATGCCTGGCTGAGATTGG + Intergenic
1066361578 10:34736962-34736984 CCACCATGCCTGGCCAAAATAGG + Intronic
1066384283 10:34929017-34929039 CCACCATGCCTGGCCCATACTGG + Intergenic
1066407283 10:35129907-35129929 CCACCATGCCCGGCCTAAACTGG - Intronic
1066546335 10:36504231-36504253 CCACCATGCCTGGCTGTAGAAGG + Intergenic
1066570149 10:36762568-36762590 CCACCATGCCCGGCCTAGACTGG + Intergenic
1067014150 10:42743508-42743530 CCACCATGCCTGGCCAAAAATGG + Intergenic
1067092834 10:43278637-43278659 CCACCATTCCTGGCTCTAAAGGG - Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1067129377 10:43547705-43547727 CCACCACGCCTGGCTCCAAAGGG + Intergenic
1067197088 10:44131311-44131333 CCACCATGCCCAGCTGGAATTGG - Intergenic
1067567282 10:47348547-47348569 GCACCAGGCTTGGCTGGAACAGG - Exonic
1068119947 10:52775007-52775029 CCACCACGCCTGGCTGGGAAGGG - Intergenic
1069455008 10:68547092-68547114 CCACAATGCCAGGCTAAAATGGG - Intergenic
1069479945 10:68772603-68772625 CCACTGTGCCTGGCTTAAAATGG - Intronic
1069483023 10:68801032-68801054 CCACCATGCCTGGCTAATTTTGG - Intergenic
1069493576 10:68882782-68882804 CCACCATGCCCGGCATAAATTGG + Intronic
1069689375 10:70339831-70339853 CCACCATGCCTGGCCGATGTTGG - Intronic
1069696835 10:70392702-70392724 CCACCATGCCTGGCCACATCTGG - Intergenic
1070026816 10:72639816-72639838 CAACCACGCCTGGCCGAAAGGGG - Intergenic
1070096830 10:73345650-73345672 CCACCATGCCTGGCTAATTTTGG - Intronic
1070150855 10:73804035-73804057 CCACAATGGCTGCCTGAAGCTGG - Intronic
1070168027 10:73912561-73912583 CCACCATGCCCGGCTGCCAACGG - Intronic
1070196456 10:74161665-74161687 CAACCATTCCTGGCAGAATCAGG + Intronic
1070629869 10:78076827-78076849 CCACCATGCCTGGCCTGCACAGG + Intergenic
1070912239 10:80128688-80128710 CCACCATGCCTGGCCAATAATGG + Intergenic
1070978280 10:80623200-80623222 CCGCCGTGCCTGGCCGAAACTGG + Intronic
1071576059 10:86727307-86727329 CCACCACGCCTGGCTGATTTGGG + Intronic
1071849176 10:89551152-89551174 CCACCACGCCAGGCTGAACTTGG - Intronic
1071943567 10:90615208-90615230 CCACCATGCCTGGCACCAGCTGG - Intergenic
1072143185 10:92608722-92608744 CCACCGTGCCTGGCCGAACTTGG + Intronic
1072157282 10:92735441-92735463 CCACCATGCCTGGCAGATTTTGG + Intergenic
1072159032 10:92749322-92749344 CCACTATGCCTGGCCGAAACTGG + Intergenic
1072193142 10:93092434-93092456 CCACCATGCCTGGCACATAAAGG + Intergenic
1072487483 10:95869535-95869557 CCACCATGCCTGGCCAGAAGTGG + Exonic
1072698629 10:97623290-97623312 CCACCATGCTTGGTTGATAGAGG - Intronic
1073084742 10:100880914-100880936 CCACCATGCCTGGCCGCGAAGGG + Intergenic
1073306665 10:102508259-102508281 CCACCGTGCCCGGCCAAAACAGG + Intronic
1073483487 10:103801854-103801876 CCACCATGCCTGGCTAATTTTGG + Intronic
1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG + Intronic
1073773660 10:106762714-106762736 CCATCATGCCTGGGGGAGACTGG + Intronic
1074052663 10:109894242-109894264 CCACTGTGCCTGGCTGAAAGGGG - Intronic
1074144006 10:110700726-110700748 CCACCGTGCCTGGCCCAAAGAGG - Intronic
1074559191 10:114519895-114519917 CCCCCAAACCTGGGTGAAACTGG + Intronic
1074785133 10:116832451-116832473 CCACCGTGCCTGGCTGCAAAGGG + Intergenic
1075049885 10:119175680-119175702 CCACAGTGCCTGGCTGAGATGGG + Intronic
1075113116 10:119603980-119604002 CCACCATGCCTGGCCTAGACTGG + Intergenic
1075595103 10:123723615-123723637 ACATCATGCATGGCTGAATCTGG - Intronic
1075675775 10:124294896-124294918 CCACCCTGCTTGGCTGGCACAGG + Intergenic
1075702570 10:124478760-124478782 CCACCGCGCCTGGCCCAAACTGG - Intronic
1075786124 10:125051350-125051372 CCACCATGCCTGGCCTGAAAAGG - Intronic
1076640602 10:131914039-131914061 TCACCATACCTGCCTGAAAGGGG + Intronic
1076660412 10:132052070-132052092 CCACCATGCCTGGCTAATTGTGG - Intergenic
1076711930 10:132341141-132341163 CCACCATGCCTGGCTAATGTTGG - Intronic
1076774493 10:132687229-132687251 CCACCAAGCCTGGCCAACACTGG + Intronic
1078255510 11:9655315-9655337 ACACCATGCCTGGCCTAAGCAGG + Intergenic
1078457150 11:11484303-11484325 CCACCATGCCTGGCCTCACCTGG - Intronic
1078571184 11:12459137-12459159 CCACCATGCCCAGCTGGCACAGG - Intronic
1078697244 11:13646796-13646818 CCACCTTGCCTGGCTGAAAAAGG + Intergenic
1079486497 11:20940848-20940870 CCACCACGCCTGGCTGGAGGTGG - Intronic
1079948359 11:26770597-26770619 CCACCATGCCCAGCTGATACTGG + Intergenic
1079986616 11:27206792-27206814 CCACCATGCCCGGCTAAGGCTGG + Intergenic
1080044779 11:27797524-27797546 CCACCGCGCTTGGCTGAAATAGG - Intergenic
1080184528 11:29465059-29465081 CCACCATGCCCAGCCGAAACTGG + Intergenic
1080210783 11:29782411-29782433 CTACCAGGGTTGGCTGAAACAGG - Intergenic
1080505271 11:32906549-32906571 CCACCATGCCTGGCTAAATTCGG + Intronic
1080518442 11:33045065-33045087 CCACCATGCCTGGCCAATCCTGG - Intronic
1080639447 11:34150169-34150191 CCTGCCTGCCTGCCTGAAACAGG - Intergenic
1081057998 11:38434806-38434828 CCACCATGCCTGGCTAATTTTGG + Intergenic
1081190193 11:40094516-40094538 CCACCATGCCCAGCTGAAGAAGG + Intergenic
1081217186 11:40416092-40416114 CCACCATGACAGGCTGAGAGAGG + Intronic
1081633640 11:44706056-44706078 CCACCGTGCCCGGCTGGAAATGG - Intergenic
1081790755 11:45782208-45782230 CCACCATGCCTGGCCATAAATGG + Intergenic
1081883994 11:46479044-46479066 CCACCATGCCTGGCTAATTTTGG - Intronic
1081890736 11:46540117-46540139 CCACCGTGCCCGGCAGTAACTGG + Intronic
1081911659 11:46704018-46704040 CCACCGTGCCCGGCTGGAAGGGG + Intronic
1081952198 11:47054020-47054042 TCACCGTGCCCGGCTGCAACAGG - Intronic
1081980886 11:47266316-47266338 CCACCGTGCCCTGCTGAAAAAGG + Intronic
1082086530 11:48054895-48054917 CCACCATGCCTGGCTGCCAGCGG - Intronic
1082284513 11:50304129-50304151 ACACCATGCCTGGCCGGAAAAGG - Intergenic
1082593884 11:55050256-55050278 CCACCGTGCCTGGCCAAAAAAGG - Intergenic
1082857410 11:57820742-57820764 CCACCATGCCTGGCCCATCCAGG + Intergenic
1083047694 11:59751485-59751507 CCACCACGCCCGGCTGAGATGGG + Intronic
1083224232 11:61274490-61274512 CCACCATACCTGGCAAACACAGG + Exonic
1083449158 11:62731039-62731061 CCACCATGCCTGGCTAATTTTGG + Intronic
1083549459 11:63575500-63575522 CCTCCATGCCTGGCAGGACCAGG - Intronic
1083565175 11:63708449-63708471 CCACCATACCTGGCCTAAATAGG + Intronic
1083582490 11:63833765-63833787 CCACCATGCCTAGCTAACAGGGG + Intergenic
1083643505 11:64158528-64158550 CCACCACGCCTGGCCCAAAGTGG + Intronic
1083696291 11:64444910-64444932 CCACCTTGCCTGGCTAAATCTGG + Intergenic
1083837092 11:65277463-65277485 CCAGCATGCCTGGCAGTAATTGG + Intronic
1084073800 11:66756483-66756505 CCACCATGCCTGGCTAATTATGG + Exonic
1084276886 11:68056719-68056741 CCACCATGCCTAGCTAACAAAGG - Intronic
1084371446 11:68747477-68747499 CCACCATGCCTAGTAGAGACAGG - Intronic
1084377000 11:68784387-68784409 CCACCATGCCTAGTAGAGACAGG - Intronic
1084531763 11:69731598-69731620 CCTCCAGGCCTGGCTGATGCTGG - Intergenic
1084572800 11:69969659-69969681 CCACCGTGCCTGGCCGCATCCGG - Intergenic
1084726858 11:70947506-70947528 CCACCATGCCTGGCTAATCCTGG + Intronic
1084927372 11:72524333-72524355 CCATAATGCCTGGCTGGAATGGG + Intergenic
1084984087 11:72852174-72852196 CCATCATGCCTGGCTGAGAATGG + Intronic
1085114780 11:73921145-73921167 CCACCATGCCTAGCTAATATTGG - Intronic
1085125458 11:73999080-73999102 TCACCATGCCTGGCTAAAAAGGG + Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085282707 11:75341423-75341445 CCACCATGCCTGGCCGACAATGG + Intronic
1085482170 11:76831668-76831690 CCACCATGCCCAGCTGATACTGG - Intergenic
1085542369 11:77284006-77284028 CCACCATGCCTGGCTAATTTTGG + Intronic
1085575485 11:77599166-77599188 CCACCATGCCTGGCCACACCTGG + Intronic
1085858431 11:80203288-80203310 CCACTGTGTCTGGCTGAAATTGG + Intergenic
1086965120 11:93019405-93019427 CCACCATGCCTGGCCAATATAGG + Intergenic
1087043462 11:93824058-93824080 CCACCATGCCTGGCTAATTTTGG + Intronic
1087111686 11:94476691-94476713 CCACCATGCCTAGCTGTTTCAGG + Intronic
1087251340 11:95903825-95903847 CCACCATGCCTGGCCTAATGAGG - Intronic
1087262329 11:96024860-96024882 CCACCTTGCCTGTGTCAAACTGG + Intronic
1087765720 11:102151113-102151135 CCACCACGCCTGGCTGAACATGG + Intronic
1087768566 11:102182104-102182126 CCACCATGCCTGGCCCTAAGTGG + Intronic
1087803063 11:102525165-102525187 CCACCATGCCTGGCCTGGACTGG - Intronic
1087851226 11:103032440-103032462 CCACCGCGCCCGGCTGCAACTGG - Intergenic
1087938326 11:104061893-104061915 CCACCATGCCTGGCCGTTTCTGG + Intronic
1087985778 11:104677570-104677592 CCACCATGCCTGGCTAATGTTGG - Intergenic
1088456552 11:110038853-110038875 CCACCATGCCTGGCCAAGAAAGG - Intergenic
1088610034 11:111568096-111568118 CCACCACGCCTGGCCAAAATTGG - Intergenic
1088663443 11:112071803-112071825 CCACCATGCCTGGCCTTAAATGG - Intronic
1088680674 11:112239030-112239052 CCACCATGCCTGGCTAATTTTGG - Intronic
1088825438 11:113490045-113490067 CCACCTTGCCTGGCTCACATTGG + Intergenic
1089317982 11:117605179-117605201 CCACCATGCCCGGCTGCTCCCGG + Intronic
1089381014 11:118031848-118031870 CCACCATGCCTGGCCGATGCTGG - Intergenic
1089417913 11:118308014-118308036 CCACCATGTCTGGCTGATTTTGG - Intronic
1089430439 11:118419600-118419622 CCACCATGCCTGGCTAATTTTGG - Intronic
1089481018 11:118805122-118805144 CCACCGTGCCTGGCCAGAACTGG + Intergenic
1089723083 11:120447663-120447685 CCACCATGCCTGGCTAATTTTGG - Intronic
1090092223 11:123708944-123708966 CCACCGTGCCTGGCTTGATCAGG + Intergenic
1090336686 11:125973243-125973265 CCACCATGCCCAGCTGAATTTGG - Intronic
1090726219 11:129529684-129529706 CAACCATGCCTGCCTGGAAAAGG + Intergenic
1091425139 12:381279-381301 CCACCGTGCCCGGCTGAGACAGG + Intronic
1091486111 12:890238-890260 CCACCATGCCTGGCCCTAAAAGG + Intronic
1091552683 12:1548737-1548759 CCACCATGCCCGGCTGAGACTGG - Intronic
1091568882 12:1667381-1667403 CCACCACGCCTGGCCCACACTGG - Intergenic
1091745623 12:2990910-2990932 CCACCATGCCTGGTCACAACTGG - Intronic
1091751910 12:3027712-3027734 CCACCATGCCTGGCTAATTTTGG - Intronic
1092425483 12:8372166-8372188 CCACCATGCCTGGCTAATTTTGG + Intergenic
1092872163 12:12814962-12814984 CCACCACATCTGGCTGTAACAGG + Intronic
1093095698 12:14969670-14969692 CCACCAAGCCTTGCTGAAGGTGG + Intergenic
1093191476 12:16079852-16079874 CCACCATGCCTGGCTAAATTTGG + Intergenic
1093223158 12:16447676-16447698 CCAGGATGCCTGGCTGAAAGTGG - Intronic
1093371231 12:18367839-18367861 CCACCACCCCTGGCTGAGACTGG + Intronic
1093474830 12:19543417-19543439 CCACCATGCCTGGCTAATTTTGG + Intronic
1093592061 12:20914049-20914071 CCACCATGCCTGGCTTATTTTGG + Intronic
1093680445 12:21996159-21996181 CCCACATTCCTGGCTGAAATGGG + Intergenic
1093748610 12:22772391-22772413 CCACCGTGCCCGGCCAAAACAGG + Intergenic
1094082554 12:26553497-26553519 CTACCATGCCTGGCTGCCAGGGG - Intronic
1094203403 12:27816102-27816124 CCACCATACCTGGCTAAGAAAGG + Intergenic
1094420812 12:30269217-30269239 CCACCCTGCATGTCTGAAATTGG - Intergenic
1094637931 12:32244912-32244934 CCACCATGCCCGGCCGACATAGG + Intronic
1094690018 12:32759656-32759678 CCACCATGCCCGGCCGTAACCGG - Intergenic
1095217152 12:39563235-39563257 CCACCATGCCTGGTTGCAGAGGG - Intronic
1095698004 12:45162363-45162385 CCACCATGCCCGGCTGCTAGTGG + Intergenic
1096172628 12:49485339-49485361 CCACCATGCCCGGCCGAAATAGG + Intronic
1096193222 12:49633298-49633320 CCACCTGGCCTGGTTCAAACTGG - Intronic
1096248571 12:50011666-50011688 CCACCATGCCCGGCCCACACCGG - Intronic
1096793511 12:54059965-54059987 CCTCCAGGCCTGGCAGAAAGTGG - Intergenic
1096800143 12:54105196-54105218 CCACCACACCTGGCTAACACCGG - Intergenic
1097002835 12:55892583-55892605 CCACCACGCCCGGCTGAGAGTGG - Intergenic
1097028081 12:56073017-56073039 CCACCATGCCTGGCTGCTGGTGG + Intergenic
1097034247 12:56112239-56112261 CCACCATGCCTGGCTCAAAATGG + Intronic
1097556140 12:61139838-61139860 CCACCATGCCTGGCTTTACTTGG + Intergenic
1097785764 12:63757204-63757226 CCACCAGGCCTGGTTTAAACTGG - Intergenic
1098344382 12:69485753-69485775 CCACCATGCCTGACCTAAACAGG + Intronic
1098931075 12:76414738-76414760 CCACCATGTCCAGCTGGAACAGG + Intronic
1099058694 12:77878376-77878398 CCACCATGCCTGGCTAATTTTGG + Intronic
1099977024 12:89556773-89556795 CCACCAGGCCTGGCTAATTCTGG + Intergenic
1100253214 12:92853464-92853486 CCACCAAGCCTGGCTCAAAAAGG + Intronic
1100255302 12:92877262-92877284 CCACCATTCCTGGCCTAACCTGG + Intronic
1100438234 12:94591601-94591623 CCACCATGCCTGGCTAATTTTGG - Intronic
1100438565 12:94594378-94594400 CCACCGTGTCTGGCAGAACCAGG + Intronic
1100499578 12:95160893-95160915 CCACCATGCCTGGCCACAAGTGG - Intronic
1100508549 12:95244943-95244965 CCACCTTGCCTGGCCAAAAGTGG - Intronic
1100612468 12:96202812-96202834 CCACCATGCCTGGCCACCACAGG + Intronic
1101006172 12:100403187-100403209 CCACCACGCCTGGCAGAAAGAGG - Intronic
1101118400 12:101554101-101554123 CCACCATGCCTGGCCCACATAGG + Intergenic
1101145671 12:101838406-101838428 CCACCGTGCCTGGCAGAAGCTGG - Intergenic
1101180627 12:102212867-102212889 CCACCATGACTGGCTGATTTTGG - Intergenic
1101332150 12:103765827-103765849 CCACCATGCCCGGCTGAGCGGGG + Intronic
1101363177 12:104047114-104047136 CCACCATGCCAGCCTGAACTGGG + Intronic
1101387205 12:104268370-104268392 CCACCATGCCCGGCTAATATGGG - Intronic
1101703481 12:107197679-107197701 CCACCATGCCTAGCTAAATGAGG + Intergenic
1101770233 12:107743052-107743074 CCACCATGCCTGGCTGCCTTGGG + Intronic
1102017778 12:109659407-109659429 CCACCATGCCCGGCAGAACTGGG - Intergenic
1102087269 12:110152876-110152898 CCACCATGCCTGGCTTATTCGGG + Intronic
1102091407 12:110191881-110191903 CCACCGTGCCTGGCCTGAACAGG - Intronic
1102103289 12:110298430-110298452 CCACCACGCCTGGCCAAAACAGG - Intronic
1102235183 12:111289996-111290018 CAACCATGCCTGTGTGAAGCGGG - Intronic
1102362393 12:112299468-112299490 CCACCATGCCTGGCTAATTTTGG - Intronic
1102498890 12:113337777-113337799 CCACCATGCCTAGCTGAAATAGG + Intronic
1102662020 12:114537400-114537422 CCACCTTGCCTGGCCAACACTGG + Intergenic
1102765218 12:115427012-115427034 CCAGCATGTTTGTCTGAAACTGG + Intergenic
1102802800 12:115751261-115751283 CCACCATGCCTGGCCTAAGCAGG + Intergenic
1103025526 12:117570968-117570990 CCACCGTGCCTGGCTGGAATAGG - Intronic
1103047987 12:117754348-117754370 CCACCATGCCTGGCCGAGGAAGG - Intronic
1103212125 12:119174844-119174866 TCACCCTGCATGCCTGAAACTGG - Intergenic
1103523676 12:121552943-121552965 CCACCGTGCCCGGCTGGTACTGG - Intronic
1103547205 12:121710783-121710805 CCACCATGCCTGGCCAGAAAGGG + Intergenic
1104095434 12:125552887-125552909 CCATCAGGCCTGGCTGCAGCAGG + Intronic
1104513695 12:129404482-129404504 CCACCATGCCCGGCCAAGACTGG + Intronic
1104739538 12:131163225-131163247 CCCCCGTGCCTGGGTGACACTGG - Intergenic
1104849508 12:131864894-131864916 CCACCACGCCTGGCTAATACGGG - Intergenic
1104912309 12:132245152-132245174 CCACCACGCCTGGCTGACATAGG - Intronic
1105342443 13:19539855-19539877 CCACCATGCCTGGCCCCAATGGG - Intergenic
1105491769 13:20895023-20895045 CCACCATGCCTGGCTAATTTTGG - Intronic
1105522891 13:21147203-21147225 GCACCATGTCTGGCAGAAAGGGG + Exonic
1106119394 13:26846384-26846406 CCACCATGCCCGGCCGTGACTGG + Intergenic
1106254830 13:28012645-28012667 CCACCACGCCTGGCTAAGAGAGG - Intronic
1106411661 13:29515152-29515174 CCACCTTGTGTGGCTGACACAGG + Intronic
1106685562 13:32055328-32055350 CCACCATGCCTGGCCTAAGATGG + Intronic
1106781126 13:33060114-33060136 CCACCATGCCGGGCCAAGACGGG + Intronic
1107282917 13:38756826-38756848 CCACCATGCCTGGCTGGTTGGGG + Intronic
1107463453 13:40627678-40627700 CCACCATGCCTGGCTAATTTTGG - Intronic
1107644712 13:42482007-42482029 CCACCATGCCCGGCCTACACAGG - Intergenic
1108197185 13:48006912-48006934 CCACCATGCCTGGCTGGGATTGG - Intergenic
1108283939 13:48887152-48887174 CCCCCAGGCCTGGATGAAAGGGG + Intergenic
1108402177 13:50057046-50057068 CCACCATGCCTGGCGAAACATGG + Intergenic
1108496629 13:51031781-51031803 CCACCATGCCTGGGTGATTTGGG + Intergenic
1108554351 13:51578472-51578494 CCACCATGCCTGGCTAATTTTGG - Intergenic
1108597134 13:51959354-51959376 CCACCATGCCTGGCTAGATAGGG - Intronic
1109177343 13:59172973-59172995 CCACCATGCCTGGCATCACCTGG - Intergenic
1109347145 13:61127359-61127381 CCACCATGCCTGGCCAAATCAGG + Intergenic
1109564603 13:64095678-64095700 CCACCATGCCTGGCTAATTTTGG - Intergenic
1110656452 13:78005519-78005541 CCACCATGCCTGGCCCACATAGG + Intergenic
1111583257 13:90252009-90252031 CCACCATGCCTGGCCTCAATAGG + Intergenic
1111743224 13:92231678-92231700 CCACCTTGCCTGGCTGTCATTGG - Intronic
1111968554 13:94885941-94885963 CCACCAAGCCTGGCCTAGACTGG + Intergenic
1111991841 13:95124402-95124424 CCACCATGCCTGGCAGCAGTGGG - Intronic
1112356749 13:98679851-98679873 CCACCATGCCTGGCTAATTTTGG - Intergenic
1114300906 14:21376918-21376940 CTACCATGCCTGGCTAATCCAGG - Intronic
1114321690 14:21551959-21551981 CCACCATGCCTGGCCCCAAGGGG - Intergenic
1114574122 14:23696879-23696901 CCACCACAGTTGGCTGAAACCGG + Intergenic
1114632565 14:24168788-24168810 CCACCATGCCTGGCCTCACCTGG - Intergenic
1114649861 14:24277719-24277741 CCACCATGCTTTGCTGGAGCCGG + Intergenic
1115612603 14:35063283-35063305 CCACCATGCCTGGCCCCAAAGGG - Intronic
1115614675 14:35083452-35083474 CCACCGTGCCCAGCTGGAACTGG - Intronic
1115645878 14:35368146-35368168 CCCCCATGCCAGGCTGCTACAGG - Intergenic
1116171771 14:41411726-41411748 CCACCGTGCCTGGTCGAAAATGG - Intergenic
1116455870 14:45119975-45119997 CCACCACGCCTGGCTGGGGCAGG + Intronic
1117109348 14:52433889-52433911 CCACCATGCCCAGCCTAAACTGG - Intronic
1117375359 14:55113946-55113968 CCACCATGCCTGGCTAAAGCTGG + Intergenic
1117651663 14:57914274-57914296 CCACCATGCCCGGCTGAGACTGG - Intronic
1117685778 14:58251436-58251458 CCACCATGCCTGGCTAAGCCAGG + Intronic
1117986290 14:61389195-61389217 CCATCATGCCTGGCTTAGAGAGG - Intronic
1118958753 14:70507987-70508009 CCACCACACCCGGCTGAAACTGG + Intergenic
1119352571 14:73978314-73978336 CCACCATGCCCGGCTGCCACTGG - Intronic
1119462340 14:74817765-74817787 CCACCATGCCAGGCCATAACAGG - Intronic
1119672295 14:76528939-76528961 CCACTGTGCCCGGCCGAAACAGG + Intergenic
1119750742 14:77075706-77075728 CCACCAAGCCTGGCTGAGATGGG + Intergenic
1119762333 14:77160439-77160461 CCACCGTGCCTAGCTGAACATGG - Intronic
1120253392 14:82088421-82088443 CCACTATGCCTGGCTGAGACTGG + Intergenic
1120884653 14:89442211-89442233 CCACCGCGCCCGGGTGAAACTGG + Intronic
1121246214 14:92462683-92462705 CCACCATGCCCAGCCGAGACAGG + Intronic
1121349343 14:93161093-93161115 CCACCATGCCTGGCTAATTTTGG - Intergenic
1121402810 14:93695737-93695759 CCACCATGCCTGGCTGATGTTGG - Intronic
1121540887 14:94725545-94725567 CCACCATGCCTGGCTAATTTTGG + Intergenic
1122225334 14:100273439-100273461 CCACCATGCCTGGCTGATTTTGG + Intronic
1122497200 14:102166150-102166172 CCACCACGCCTGGCAGAGACCGG + Intronic
1122560938 14:102613841-102613863 CCACCGCGCCTGGCTGAGATAGG + Intronic
1123037391 14:105477077-105477099 CCACCCTGCCCGGCAGAATCTGG - Intronic
1123218961 14:106839262-106839284 CCACCACGACTGGCTGAAACCGG - Intergenic
1123390685 15:19868696-19868718 CCACCACGCCTGGCTGATTTTGG - Intergenic
1123698969 15:22900685-22900707 CCACCGTGCCTGGCCGAGCCTGG + Intronic
1123855951 15:24411861-24411883 CCACCATGCCCTGCTGTAAGTGG + Intergenic
1124156721 15:27232671-27232693 CAACAAGGCCTGGCTGAAAAAGG + Intronic
1124244880 15:28060188-28060210 CCAGCATGCCTGCCTGGAACTGG + Intronic
1124930668 15:34116193-34116215 CCACCACACCTGGCCCAAACAGG + Intergenic
1125133271 15:36309921-36309943 CCACCATGCCTGGCTAATCTTGG + Intergenic
1125613827 15:40992061-40992083 CCACCGGGCCCTGCTGAAACAGG + Intronic
1125630846 15:41145801-41145823 CCACCATGCCTGGCCGAGCCTGG - Intergenic
1125727841 15:41877127-41877149 CCACCAGGCCTGGCTGCACCTGG - Exonic
1125768026 15:42147901-42147923 CCACTGTGCCTGGCTGAAAATGG - Intronic
1125822378 15:42643347-42643369 CCACCATGCCTGGCTAATTTTGG + Intronic
1125857322 15:42962775-42962797 CCACCACGCCTGGCCAACACTGG + Intronic
1125928936 15:43585901-43585923 CCACCGTGCCTGGCCGAAACAGG - Intronic
1125942103 15:43685736-43685758 CCACCGTGCCTGGCCGAAACAGG - Intergenic
1125982894 15:44019179-44019201 CCATCATGCCTGGCTGATGTGGG + Intronic
1126072581 15:44877907-44877929 CCACCATGCCTGGCCTCAAGAGG + Intergenic
1126165961 15:45653967-45653989 CCACCATGCCTGGCTAATTTTGG - Intronic
1126480565 15:49114743-49114765 CCACCACGCCTGGCTGAGGAGGG + Intronic
1126527837 15:49677440-49677462 CCACCATGCCTGGCTTGAACTGG + Intergenic
1126614414 15:50562181-50562203 CCACCATGCCCGGCTGAATTAGG + Intronic
1126779155 15:52123828-52123850 CCACCATGCCCAGCTTAAACAGG + Intronic
1127360495 15:58240873-58240895 CCACCATGCCTGGCCGACCCAGG - Intronic
1127571700 15:60250007-60250029 CCACCATGCCTGGCCCCAAATGG + Intergenic
1127822097 15:62667251-62667273 CCACCGTGCCTGGCGAACACTGG + Intronic
1128270453 15:66304746-66304768 CCACCATGCCTGGCTAATTTTGG - Intronic
1128299463 15:66556590-66556612 CCACCGTGCCCGGCTGACAATGG + Intronic
1128344782 15:66846671-66846693 CCACCACGCCTGGCTGGAAGTGG + Intergenic
1128600672 15:68992995-68993017 CCACCACAGTTGGCTGAAACTGG - Intronic
1128630455 15:69260545-69260567 CCACCGTGCCTGGCCACAACTGG + Intronic
1128700041 15:69797368-69797390 CCACCAAGGCAGGCTGAAAAGGG - Intergenic
1128754856 15:70174906-70174928 CCACCATGCCTGGCTAATTTTGG + Intergenic
1128814535 15:70597972-70597994 CCATCATGCCTGGCGCACACTGG - Intergenic
1129027447 15:72590733-72590755 CCACCATGCCCAGCTGACAATGG + Exonic
1129260955 15:74367001-74367023 CCACCATGCCTGGCCAGACCTGG + Intronic
1129436789 15:75547951-75547973 CCACCATGCCTGGCCCCTACTGG + Intronic
1129526589 15:76220351-76220373 TCACCATGCCTGGCTGGCAATGG + Intronic
1129570342 15:76676110-76676132 CCACTGTGCCCGGCTGAAACTGG + Intronic
1129740358 15:77986891-77986913 CCTCCCAGCCTGGCTGAAGCGGG + Intronic
1129785955 15:78310246-78310268 CCACCGTGCCTGGCCAAGACTGG + Intergenic
1129788742 15:78326605-78326627 CCACCATGCCTGGCCTGAATTGG - Intergenic
1129825366 15:78631287-78631309 CACCAATGTCTGGCTGAAACAGG - Exonic
1129928507 15:79387078-79387100 CCACCATGCCTGGCTAATTATGG + Intronic
1129991887 15:79972505-79972527 CCACCGTGCCTGGCCCAAAGAGG - Intergenic
1130256454 15:82328153-82328175 CCTCCCAGCCTGGCTGAAGCGGG + Intergenic
1130320107 15:82834321-82834343 CCACCGTGCCTGGCTGATGCTGG + Exonic
1130598498 15:85261835-85261857 CCTCCCAGCCTGGCTGAAGCGGG - Intergenic
1131199066 15:90381093-90381115 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1131240983 15:90743147-90743169 CCACCATGCCTGGCTAAAGATGG + Intronic
1131253262 15:90844846-90844868 CCACCACGCCTGGCTAAAACTGG + Intergenic
1131486817 15:92827781-92827803 CCACCATGCCCGGCTGAGGAAGG + Intergenic
1131492667 15:92876389-92876411 CCACCATGCCCGGCTGAGGTGGG - Intergenic
1131538315 15:93255489-93255511 CCACGATGCCTGGCCGAAGTAGG + Intergenic
1131670922 15:94618830-94618852 CCACCATGCTGGGCCGAAGCTGG + Intergenic
1131708953 15:95032186-95032208 CCACCATTCCTGGCTGAGGGGGG - Intergenic
1132233756 15:100203744-100203766 CCACCATGCCTGGCTAATTTGGG - Intronic
1132342210 15:101085907-101085929 CCACCGCGCCTGGCTGATAATGG + Intergenic
1132489285 16:216845-216867 CCACCACGCCTGGCTAACTCTGG + Intronic
1132491166 16:232167-232189 CCACCGTGCCTGGCCAAGACAGG - Intergenic
1132558217 16:582041-582063 CCACCGTGCCTGGCTGCAGGAGG + Intronic
1132753466 16:1470282-1470304 CCACCATGCCTGGCTCAAAATGG + Intronic
1133124205 16:3634513-3634535 CCACTGTGCCTGGCCGAGACAGG + Intronic
1133149235 16:3814542-3814564 CCACCACGCCTGGCCATAACTGG + Intronic
1133189703 16:4124533-4124555 CCACCATGCCTGGCTTCTCCTGG - Intergenic
1133228757 16:4356238-4356260 CCACCATGCCTGGCCACACCTGG + Intronic
1133305764 16:4807398-4807420 CCACCGTGCCCAGCTGAAACTGG + Intronic
1133408312 16:5545127-5545149 CCACCATGCCTGGCTAATTTTGG + Intergenic
1133411048 16:5569135-5569157 CCACCATGCCCGGCTGACATTGG + Intergenic
1133513086 16:6479760-6479782 CCACCGTGCCTGGCCTAGACTGG - Intronic
1133558778 16:6930560-6930582 CCACCATGCCTGGCTAATTTTGG + Intronic
1133639736 16:7705217-7705239 CCACCATGCCCGGCCCACACAGG - Intronic
1133753716 16:8745542-8745564 CCACCATGCCTGGCTAATTTTGG - Intronic
1133855915 16:9549099-9549121 CCACCATGCCTGGCCAAGAATGG + Intergenic
1133870100 16:9677942-9677964 CCACCATGCCTGGCTAATTTTGG - Intergenic
1134087252 16:11366046-11366068 CCACCATGCCTGGCTCAGCATGG + Intronic
1134170823 16:11968187-11968209 CCACCGCGCCTGGCCAAAACTGG - Intronic
1134239564 16:12495433-12495455 CCACCATGCCTGGCGTCATCTGG + Intronic
1134253098 16:12588540-12588562 CCACCATGCCTGGCTGGATCTGG - Intergenic
1134391145 16:13821304-13821326 CCACCATGCCTGGCTAATTTTGG + Intergenic
1134414834 16:14034324-14034346 CCACCATGCCTGGCCAAAGATGG - Intergenic
1134465322 16:14471068-14471090 CTACCATGCCCAGCTGATACAGG + Intronic
1134651491 16:15912434-15912456 CCACCATGCCTGGCCCCAAAGGG - Intergenic
1134657705 16:15959611-15959633 CCACCATGCCCAGCCGAAAATGG + Intronic
1134766488 16:16763279-16763301 CCACCATGCCTGGCCAAAAAAGG + Intergenic
1134897048 16:17897657-17897679 ACACCAGGCCCGGCTGAAATTGG + Intergenic
1135027126 16:19007110-19007132 CCACCGTGCCTGGCTGTCCCAGG + Intronic
1135034556 16:19066147-19066169 CCACCACGCCCAGCTGAGACTGG - Intergenic
1135062079 16:19279603-19279625 CCACCATGCCTGGCTAATTTTGG + Intergenic
1135094448 16:19553756-19553778 CCACCATGCCTGGCTAATATCGG - Intergenic
1135141320 16:19924506-19924528 CCACTATGCCTGGCTCATAATGG + Intergenic
1135333835 16:21584228-21584250 GCACCGTGCCTGGCCGAAGCAGG - Intergenic
1135519563 16:23164387-23164409 CCACTGTGCCTGGATGAAAATGG - Intergenic
1135566373 16:23514257-23514279 CCACCATGCCTGGCTAATTTTGG + Intronic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1135799220 16:25476921-25476943 CCACCATGCCTGGCCCAAAGCGG + Intergenic
1136020270 16:27435739-27435761 CCACCATGCCAGGCCCAAACAGG + Intronic
1136099794 16:27985554-27985576 CCACCGTGCCCGGCCGAGACTGG - Intronic
1136130713 16:28219166-28219188 CCACCATGCCCAGCTGACAAGGG + Intergenic
1136155792 16:28381110-28381132 CCACCACGCCTGGCTGGAAGAGG - Intronic
1136207292 16:28734179-28734201 CCACCACGCCTGGCTGGAAGAGG + Intronic
1136445288 16:30313769-30313791 CCACCACGCCTGGCTGATATTGG - Intergenic
1136473678 16:30498609-30498631 CCACCATGCCTGGCCAATAATGG - Intronic
1136533242 16:30883802-30883824 CCACCACGCCAGGCCCAAACTGG + Intronic
1136571261 16:31098349-31098371 CCACCATGCCTGGCCCACAGGGG + Intergenic
1137625088 16:49902671-49902693 CCACCATGCCTGGCCAACAATGG - Intergenic
1137630182 16:49937775-49937797 CCACCATGCCTGGCCAATCCAGG + Intergenic
1137632104 16:49954063-49954085 CCACCATGCCCGGCTGGCAAAGG - Intergenic
1137655910 16:50157916-50157938 CCACCATGCCTGGCTCATTTTGG + Intronic
1137664003 16:50237607-50237629 CCACCACACCTGGCTAAGACAGG - Intergenic
1137841981 16:51649322-51649344 CCACCATGCCTGGCTAATTTTGG + Intergenic
1138061093 16:53891141-53891163 CCACCATGCCTGGCTAATTTTGG + Intronic
1138089488 16:54162600-54162622 CCACCACATCTGGCTGAGACTGG + Intergenic
1138287448 16:55821121-55821143 CCACCATTGCAGGCTGCAACTGG + Intronic
1138444789 16:57056809-57056831 CCACCATGCCTGGCTAATTTTGG + Intronic
1138448403 16:57078756-57078778 CCACCATGGCTGGCTGGTGCTGG + Intronic
1138525974 16:57607431-57607453 CCACCATGCCTGGCCAGCACTGG - Intergenic
1138727924 16:59161284-59161306 CCACCATGCCTGGCTAATTTTGG + Intergenic
1138754420 16:59465895-59465917 CCACCATGCCTGGCCACAACAGG + Intergenic
1138953508 16:61942782-61942804 TCACCATGCCCAGCTGGAACTGG - Intronic
1138973426 16:62173696-62173718 CCACCATGCCTGACTTAGAAAGG + Intergenic
1139022034 16:62761446-62761468 CCACCACGCCTGGCCCACACAGG + Intergenic
1139398800 16:66663351-66663373 CCACCATGCCTGGCTAATCTTGG - Intronic
1139400405 16:66676960-66676982 CCACCACACCTGGCTGTCACTGG - Intronic
1139438659 16:66952406-66952428 CCACCGTGCCTGGCCGAAACCGG - Intergenic
1139594252 16:67948871-67948893 CCAGCAGGCCTGGCTGTAGCTGG + Intronic
1139604351 16:68007491-68007513 CCACCGCGCCTGGCCGAGACAGG + Intronic
1139828259 16:69774815-69774837 CCACCATGCCTGGCTAATTTTGG - Intronic
1139849037 16:69939761-69939783 CCACCATGCCTGCCTGCAGCAGG - Intronic
1140266863 16:73428535-73428557 CCTGCATGCCTGGCTGACCCAGG - Intergenic
1140485192 16:75288029-75288051 CCACCAGGCCTGTCTGAAGCAGG + Intergenic
1140757212 16:78078505-78078527 GCACCATGCCTGGCTAATCCAGG - Intergenic
1141095556 16:81160407-81160429 CCACCACACTTGGCTGAAAGTGG + Intergenic
1141420205 16:83909920-83909942 CCACCGTGCCCGGCTGATATAGG + Intronic
1141520787 16:84577530-84577552 CCACCATGCCTGGCCGGAACAGG + Intronic
1141712320 16:85707197-85707219 CCACCATGCCTGGCCACAAATGG - Intronic
1142541031 17:659566-659588 CCACCGTGCCCGGCTGCATCAGG + Intronic
1142571025 17:874300-874322 CCACCGTGCCCGGCTGAGACTGG - Intronic
1142580106 17:936663-936685 CTACGATGTCTGGCTAAAACGGG + Intronic
1142732400 17:1869247-1869269 CCACCATGCCCGGCCGAAACAGG - Intronic
1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG + Intronic
1143743250 17:8969665-8969687 CCACTGTGCCTGGCTGACATTGG + Intergenic
1143836004 17:9693546-9693568 CCACCATGCCTGGCTGAATTTGG - Intronic
1144144285 17:12382250-12382272 CCACCACGCCTGGCTAAACTGGG - Intergenic
1144337972 17:14288562-14288584 CCACAGTGCCTGGCTGAACATGG + Intergenic
1144443561 17:15305631-15305653 CCACCCTCCCTGGCTTCAACAGG + Intronic
1144664753 17:17094761-17094783 CCACCATGCCTGGCTAATTTTGG + Intronic
1144696546 17:17307566-17307588 CCACCGTACCTGGCTGAGGCAGG - Intronic
1144747891 17:17627790-17627812 CCACCATGCCTGGCCTCACCTGG + Intergenic
1145020668 17:19428108-19428130 CCACCATGCCTGGCTAATTTTGG + Intergenic
1145020772 17:19429065-19429087 CCACCATGCCTGGCTAATTTTGG + Intergenic
1145945284 17:28769466-28769488 CCACCGTGCCTGGCCCAAACGGG + Intronic
1146314963 17:31799655-31799677 CCACCATGCCTGGCTTGTGCAGG - Intergenic
1146356635 17:32139910-32139932 CCACCATACCTGGCTGGATATGG + Intergenic
1146467246 17:33095918-33095940 TCCCCATGCCTGGGTGACACAGG - Intronic
1146943834 17:36861082-36861104 CCACCGTGCCTGGCCGACCCAGG + Intergenic
1147003001 17:37378423-37378445 CCACCATGCCTGGCCAAAGCTGG - Intronic
1147114037 17:38285445-38285467 CCACCGTGCCCAGCTGAGACTGG + Intergenic
1147126344 17:38371615-38371637 CCACCATGCCCGGCCGGGACGGG + Intronic
1147171993 17:38626741-38626763 CCACCATGCCCGGCTGATTTTGG + Intergenic
1147207455 17:38847826-38847848 CCACCATGCCCAGCTGACAAAGG + Intergenic
1147271899 17:39278990-39279012 CCACCATGCCTGGCTAATTTTGG - Intronic
1147349129 17:39826328-39826350 CCACCATGCCTGGCTGTGGATGG + Intronic
1147487961 17:40836568-40836590 CCACTGTGCCTGGCTAAAATGGG + Intergenic
1147609182 17:41791760-41791782 CCACCATGCCTGGCCGATCCTGG + Intergenic
1147639677 17:41988322-41988344 TCACCATGCATGGTTGAAAATGG - Intronic
1147682064 17:42255933-42255955 CCACCATGCCTGGCTAATTTTGG - Intronic
1147778410 17:42920703-42920725 CCACCATGCCTGGCTAATTTTGG + Intergenic
1147780859 17:42940894-42940916 CCACCATGCCCGGCCGAAATCGG - Intergenic
1147870860 17:43586516-43586538 CCACCATGCCTGGCCTAGGCAGG - Intergenic
1147871910 17:43593438-43593460 CCACCCTGCCCGGCTGAAAGTGG - Intergenic
1147983369 17:44289015-44289037 CCACCATGCCCGGCTAAATTTGG + Intergenic
1147983444 17:44289557-44289579 ACACCATGCCTGGCTAAGACAGG + Intergenic
1147983590 17:44290842-44290864 CCACCGCACCTGGCTGAGACGGG + Intergenic
1148143452 17:45344490-45344512 CCACCACGCCCGGCCGAAAGGGG - Intergenic
1148271521 17:46265763-46265785 CCACCATGCCCGGCCTCAACAGG + Intergenic
1148415568 17:47503745-47503767 CCACCGTGCCCAGCTGAGACTGG - Intergenic
1148465733 17:47864129-47864151 CCACCACGCCTGGCCTACACTGG + Intergenic
1148493784 17:48039832-48039854 CCACCGTGCCCGGCCGACACTGG - Intergenic
1148496833 17:48058116-48058138 CCACCAGGCCTGGCAGAGATGGG - Intronic
1148821384 17:50361727-50361749 CCACCAGGCCAGGCTGCAGCAGG + Intronic
1148925910 17:51085001-51085023 CCACCATGCCTGGCTAATTTTGG + Intronic
1149266731 17:54935003-54935025 CCACAGTGCCTGGCTGAACTAGG + Intronic
1149407483 17:56368565-56368587 CCACCGCGCCCGGCTGAAAATGG + Intronic
1149413754 17:56436534-56436556 CCACCGTGCCCGGCCGCAACTGG - Intronic
1149492452 17:57094895-57094917 CCATCGTGCCTGGCTGAAGATGG + Intronic
1149759889 17:59219679-59219701 CCACCGCGCCCGGCTGAATCAGG + Intergenic
1149779413 17:59385423-59385445 CCACCATGCCTGGCTAATTTTGG - Intronic
1149825335 17:59823160-59823182 CCACCATGCCTGGCCCATTCAGG - Intronic
1149899194 17:60458144-60458166 CCACCATGCCTGGCTGGAAAAGG - Intronic
1149943150 17:60892631-60892653 CCACCATGCCGGGCCGAAAACGG - Intronic
1150111587 17:62504994-62505016 CCACCATGCCTGGCTAATTTTGG + Intronic
1150166295 17:62946763-62946785 CCACTGTGCCCGGCTGCAACTGG + Intergenic
1150688473 17:67341314-67341336 CCACCATGCCTGGCTAATTTTGG - Intronic
1150701614 17:67451921-67451943 CCACCACGCCTGGCCGAGACTGG + Intronic
1150765257 17:67997030-67997052 CCACCCTGCCTGGCCTCAACAGG - Intergenic
1150774622 17:68069484-68069506 CCACCGTGCCTGGCTCAACCTGG + Intergenic
1151483081 17:74381703-74381725 CCACCGTGCCTGGACGAAGCTGG - Intergenic
1151584533 17:75001079-75001101 CCACCATGCCTGGCTAATTTTGG - Intronic
1151796378 17:76349021-76349043 CCACCACGCCTGGCCAAAAATGG - Intronic
1151903181 17:77031022-77031044 CCACCATGCCTGGCTTCAGAAGG - Intergenic
1151941165 17:77292814-77292836 CCACCAGGCCTGGCTGTAGTTGG + Intronic
1152154658 17:78625024-78625046 CCACCACGCCCAGCTGGAACAGG - Intergenic
1152510626 17:80784849-80784871 CCACCACGCCTGGCTAATGCTGG + Intronic
1152557279 17:81059736-81059758 CCACCACGCCTGGCTGAAAGAGG + Intronic
1152611826 17:81318772-81318794 CCACCATGCCCGGCCGGCACTGG - Intronic
1152765887 17:82138433-82138455 CCACCGCACCTGGCTGAGACGGG + Intronic
1152993617 18:385608-385630 CCACCGTGCCTGGCCAAAAATGG + Intronic
1153060359 18:988817-988839 CCACCATGCCTGGCTAATTTTGG + Intergenic
1153198492 18:2626109-2626131 CCACCATGCCTGGCTAATTTGGG + Intergenic
1153543901 18:6186327-6186349 CCACCATGCCTGGCCAAAAAGGG + Intronic
1153603344 18:6805119-6805141 CCACCATGCCCAGCTGAAAGAGG + Intronic
1153772326 18:8425973-8425995 CCAGCATGCCTGCCTGACCCTGG + Intergenic
1154308474 18:13248111-13248133 CCACCATGCCTGGCTAATTTTGG + Intronic
1155083453 18:22432450-22432472 CCACCATGCCTGGCCCCAAATGG + Intergenic
1155153566 18:23140587-23140609 CCACCACGCCTGGCTGATTTTGG + Intronic
1155176125 18:23302758-23302780 CCACCCTGGCTGGCTGAGACTGG - Intronic
1155306014 18:24479068-24479090 CCACCATGCCTGGCTAATTTTGG + Exonic
1155375026 18:25147915-25147937 ACACCATGCCTGGCTCTACCTGG + Intronic
1155613076 18:27690791-27690813 CCACCATGCCTGGCCAGAAATGG + Intergenic
1155699921 18:28731180-28731202 CCACCATGCCCAGCTGAGGCGGG - Intergenic
1156120008 18:33831914-33831936 CCACCGTGCCTGGCCCAGACAGG - Intergenic
1156242120 18:35264857-35264879 CCACCGTGCCTGGCAAAAATGGG - Intronic
1156261596 18:35449408-35449430 CCACCATGCCTGGCTAATTTTGG - Intronic
1156393880 18:36680175-36680197 CCACCATCCCTGGCAGCTACAGG - Intronic
1156485514 18:37463285-37463307 GCACCAGGCCTGGCTGCAGCAGG + Intronic
1156505704 18:37590231-37590253 CCACCATGCCTGGCCAACTCTGG + Intergenic
1156652295 18:39238619-39238641 CCACCGTGCCTGGCCGAAAATGG + Intergenic
1157207478 18:45712871-45712893 CCACCATGCCTGGCCAAAGGAGG + Intergenic
1157220753 18:45827201-45827223 CCACCATGCCCGGCAGAGAAAGG + Intronic
1157253428 18:46116406-46116428 CCACCATGCCTGGCTAATTTTGG - Intronic
1157412447 18:47474815-47474837 CCACCATGGCTGGGTGAGAAAGG + Intergenic
1157850903 18:51050068-51050090 CCACCGTGCCTGGCTGACAGTGG - Intronic
1157902519 18:51533404-51533426 CCACCATGCCTGGCCTTAAAGGG - Intergenic
1157996087 18:52557810-52557832 CCACCATGCCTGGCTAATTTTGG + Intronic
1158231711 18:55263487-55263509 CCACTATGCCTGGCTAAGGCAGG + Intronic
1158625926 18:59071656-59071678 CCACCATGCCTGGCTAATTTTGG + Intergenic
1158927658 18:62285466-62285488 GCACCATGCCTGACTTAGACAGG - Intronic
1159317222 18:66791559-66791581 CCACCATGCATGACCGATACTGG + Intergenic
1159367081 18:67482039-67482061 GCACCATGCCTCTCTGAGACTGG + Intergenic
1159884172 18:73888535-73888557 CCACCATTCCTGGCTGTGTCAGG - Intergenic
1160205313 18:76826644-76826666 CCACCATGCCTGGCTAACTTTGG - Intronic
1160549494 18:79684481-79684503 CCACCCTGCCTGGCTGGTGCTGG - Intronic
1160729703 19:635572-635594 ACACCAGGCCTGGCTGATTCAGG - Intergenic
1160753155 19:744604-744626 CCACCATGCCTGGCCATTACAGG - Intronic
1161141773 19:2652330-2652352 CCACCGTGCCTGGCTGTATTTGG - Intronic
1161157683 19:2741502-2741524 CCACCATGCCTGGCTAATTTTGG - Intergenic
1161160674 19:2760363-2760385 CCACCATGCCTGGCTAATTTTGG - Intronic
1161178715 19:2864995-2865017 CCACCATGCCTGGCCAACGCTGG - Intergenic
1161413861 19:4133462-4133484 CCACCGCGCCCGGCTGAGACGGG - Intergenic
1161543538 19:4866792-4866814 CCACCATGACTTCCTGGAACTGG + Intronic
1161566012 19:5003202-5003224 CCACCATGCCCGGCCCAAGCAGG - Intronic
1161610665 19:5240550-5240572 CCACCGTGCCCGGCCGAAAGGGG - Intronic
1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG + Intronic
1161645259 19:5449443-5449465 CCACCATGCCTGGCCAAGACAGG + Intergenic
1161676567 19:5653748-5653770 CCACCATGCCTGGCCGGGGCAGG + Intronic
1161797953 19:6398382-6398404 CCACCGCGCCTGGGTGAGACAGG - Intergenic
1161884687 19:6985394-6985416 CCACCGTGCCCGGCTGAGCCAGG - Intergenic
1162025318 19:7890500-7890522 CCACCGTGCCCGGCTGAAGCAGG - Intronic
1162039943 19:7964545-7964567 CCACCATGCCTGGCCCAGAAAGG - Intronic
1162054582 19:8055001-8055023 CCACTGTGCCTGGCTGATAGTGG - Intronic
1162065926 19:8125501-8125523 CCACCACGCCTGGCCTGAACAGG - Intronic
1162159501 19:8701205-8701227 CCACCATGCCTGGCTGTTTTGGG - Intergenic
1162217360 19:9147622-9147644 CCACCACGCCCGGCTGATCCTGG + Intronic
1162244122 19:9384562-9384584 CCACCATGCCTGGCCGGAACTGG + Intergenic
1162274782 19:9644485-9644507 CCACCGTGCCTGGCCGAGACTGG + Intronic
1162356225 19:10186683-10186705 CCACCATGCCTGGCTGATTCTGG - Intronic
1162485352 19:10956968-10956990 CCACCGTGCCTGGTTGAGACAGG + Intergenic
1162611211 19:11755025-11755047 CCACCATGCCTGGCCCAAAGAGG - Intergenic
1162706141 19:12555979-12556001 CCACCGTGCCTGGCCTACACAGG - Intronic
1162925216 19:13927489-13927511 CCACCATGCCTGGCCAAGAGTGG - Intronic
1162986185 19:14271714-14271736 CCACCATGCCCGGCCAAGACAGG + Intergenic
1163041088 19:14603020-14603042 CCACCGTGGCTGGCCAAAACAGG + Intronic
1163268890 19:16237578-16237600 CCACCATGCCTGGCTAATTTTGG - Intronic
1163279104 19:16304280-16304302 CCACCGTGCCTGGCTGACTTTGG - Intergenic
1163332463 19:16649288-16649310 CCACTGCGCCTGGCTGAAACAGG - Intronic
1163333302 19:16655391-16655413 CCACCATGCCTGGCCTAATCTGG - Intronic
1163345139 19:16736380-16736402 CCACCATGCTTGGCTTTGACTGG + Intronic
1163411584 19:17158282-17158304 CCACCGTGCCTGGCTGGCAGGGG - Intronic
1163456131 19:17406652-17406674 CCACCATGCCTGGCTCTAAGTGG - Intronic
1163744569 19:19037636-19037658 CCACCATGCCTGGCCTGAAGTGG + Intronic
1164145853 19:22512208-22512230 CCACCATGCCTGGCCGAAGCAGG + Intronic
1164277647 19:23735073-23735095 CCACCAGGCCTGGCTGACAATGG + Intergenic
1164526696 19:29018264-29018286 CCATCATGCCTGGCTGCAAAGGG + Intergenic
1164792664 19:31001521-31001543 CCTCCATGCATGGCTGCAAATGG + Intergenic
1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG + Intergenic
1164930939 19:32175413-32175435 CCACCGTGCCTGGCTGATGCTGG + Intergenic
1164947304 19:32307060-32307082 CCACCGTGCCTGGCCCAGACTGG + Intergenic
1164991787 19:32689917-32689939 CCACCACACCTGGCAGAAACTGG - Intergenic
1165224847 19:34347512-34347534 CCACTGTGCCTGGCTGATGCTGG + Intronic
1165861827 19:38913070-38913092 CCACTATGCTTGGCTGAGAGTGG + Intergenic
1166372278 19:42308834-42308856 CCACCATGCCTGGCCTCATCTGG + Exonic
1166392267 19:42415521-42415543 CCACCATGCCCAGCTAAGACTGG - Intronic
1166537949 19:43587175-43587197 CCACCATGCCTGGCTAATTTTGG - Exonic
1166706996 19:44913595-44913617 CCACCATGCCTGGCTAATGCAGG + Intergenic
1166709167 19:44926155-44926177 CCACCATGCCTGGCCAATGCAGG + Intergenic
1166749230 19:45156805-45156827 CCACCAGGCCTCTCTGAAAGTGG - Intronic
1166838642 19:45682828-45682850 CCACCATGCCCGGCCCAAATGGG + Exonic
1166925675 19:46265468-46265490 CCACCCTGCTGGGCTGAAATAGG - Intergenic
1166946229 19:46398269-46398291 CCACTGTGCCTGGCTGACACTGG - Intergenic
1166961233 19:46497058-46497080 CCACCATGCCTGGCCTCAAAGGG + Intronic
1166971327 19:46570290-46570312 CCACCATGCCTGGCCACAATGGG + Intronic
1166986986 19:46666673-46666695 CCACCGCGCCTGGCCGAGACTGG - Intergenic
1167032879 19:46975155-46975177 CCACCATGCCTGGCCAGAAGGGG + Intronic
1167094395 19:47366566-47366588 CCACTGTGCCTGGCTGACACTGG + Intronic
1167194702 19:48020162-48020184 CCACCATTCGTGGCTCACACTGG - Intronic
1167328683 19:48840710-48840732 CCACCATGCCCGGCCGAAAAAGG + Intronic
1167376089 19:49112898-49112920 CCACCTTGCCTGGCCGATACTGG - Intergenic
1167481418 19:49734121-49734143 CCACCATGCCCAGCCTAAACTGG + Intergenic
1167640919 19:50680941-50680963 CCACCACGCCTGGCTGATAGTGG + Intronic
1167829987 19:52011674-52011696 CCACCACGCCCGGCTGACATTGG - Intergenic
1167871566 19:52375022-52375044 CCACCATGCCTGGCCTAGAAGGG + Intronic
1167899699 19:52610568-52610590 CCACCATGCCTGGCCCATTCTGG + Intronic
1168047673 19:53805668-53805690 CCACCATGCCTGGCTCATTTTGG + Intronic
1168210165 19:54884342-54884364 CCACCGCACCTGGCTGCAACTGG - Intronic
1168235096 19:55057934-55057956 CCAGCATGCCTGGCTAACTCTGG + Intronic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
1168534922 19:57161036-57161058 CCACCATGCCCGGCTCACAATGG - Intronic
1168713633 19:58515035-58515057 CCACCACGCCTGGCTGAGACAGG - Intronic
924964452 2:62393-62415 CCACCATGCCTGGCCCAGAGTGG - Intergenic
925345051 2:3166077-3166099 CCACTGCACCTGGCTGAAACTGG + Intergenic
925819917 2:7790153-7790175 CCACCATGCCTGGCCCAGATTGG - Intergenic
925965605 2:9062606-9062628 CCACTGTGCCTGGCTGAGAGGGG - Intergenic
926032702 2:9606276-9606298 CCACCAAGCCTGGCCGGAAAAGG - Intronic
926075970 2:9943109-9943131 CCACCGTGCCTGGCCAAATCAGG - Intergenic
926085558 2:10017834-10017856 CCACCATGCCCGGCTTCAACAGG - Intergenic
926180217 2:10636173-10636195 CCACCATGCCTGGCCCATCCAGG + Intronic
926952109 2:18254059-18254081 GCTCCAGGCCTGGCTGAAAGGGG + Intronic
927165509 2:20316743-20316765 CCACCATGCCTGGCCGTGTCTGG - Intronic
927512626 2:23653876-23653898 CCACCGTGCCTGGCCGAAGCTGG - Intronic
927527560 2:23760371-23760393 CCACCATGCCTAGCTGGAAATGG - Intronic
927541328 2:23913979-23914001 CCACCATGCCTGGTCCATACTGG - Intronic
927544752 2:23942704-23942726 CCACCGTGCCCGGCTGATGCAGG + Intronic
927771381 2:25865141-25865163 CCACCATGCCTGGCCTAAATTGG - Intronic
927876783 2:26662005-26662027 CCACCATGCCCGGCCAAGACAGG + Intergenic
928055700 2:28051935-28051957 CCACCATGCCTGGCCAAGTCAGG + Intronic
928087288 2:28353650-28353672 CCACCACGCCTGGCCTGAACTGG + Intergenic
928099495 2:28427741-28427763 CCACCATGCCTGGCCTAAAATGG + Intergenic
928125417 2:28612180-28612202 TCAGCATTCCTGTCTGAAACAGG - Intronic
928230756 2:29496981-29497003 CCACCATGCCTGGCCTCATCAGG - Intronic
928340496 2:30439317-30439339 CCACCATGCCTGGCTGAGACTGG + Intergenic
928495840 2:31830770-31830792 CCACCATGCCTGGCCGATTTTGG + Intergenic
928851589 2:35754046-35754068 CCACCGTGCCCGGCTGGTACTGG - Intergenic
929198693 2:39212518-39212540 CCACCATGCCCGGCCGGAAACGG + Intronic
929236519 2:39610824-39610846 CCACCATGCCTGGCTAATTTTGG + Intergenic
929800515 2:45096339-45096361 CCACCATGCCTGGCAGATCAGGG + Intergenic
930007649 2:46910750-46910772 CCACCATGCCTGGCCTATCCTGG - Intronic
930110101 2:47671579-47671601 CCACCATGCCTGGCCAATATAGG + Intergenic
930116317 2:47721464-47721486 CCACCATGCCTGGCTAATTATGG + Intronic
930333944 2:50022001-50022023 CCACCATGCCTGGCTAATTTTGG + Intronic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930672138 2:54162676-54162698 CCACCATGCCTGGCCTGTACAGG - Intronic
931273564 2:60723768-60723790 CCACCATGCCCGGCCGACTCAGG + Intergenic
931283138 2:60810896-60810918 CCACCATGCCTGGCCGAGACAGG - Intergenic
931338300 2:61372556-61372578 CCACCATGCCTGGCGGAAACAGG - Intronic
931469350 2:62522038-62522060 CCACCGTGCCTGGCTGGATATGG + Intergenic
931733918 2:65177367-65177389 CCACCACGCCTGGCCGAGTCTGG + Intergenic
932138822 2:69256773-69256795 CCACCATGCCTGGCTAGAGATGG - Intergenic
932145977 2:69317590-69317612 CCACTATGCCTGGCTGTATTAGG + Intergenic
932263995 2:70351113-70351135 CCACCGTGCCTGGCTCCTACTGG + Intergenic
932282121 2:70502490-70502512 TCACCATGCCTGGCTAAGACGGG + Intronic
932898200 2:75665439-75665461 CCACCATGCCCGGCCAAATCTGG + Intronic
932901000 2:75699862-75699884 CCACTATGCCTGGCCAAATCTGG + Intronic
933548776 2:83747235-83747257 CCAGCACGCCTGGCTGAGATAGG + Intergenic
933645766 2:84811571-84811593 CCACCGTGCCCGGCTGGAAAGGG - Intronic
933722528 2:85407423-85407445 CCACCATGCCTGGCTGGCACTGG - Intronic
933874037 2:86600672-86600694 CCACCGTGCCTGGCTAAGATGGG - Intronic
934076409 2:88432252-88432274 CCACCACGCCCGGCTGAGACAGG - Intergenic
934684969 2:96314340-96314362 CCACCATGCCTGGCCTGAATGGG + Intergenic
934723666 2:96601113-96601135 CCACCATGCCCGGCTACAACAGG - Intronic
934920424 2:98339965-98339987 CCACCAGGCCAGGCTGGAGCTGG + Intronic
935201556 2:100861152-100861174 CCACCATGCCTGGCCCAGCCTGG + Intronic
935359354 2:102234504-102234526 CCACCTTGCCTGGCCAAAAATGG - Intronic
935617480 2:105101459-105101481 CCACCACACCTGGCTTAAAATGG - Intergenic
935710746 2:105896177-105896199 CCATCGTGCCTGGCTTAAACAGG - Intergenic
935779236 2:106496985-106497007 CCACCACGTCTGGCCAAAACTGG - Intergenic
936014727 2:108949267-108949289 CCACCAAGCCTGGCTAACATAGG + Intronic
936102700 2:109597226-109597248 CCACCGTGCCTGGCTGGAAAAGG + Intronic
936540388 2:113345144-113345166 CCACCATGCCTGGCCTAATTAGG + Intergenic
936697210 2:114965287-114965309 CCACCATGCCTGGCTGATTTTGG + Intronic
937176232 2:119938412-119938434 CCACCATGCCTGGCTAATGTGGG + Intronic
937408744 2:121654236-121654258 CCACCCTGCCTGGCCCAAAATGG - Intergenic
937586549 2:123558354-123558376 CCACCATGCCTGCCTTCAAATGG + Intergenic
937930686 2:127202879-127202901 CCACTGCACCTGGCTGAAACTGG - Intronic
937956867 2:127426608-127426630 CCCCCATGCCTGGCAGAGAGGGG - Intronic
937960939 2:127458149-127458171 CCACCATGTCTGGCTAATATAGG - Intronic
938035810 2:128034070-128034092 CCACCATGCCTGGCCAAGATTGG - Intergenic
938040323 2:128070412-128070434 CCACCGTGCCCGGCTGCAATTGG - Intergenic
938223402 2:129593286-129593308 CCACCATGCCCAGCCGAAATTGG - Intergenic
938721279 2:134069265-134069287 CCACCATGCCTGGCTGCCACTGG - Intergenic
938894309 2:135735369-135735391 CCACCATGCCCGGCCGAGAGGGG + Intergenic
938924773 2:136028998-136029020 CCACCATGCCTGGCCTTAATTGG + Intergenic
939181255 2:138804745-138804767 CCACCATGCCTGGCTAATTTTGG - Intergenic
939392301 2:141584090-141584112 CCACCATGCCTGGCTAACGTTGG - Intronic
939589509 2:144046523-144046545 CCACCATGGCTGGCTCATATAGG + Intronic
939918565 2:148079702-148079724 CCACCATGCCTGGCTAATTTTGG - Intronic
940046412 2:149415346-149415368 CCCCTCTGCCTGGCTGAAAAAGG + Intronic
940229903 2:151439694-151439716 CCACCATGCCTGGCTGAGAATGG - Intronic
940377833 2:152976609-152976631 CCACCACGCCTGGCCGAAAATGG + Intergenic
940785244 2:157974084-157974106 CCACCATGCCTGGCTAATTTTGG + Intronic
941968958 2:171329136-171329158 CCACCATGCCTGGCTACAGGAGG + Intronic
942666391 2:178323748-178323770 CCACCATGCCTGGCCGCCACTGG + Intronic
943108084 2:183572006-183572028 CCTCCAGCCATGGCTGAAACAGG + Intergenic
944082961 2:195810562-195810584 CCACCATGCCTGGCTAATTTTGG + Intronic
944376971 2:199056915-199056937 CCACCGTGCCTGGCTGATCATGG + Intergenic
944526160 2:200622037-200622059 CCACCACGCCCGGCTTAAATGGG + Intronic
944541485 2:200757763-200757785 CCACCATGCCCAGCTGAGGCAGG - Intergenic
944832162 2:203543757-203543779 CCACCGTGCCTGGCCCAAAAGGG - Intergenic
944958348 2:204838500-204838522 CCACCATGCCTGGCTGCATCAGG + Intronic
945053170 2:205844705-205844727 CCACCACGCCCGACTGATACTGG - Intergenic
945095669 2:206216567-206216589 CCACCATGCCTGGTCTCAACAGG + Intronic
945292645 2:208141332-208141354 CCACCACGCCTGGCCTACACTGG - Intergenic
946234434 2:218314521-218314543 CCACCATGCCTGGCTATACTTGG + Intronic
946265122 2:218534199-218534221 CCACCATGCCCGGCCTAATCTGG - Intronic
946270771 2:218591588-218591610 CCACCATGCCTGGCTAATTTTGG - Intronic
946390270 2:219411047-219411069 CCACCACGCCCGGCTTAATCTGG + Intergenic
946435332 2:219648082-219648104 CCACCATGTCAGGCTCACACTGG + Intergenic
946552732 2:220821317-220821339 CCACCATGCCCAGCTGAAAATGG - Intergenic
946768149 2:223059554-223059576 TCACCATTCCAGGCTGACACAGG - Intronic
946876089 2:224131186-224131208 CCTCAATGCCTCCCTGAAACAGG - Intergenic
947016981 2:225631968-225631990 CCACCATGCCTGGCTAATTTTGG + Intronic
947167226 2:227274784-227274806 CCACCATGCCTGGCCGAAGGAGG + Intronic
947404048 2:229756101-229756123 CCCCCATGCCTGGCCAAAAGTGG + Intergenic
947557012 2:231101966-231101988 CCACCATGCCTGGCTAATTTTGG + Intronic
947738840 2:232475556-232475578 CCACCGTGCCTGGCCGAAGGGGG - Intergenic
947852925 2:233303100-233303122 CCACCATGCCTGGCTGAAGAAGG + Intergenic
947931570 2:233969189-233969211 CCACCATGCCTGGCCAAACTTGG - Intronic
947997596 2:234541947-234541969 CCACCATGCCCAGCTGAGACAGG + Intergenic
948197096 2:236104247-236104269 CCACCAGGCCAGGCTGACATGGG + Intronic
1169086732 20:2830639-2830661 CCACCATGCCTGGCCCAAGCAGG + Intergenic
1169089908 20:2853101-2853123 CCACCATGCCCGGCTGAAAGTGG - Intronic
1169223263 20:3839599-3839621 CCACCATGCCTGGCCCAGCCAGG - Intergenic
1169246189 20:4027078-4027100 CCACCATGCCTGGCTAATTTTGG + Intergenic
1169452139 20:5721187-5721209 CCACCACGCCTGGCCTAAAAAGG - Intergenic
1169728946 20:8765964-8765986 CCACCATGCCTGCCCACAACTGG + Intronic
1170141517 20:13129287-13129309 CCACTGTGCCTGTCTTAAACAGG + Intronic
1170297903 20:14849491-14849513 CCACTGTGCCTGGCTGAGAGAGG - Intronic
1171236019 20:23525780-23525802 CCACCACGCCTGGCTCAGCCTGG - Intergenic
1171796304 20:29569146-29569168 CCACCACACCTGGCTAACACCGG + Intergenic
1171814693 20:29775320-29775342 CCACCATGCCTGGCTAATTTTGG + Intergenic
1171945675 20:31375300-31375322 CCACCATGCCTGGCTAATTTTGG + Intergenic
1172019077 20:31900045-31900067 CCACTGTGCCTGGCCGAATCTGG + Intronic
1172054488 20:32144620-32144642 CCACCATGCCTGGCCAACAATGG - Intronic
1172264468 20:33598971-33598993 CCACCATGCCTGGCCGACAGTGG - Intronic
1172309575 20:33907380-33907402 CCACCATGCCTGGCTCTAATTGG + Intergenic
1172542080 20:35726416-35726438 CCACCACGCCTGGCCCAAAAAGG + Intronic
1172718177 20:36979373-36979395 CCACCATGCCCGGCCGATACAGG + Intergenic
1172828970 20:37815603-37815625 CCACCATGCCTGGCCCACATTGG + Intronic
1173183192 20:40820050-40820072 CCACCATGCCTGCCTAAACCTGG + Intergenic
1173520482 20:43696391-43696413 CCACCATGCCTGGCTAATTGGGG + Intronic
1173690507 20:44957343-44957365 CCACCACGCCTGGTAGAGACAGG + Intronic
1173871647 20:46345765-46345787 CCACCATGCCTGGCTTCTGCAGG - Intergenic
1174003767 20:47394097-47394119 CCACCACGCCTGGCTCTAAAAGG + Intergenic
1174019503 20:47518710-47518732 CCACCATGCCTGGCCAATAGAGG + Intronic
1174324271 20:49766798-49766820 CCACCACACCTGGCTAATACTGG + Intergenic
1174347454 20:49940892-49940914 CCACCATGCCTGGCTAATTTTGG + Intronic
1174479374 20:50820132-50820154 CCACCATGCCCGGCTGCATTGGG + Intronic
1174660298 20:52206728-52206750 CCACCATGCCCGGCCGAGACAGG + Intergenic
1174779844 20:53379092-53379114 CCACCATGCCTGGCTTACTGTGG - Intronic
1174830109 20:53804622-53804644 CCACCATGCCTGGCCTTATCAGG + Intergenic
1175077478 20:56388522-56388544 CCACCATGCCCGGCCTAAAGAGG - Intronic
1175299336 20:57931955-57931977 CCACCAGGCCCAGCTGAAGCAGG + Intergenic
1175383790 20:58581295-58581317 CCACCATGCCTGGCCTTAATTGG + Intergenic
1175592862 20:60207319-60207341 CCACCATGCCTGGCCGAGACTGG + Intergenic
1175807622 20:61838522-61838544 CCACCGTGCCTGGCCGAGAGAGG - Intronic
1175830461 20:61962569-61962591 CCACCATGCCTGGCCTAGGCGGG - Intronic
1175850765 20:62091150-62091172 CCACTGTGCCCAGCTGAAACTGG + Intergenic
1176082393 20:63280443-63280465 CCACCATGCCTGGCCAGAAAGGG + Intronic
1176184766 20:63772281-63772303 CCATCATGCCTGGCCCAAAAGGG + Intronic
1176718816 21:10377223-10377245 CCACCATGCCTGGCTAATTTTGG + Intergenic
1177221929 21:18205887-18205909 CCACCATGCCTGGCTAATTTAGG + Intronic
1177842800 21:26253257-26253279 CCACCATTCCTAGCTGAATAAGG - Intergenic
1177856716 21:26407857-26407879 CAACCATGCCTGGCCAAAATAGG - Intergenic
1178236405 21:30847130-30847152 CCACCATGCCTGGCTGGTTATGG - Intergenic
1178325769 21:31644315-31644337 CCACCACGCCCGGCCTAAACTGG - Intergenic
1178336699 21:31749818-31749840 CCACCACGCCTGGCTAATTCTGG - Intergenic
1178361822 21:31954933-31954955 CCACCATGCCTGGCTAATTTTGG + Intronic
1178547129 21:33501613-33501635 CCACCATGCCTGGCCGCATGTGG + Intergenic
1178564361 21:33669368-33669390 CCACCATGCCTGGCCCAAACTGG + Intronic
1178569768 21:33725286-33725308 CCACCACGCCTGGCTGATTTTGG + Intronic
1178699411 21:34820360-34820382 CCACCATGCCTGGCTGGAGGAGG - Intronic
1179029020 21:37703814-37703836 ACACCTTGCCTGGCTGGCACAGG + Intronic
1179222258 21:39418785-39418807 CCACCATGCCTGGCCAGAAATGG + Intronic
1179476406 21:41649008-41649030 CCACCACGCCTGGCTTAACTTGG - Intergenic
1179668043 21:42925952-42925974 CCACCGTGCCCGGCTGAGACAGG - Intergenic
1180203871 21:46244855-46244877 GCACCTGGCCTGGCTGAAGCAGG - Exonic
1180217803 21:46337147-46337169 CCACCATGCCTGGCTAATTGGGG + Intronic
1180623853 22:17180847-17180869 CCACCATGCCTGGCCTATTCTGG - Exonic
1180643737 22:17320376-17320398 CCACCACGCCCAGCTGAAAGGGG - Intergenic
1180872982 22:19157746-19157768 CCAGCATGCCTGGCTTCAGCTGG + Intergenic
1180982149 22:19883664-19883686 CCATCACGCCTGGCTGAGACAGG - Intronic
1181470943 22:23139331-23139353 CCACCATACCTGGCCAAAGCTGG - Intronic
1181530346 22:23513778-23513800 CCACCACTGCTGGCTGTAACTGG - Intergenic
1181936179 22:26440482-26440504 CCACCATGCCTGGCTCATTTTGG + Intronic
1182101572 22:27661476-27661498 CCTCCATGCCTGGCGGCATCTGG - Intergenic
1182127071 22:27823799-27823821 CCACCATGCCTGGCTCATTTTGG - Intergenic
1182846484 22:33435287-33435309 CCACCATGCCTGGCTCCTACGGG + Intronic
1182930242 22:34166868-34166890 GCACAATGCATGGATGAAACTGG - Intergenic
1183053995 22:35290356-35290378 CCACCGCGCCTGGCTGGTACAGG - Intronic
1183249352 22:36718557-36718579 CCACCATGCCCGGCTAAGATGGG + Intergenic
1183399459 22:37593563-37593585 CCACCATGCCTGGCCTATACTGG + Intergenic
1183494394 22:38134272-38134294 CCACCGTGCCTGGCCTAAAGGGG - Intronic
1183566767 22:38621047-38621069 CCACCATGCCCGGCCGACTCAGG - Intronic
1183925701 22:41204505-41204527 CCACCGCGCCCGGCTGAAACTGG - Intergenic
1183961244 22:41413141-41413163 CCACCGTGCCTGGCCGAGGCTGG - Intergenic
1184028872 22:41879146-41879168 CCACCACGCCTGGCTGAGTCAGG + Intronic
1184207822 22:43016050-43016072 TCACCATGCCTGGCTCTATCTGG - Intergenic
1184310944 22:43642226-43642248 CCACCATTCCCGGCTGAGATTGG + Intronic
1184361146 22:44019505-44019527 CCACCGTGCCCGGCTGAAGCTGG + Intronic
1184578870 22:45398540-45398562 CCACCATGCCCGGCCGATGCAGG - Intronic
1184752465 22:46495661-46495683 CCACCATGCCTGGCTAAACAGGG - Intronic
1184849757 22:47113395-47113417 CCACCAGGCATGGCTGACCCAGG - Intronic
1185401160 22:50618099-50618121 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
949550415 3:5108087-5108109 CCACCATGCCCGACTTACACAGG + Intergenic
950349566 3:12334518-12334540 CCACCGTGCCTGGCTGACTTGGG + Intronic
950486972 3:13279705-13279727 CCACCAGGCCTGGCTTAGCCTGG + Intergenic
950493501 3:13320096-13320118 CCAGCATGTCAGGCTGAAGCGGG - Intronic
950560376 3:13718039-13718061 CCACCATGCAGGGCTGGATCTGG + Intergenic
951337222 3:21438506-21438528 CCCCTATGCCTGGATGAAAGGGG - Intronic
951895436 3:27605625-27605647 CCACCACGCCTGGCTGGGATCGG - Intergenic
951927062 3:27919821-27919843 CCACCATGCCTGGCTAATTTTGG - Intergenic
952394087 3:32905831-32905853 CCACCACGCCTGGCCCTAACTGG + Intergenic
952551808 3:34486969-34486991 CCACCATGCCTGGCCTAGAAAGG - Intergenic
952819646 3:37475125-37475147 CCACCATGCCTGGAGGAATGTGG - Intronic
953366136 3:42346851-42346873 CCACCGTGCCTGGCCGACAAGGG + Intergenic
953423323 3:42772117-42772139 CCACCATGCCTGGCTAATTTTGG - Intronic
953442466 3:42930134-42930156 CCACCATGCCTGGCCATAAATGG - Intronic
953558130 3:43963094-43963116 CCACCGTGCCTGGCTGCAGGAGG - Intergenic
953697169 3:45169145-45169167 CCACCGTGCCCGGCTATAACAGG + Intergenic
954197270 3:49004198-49004220 CCACCATACCTGGCTCTACCAGG + Exonic
954212735 3:49107408-49107430 CCACCATGCCTGGCCAAAGAAGG + Intergenic
954253118 3:49383740-49383762 CCACCGTGCCTGGCTGGACTAGG - Intronic
954257219 3:49415227-49415249 CCACCATGCCTGGCCAACTCAGG - Exonic
954286025 3:49619905-49619927 CCACAGTGCCTGGCACAAACTGG - Intronic
954472135 3:50707206-50707228 CCACCATGCCTGGCCAAGACTGG - Intronic
955079102 3:55641260-55641282 CCACCATGCCTGGCCTATATTGG - Intronic
955307324 3:57846844-57846866 CCACCATGCCTAGCCGAAAATGG + Intronic
955693851 3:61616237-61616259 CCACCATGCCCGGCTGAGAATGG + Intronic
956130789 3:66052060-66052082 CCACCATGCCTGGCTGAGCATGG - Intergenic
956191947 3:66616450-66616472 CCACCATGCCCAGCTGAGAGGGG - Intergenic
956495536 3:69822028-69822050 CCACCATGCCCAGCCCAAACTGG + Intronic
956552655 3:70479079-70479101 CCACAAGGCCAGGGTGAAACTGG - Intergenic
957867955 3:86049546-86049568 CCACCGTGCCTGGCCAAGACTGG + Intronic
957919434 3:86729992-86730014 CCACCGTGCCCGGCTGAAAGTGG - Intergenic
958963925 3:100537208-100537230 CCACCATGCCTGGCCAGAATAGG + Intronic
959665101 3:108911816-108911838 CCACCATGCCCGGCCAAAAAGGG - Intronic
959710073 3:109377047-109377069 CCACCATGCCCGGCCTAGACTGG - Intergenic
959983765 3:112549519-112549541 CCACCGCGCCTGGCTGAAACAGG - Intronic
960004050 3:112763914-112763936 CCACCATGCCTGGTCGCCACTGG - Intronic
960110666 3:113841577-113841599 CCACCGTGCCTGGCTGAAGTAGG + Intronic
960119857 3:113936849-113936871 CCACCACACCTGGCTAAAATTGG + Intronic
960453258 3:117837230-117837252 CCACCATGCCTGGCTCAATCAGG - Intergenic
960666911 3:120118314-120118336 CCACCATGCCTGGCCAAAAAGGG - Intergenic
960780076 3:121310754-121310776 CCACCATGCCTGGCTAATTTTGG - Intronic
960813553 3:121649520-121649542 CCACCACGCCTGGCCTAAACAGG + Intronic
960878978 3:122326169-122326191 CCACCACGCCTGGCTGATTTGGG + Intronic
961004461 3:123395585-123395607 CCACCATGCCTGGCTGACATGGG - Intronic
961016307 3:123470896-123470918 CCACCATGCCTGGCTAATCTTGG + Intergenic
961261274 3:125604160-125604182 CCACCATGCCTAGCTGAGATGGG + Intergenic
961715672 3:128855870-128855892 CCACCACAGTTGGCTGAAACTGG - Intergenic
961739394 3:129023479-129023501 CCACCATGCCTGGCTAATTTTGG + Intronic
961886094 3:130097322-130097344 CCACCCTGGCTGTGTGAAACAGG - Intronic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
963642378 3:147876661-147876683 CCACCACACCTGGCTGAAGGTGG - Intergenic
963750391 3:149171990-149172012 CCACCACGCCTGGCCTGAACTGG + Intronic
964124728 3:153224251-153224273 CCACCATGCCTGGCTAATTTTGG + Intergenic
964546370 3:157838806-157838828 CCACTGTGCCTGGCTGTCACTGG - Intergenic
964558652 3:157968468-157968490 CCACCATGCCTGGCTAAGTTTGG - Intergenic
965600002 3:170445217-170445239 CCACCGTGCCTGGCCTGAACTGG - Intronic
965854341 3:173070105-173070127 CCACTACACCTGGCTGAAAGTGG - Intronic
966016652 3:175147780-175147802 CCAACACGCCTGGCCGAAAATGG - Intronic
966184504 3:177215863-177215885 CCACCATGCCTGGCCAGCACTGG - Intergenic
966426958 3:179790059-179790081 CCACCATGCCTGGCCCACAAGGG - Intergenic
966984324 3:185165636-185165658 CCACCACGCCTGGAAGAAACAGG + Intergenic
967356695 3:188579815-188579837 CCATCATGCCTGGCTAATCCTGG - Intronic
967557418 3:190876058-190876080 CCACTGTGCTTGGCTGACACTGG + Intronic
967788530 3:193523013-193523035 CCACCACACCTGGCTGAGAGGGG - Intronic
967798857 3:193632192-193632214 CCACCGTGCCTGGCTGTGATAGG - Intronic
967907703 3:194515375-194515397 CCACCGCGCCTGGCCGGAACTGG + Intergenic
968126216 3:196162447-196162469 CCAACATGCCTGGCTAATTCTGG - Intergenic
968214395 3:196876008-196876030 CCACCATGCCTGGCCAATATTGG + Intronic
968319803 3:197755773-197755795 TCACCATGCCTGGCCGGAAGGGG + Intronic
968401269 4:300173-300195 CCACCATGCCTGGCCACAAATGG - Intronic
968630262 4:1647045-1647067 CCACCATGCCCGGCTTTTACTGG - Intronic
968632254 4:1657924-1657946 CCACCACGCCCGGCTGTAAACGG + Intronic
969118376 4:4888794-4888816 CCTCTATGCCTGGCCGACACTGG + Intergenic
969420622 4:7092833-7092855 CCACCATGCCTGGCTAATTTTGG + Intergenic
969633027 4:8349493-8349515 CCACCACGCCTGGCCAAGACAGG - Intergenic
969700994 4:8767780-8767802 CCACCGTGCCTGGCTGGATGTGG + Intergenic
970197011 4:13561099-13561121 CCACCGTGCCTGGCCGCCACAGG + Intergenic
970578654 4:17452689-17452711 TCATCACGCCTGGCTGAGACTGG - Intergenic
970603651 4:17659771-17659793 CCACCGTGCCTGGCTGCAACAGG + Intronic
971045487 4:22801116-22801138 CCACCATGCCTGGCTAATTTTGG + Intergenic
971105087 4:23515888-23515910 CCACCGTGCCTGGCGTAAAATGG - Intergenic
971316049 4:25569048-25569070 CCACCACACCCGGCTGACACTGG + Intergenic
971320403 4:25600856-25600878 CCACCATGCCTGGCTGGGCAGGG + Intergenic
971333463 4:25701480-25701502 CCACCATGCCCGGCCAACACAGG + Intergenic
971344106 4:25796639-25796661 CCACCATGCCTGGCTAATTTTGG - Intronic
971352571 4:25866215-25866237 CCACCATGCCTGGCCCAAAATGG + Intronic
971453857 4:26825382-26825404 CCACCACGCCTGGCTGATTTAGG + Intergenic
972414500 4:38825082-38825104 CCAACGTGCCTGGCCGAAACTGG + Exonic
972545289 4:40074494-40074516 CCACCACGCCTGGCCTACACAGG + Intronic
972563733 4:40251048-40251070 CCACCACGCCCGGCCGAAGCTGG - Intergenic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG + Intronic
972922840 4:43965502-43965524 CCACCACGCCTGGCCGAAAATGG - Intergenic
973308961 4:48686026-48686048 CCACCATGCCTGGCTGGTCTTGG + Intronic
973556208 4:52085754-52085776 CCACCATGCCTGGCTAATTTGGG - Intronic
973741239 4:53921439-53921461 CCACCACGCCTGGCCTCAACTGG + Intronic
973753052 4:54043132-54043154 CCACCGCGCCTGGCCGAGACAGG - Intronic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
974767200 4:66362165-66362187 CCACCGTGCCTGGCTGTAAATGG + Intergenic
974769266 4:66389535-66389557 CCACCATGCCAGGCTAAGATGGG + Intergenic
974912424 4:68138670-68138692 CCACCATGCCTAGCCCACACTGG + Intergenic
974976571 4:68901337-68901359 CCACCACAGTTGGCTGAAACCGG - Intergenic
975636805 4:76458078-76458100 TCACCACGCCTGGCTGCACCCGG + Intronic
976245185 4:83000179-83000201 CCACCATGCCCAGCCCAAACAGG + Intronic
976258365 4:83122246-83122268 CCACCATGCCTGGCTAATTTTGG + Intronic
976471161 4:85430570-85430592 CCACCATGCCCGCTGGAAACTGG + Intergenic
976707258 4:88032374-88032396 CCATCGTGCCTGGCCGATACTGG - Intronic
977579889 4:98713679-98713701 CCACCATGCCTGGCCGATTAGGG + Intergenic
977813565 4:101386885-101386907 CCACCATGCCTGGCAGTTGCTGG + Intergenic
977822161 4:101485827-101485849 CCACCATGCCTAGCTAAGATGGG + Intronic
977939405 4:102842820-102842842 CCACCACGCCTGGCCAAAACTGG - Intronic
978177001 4:105743944-105743966 CCACCATGCCTCGCCAAAACAGG + Intronic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
978714595 4:111826076-111826098 CCACCATGCCCGGCTAATAGAGG + Intergenic
978785551 4:112605446-112605468 TCACCATGCCTGGCCAAAATAGG + Intronic
978845317 4:113266588-113266610 CCACCATGCCTGGCAGAGATAGG - Intronic
978964399 4:114724168-114724190 CCACCACGCCTGGCCGGAGCAGG + Intergenic
979205115 4:118030178-118030200 CCATCATGCCTGGCTGATTTTGG + Intergenic
979292227 4:118990895-118990917 CCACCATGCCCGGCCTAAGCTGG + Intronic
979715322 4:123830571-123830593 CCACCATGCCTGGCTGTGGTAGG + Intergenic
979935605 4:126690699-126690721 CCACCTTGCCTGGCCGGGACTGG - Intergenic
980762961 4:137260826-137260848 CCACCATGCCTGGCCGAGTGGGG - Intergenic
980796966 4:137697643-137697665 CCACCATGCCCGGCCAAGACTGG + Intergenic
980884346 4:138745992-138746014 CCACTTTGCCTGGCCGACACAGG - Intergenic
981375275 4:144007923-144007945 CCACCATGCCTGGCTTAGAATGG + Intronic
981697757 4:147575708-147575730 CCACCATGTCTGGCTGACACTGG + Intergenic
982052997 4:151522011-151522033 CTACCATGCCTGGCTGATGTTGG + Intronic
982272750 4:153607958-153607980 CCACCATGCCTGGCTACATTTGG - Intronic
982367620 4:154597450-154597472 CCACCATCCCTGGCCCCAACAGG - Intergenic
982543408 4:156704642-156704664 CCACCATGCCTGGCTAATTTGGG - Intergenic
982664610 4:158245990-158246012 CCACCATGCCTGGCTAGAAGGGG - Intronic
982764176 4:159324313-159324335 CCACCATGCCTGGCACCAATAGG + Intronic
982859877 4:160435088-160435110 CCATCCTGCCTGGCTGACACTGG + Intergenic
982920506 4:161267816-161267838 CCACCGTGCCCGGCCGAAAATGG + Intergenic
983169791 4:164522480-164522502 CCACCATGCCTGGCTCTGTCAGG + Intergenic
983567921 4:169174348-169174370 CCATCATGCCAGGCCAAAACTGG + Intronic
983739164 4:171106199-171106221 CCACCATGCCTGGCCAACATAGG + Intergenic
983782783 4:171693389-171693411 CTATCATGCCAGGCTCAAACTGG - Intergenic
983928985 4:173432658-173432680 CCTCCATGCCTGCCTCAGACAGG - Intergenic
984248289 4:177301844-177301866 CAACCATGCCTTCCTGATACAGG - Intergenic
984890344 4:184486473-184486495 CCACCACGCCTGGCCGAGGCAGG - Intergenic
984987297 4:185343929-185343951 CCAACATGCCTGGCTGAGGGTGG - Intronic
985241653 4:187937143-187937165 CCACCTTGCCTGGCCTAAAATGG + Intergenic
986071369 5:4287931-4287953 CCACCATGCCTGGCTGAGCAAGG + Intergenic
986155994 5:5176356-5176378 CCTCCATCCCTGGCTGAAGAAGG - Intronic
986440503 5:7777180-7777202 CCACCTTTCCGGGGTGAAACAGG - Intronic
986683327 5:10253036-10253058 CAACCACGCCCGGCTGAAACTGG - Intronic
986723492 5:10577280-10577302 CCACCATGCCTGGCTAATTTTGG + Intronic
986750993 5:10787801-10787823 CCTCCATGCCTCACTGAAGCAGG + Intergenic
986818597 5:11439959-11439981 CCACCATGCCTGGTCCACACTGG + Intronic
987299535 5:16585224-16585246 CCACCATGCCTTGCTGACCTGGG - Intronic
987735518 5:21838270-21838292 CCACCATGCCTGGCCAGCACTGG - Intronic
987824404 5:23009889-23009911 CCACAGTGCCTGGCTGTAAATGG + Intergenic
987863549 5:23513592-23513614 CCACCATGCCTGGCCCAGAGTGG - Intronic
987882644 5:23769192-23769214 CCACCATGCCCGGCCAAAACAGG + Intergenic
987982072 5:25098375-25098397 CCACCGTGCCCGGCAGAACCAGG + Intergenic
988447339 5:31302433-31302455 CCACCATGCCCGGCCAGAACTGG - Intronic
988462321 5:31451047-31451069 CCACCATGCCTGGCTAATTTTGG - Intronic
988476844 5:31594035-31594057 CCACCACCCCTGGCTAACACTGG - Intergenic
988598363 5:32616356-32616378 CCACCATGCCTGGCTAATTTTGG + Intergenic
988603976 5:32664711-32664733 TCACCATGCCCGGCTGAGACAGG + Intergenic
988612656 5:32741876-32741898 CCACCACGCCTGGCTGAGTTGGG + Intronic
988807144 5:34751002-34751024 CCACCATGCCTGGCTCATTTTGG + Intronic
989309461 5:39997719-39997741 CCACCATGCCTGGCTAATTTTGG - Intergenic
989410945 5:41119848-41119870 CCACCATGCCTGGCCGATTTTGG + Intergenic
989744538 5:44812361-44812383 CCACCATGCATGGCACAAATAGG - Intronic
990246996 5:53873170-53873192 CCACCATGCCTGGCTAATTTTGG + Intergenic
990277717 5:54215780-54215802 CCCCCACCCCTGACTGAAACAGG - Intronic
990319131 5:54612548-54612570 CCACCGTGCCTGGCTGAGGGTGG + Intergenic
990445889 5:55893962-55893984 CCACCATGCCTGGCTGCCTATGG + Intronic
990471789 5:56122504-56122526 CCACCATGCCTGGCTAATTTTGG - Intronic
990516430 5:56534956-56534978 TCACCCTGCCTGCCTGAACCTGG + Intronic
990570303 5:57071764-57071786 CCACCATGCCTGGCTAATTTTGG + Intergenic
991102606 5:62809734-62809756 CCACCGTACCCAGCTGAAACTGG - Intergenic
991953572 5:71970489-71970511 CCACCATGCCTGGCTAATTTTGG + Intergenic
992042946 5:72855146-72855168 CCACCATGCCTGGCTAATTTGGG + Intronic
992055763 5:72987623-72987645 CCACCGTGCCTGGCTGATTAGGG + Intronic
992495597 5:77290294-77290316 CCAGTATGCATGGCTGAAAGAGG + Intronic
993731503 5:91428381-91428403 CCACCATGCCGGGCTTCAAATGG - Intergenic
993948938 5:94149902-94149924 CCACCATGCCTGGCTAATTTTGG + Intergenic
994115229 5:96054404-96054426 CCACCATGCCTGGCTTGTCCTGG + Intergenic
994688200 5:102983156-102983178 CCACCATGCCTGGCCTTACCGGG - Intronic
994755458 5:103789145-103789167 CCACCATGCCCAGCTGAATCTGG + Intergenic
995380186 5:111523106-111523128 CCACCATGCCTGGCTGAGACAGG - Intergenic
995590638 5:113696209-113696231 CCACCATGTCCAGCTGAAAGTGG - Intergenic
996366535 5:122707249-122707271 CCACCATGCCCAGCTGACAAAGG + Intergenic
996547059 5:124691115-124691137 CCACCATACCTGGCTGAGACGGG - Intronic
996624949 5:125559550-125559572 CCAGCAAGACTGGCTGAGACTGG - Intergenic
996965922 5:129306859-129306881 CCAGCCTGCCTGGCTGCAGCAGG + Intergenic
997140560 5:131375949-131375971 CCACCATGCCTGGCCAAGATGGG - Intronic
997150189 5:131485212-131485234 CCACCATGCTTGGCTAGAAGTGG + Intronic
997157144 5:131573145-131573167 GCACCTTGCCAGGCTGAATCAGG + Intronic
997181221 5:131831260-131831282 CCACCATGCCTGGCCAAAAGAGG - Intronic
997261071 5:132465871-132465893 CCACCGTGCCGGGCTGACAGTGG + Intronic
997360607 5:133292318-133292340 CCACCAGGCCTGCCTGGAAGGGG + Intronic
997451515 5:133987388-133987410 CCACCACGCCTGGCTACAAATGG - Intronic
997487536 5:134244029-134244051 CCACCATGCCTGGCTCCACCAGG + Intergenic
997531381 5:134583571-134583593 CCACCATGCCTGGCTGATTTTGG + Intergenic
997802032 5:136873306-136873328 CTACCACGCCTGGCCGAGACAGG - Intergenic
997998014 5:138602185-138602207 CCACCATGCCAGGCTGAGAGTGG + Intergenic
998015309 5:138726846-138726868 CTACCACGCCTGGCTGAGCCTGG + Intronic
998248583 5:140532943-140532965 CCACCATGCCTGGCTAAATTCGG - Intronic
998469031 5:142368964-142368986 CCACCATGCCTGGCTAATTTTGG + Intergenic
999149786 5:149419256-149419278 CCACTGTGCCTGGCTGAATTAGG - Intergenic
999797470 5:155001928-155001950 CCACCGTGCCTGGCCGAAATAGG - Intergenic
999981817 5:156965150-156965172 CCGCCACGCCCGGCTGATACAGG - Intergenic
1000332188 5:160214591-160214613 CCACCATGCCTGGCCTCAAGTGG + Intronic
1001048123 5:168391245-168391267 CCACCAAGCCTGGCTTCAACTGG - Intronic
1001244127 5:170093018-170093040 ACATCCTGCCTGGCTGAAGCAGG - Intergenic
1001326134 5:170726610-170726632 CCACCATGCCTGACTGGAATGGG - Intronic
1001426712 5:171627730-171627752 CCACCATGCCCGGCCTCAACTGG + Intergenic
1001511736 5:172328040-172328062 CCACCACGCCCAGCTGTAACTGG + Intronic
1001552917 5:172617430-172617452 CCACCACGCCTGGCTGAGTTAGG - Intergenic
1001624407 5:173118299-173118321 CCACCATGCCTGGCCCTCACTGG + Intronic
1001921293 5:175602035-175602057 CCACCATGCCTGGCTACCATAGG + Intergenic
1001995104 5:176151133-176151155 CCACCATGCCTGGCTAATTTGGG + Intergenic
1002003120 5:176209676-176209698 CCACCATGCCTGGCATAGACTGG + Intergenic
1002223344 5:177701274-177701296 CCACCATGCCTGGCATAGACTGG - Intergenic
1002351073 5:178584160-178584182 TCACCATGCCTGGCTAAATTTGG + Intronic
1002392630 5:178927822-178927844 CCACCAAGCCTGGCTGAGTCTGG + Intronic
1002514777 5:179749546-179749568 CCACTGTGCCTGGCCGAAAAAGG + Intronic
1003036585 6:2645297-2645319 CCAGCTTGCCTGGCGGGAACTGG - Intergenic
1003207774 6:4029169-4029191 CCACCATGCCTGGCTCCACTTGG + Intronic
1003547232 6:7069706-7069728 CCACCCTGCCTGGCTGAGGTTGG + Intergenic
1003612141 6:7623240-7623262 CCACCATGCCTGGCCGAGCAGGG - Intergenic
1003637866 6:7850293-7850315 CCACCATGCCTGGCTAATTTTGG + Intronic
1003858367 6:10298778-10298800 CCACCATGCCTGGCTGGTTCTGG + Intergenic
1003928813 6:10903259-10903281 CCACCACGCCTGGCCGAGATGGG - Intronic
1004068896 6:12278602-12278624 CCACCATGCCTGGCCCAAGCTGG - Intergenic
1004270170 6:14188216-14188238 CCACCATGCCTGGCTAAGAATGG + Intergenic
1004331370 6:14724992-14725014 CCACCAAGCTTGGCTGAAATTGG - Intergenic
1004363668 6:14993729-14993751 CCACCGTGCCTGGCCGAAGAGGG + Intergenic
1004382424 6:15144035-15144057 CCACCGCGCCTGGCTCATACTGG - Intergenic
1004485839 6:16065645-16065667 CCACCGCGCCTGGCTGAAATTGG + Intergenic
1004503327 6:16227871-16227893 CCACCACAGTTGGCTGAAACTGG - Intergenic
1004532710 6:16468474-16468496 CCACCATGCCTGGCCCGGACTGG + Intronic
1004701059 6:18079894-18079916 CCACCATGCCTGGCCTAAGGAGG + Intergenic
1004993379 6:21163797-21163819 CCACCATGCCTGGCTGATTTTGG - Intronic
1005333119 6:24768088-24768110 CCACCACGCCTGGCCCAAAATGG - Intergenic
1005346744 6:24897910-24897932 CCACCATGCCTGGCTGAGGCAGG + Intronic
1006265876 6:32923076-32923098 CCACCATGCCTGGCCTGAACTGG - Intergenic
1006324538 6:33343599-33343621 CCACCACGCCTGGCCTACACTGG - Intergenic
1006330517 6:33387253-33387275 CCACTATGCCTGGCAGTAATTGG - Intergenic
1006636417 6:35464522-35464544 CCACCGTGCCCGGCCGAGACAGG + Intronic
1006681961 6:35803725-35803747 CCACCATGCCTGGCTATGCCTGG + Intergenic
1006822633 6:36910438-36910460 CCACCATGCCTGGCCAATAAAGG - Intronic
1006850335 6:37093476-37093498 CCACCACCCCTGGCTGGAGCAGG + Intergenic
1006908488 6:37548729-37548751 CCACCATGCCAGGCTGTTTCAGG - Intergenic
1007027493 6:38591895-38591917 CCACCACGCCCGGCTGAACATGG - Intronic
1007074622 6:39058547-39058569 CCACGGTGCCTGGGTGAAACTGG - Intronic
1007145127 6:39621876-39621898 CCACCACGCCTGGCTGAAATAGG - Intronic
1007322488 6:41037707-41037729 CCAGGATGCCTGGTTGAAAAAGG - Intronic
1007516040 6:42412151-42412173 CCACCATGCCTGGCTAATTTTGG + Intronic
1007536489 6:42595456-42595478 CCACCTTGCCTGGCTGAGGAAGG - Intronic
1007714084 6:43844333-43844355 CCACCATGCCTGGCCTCAATAGG + Intergenic
1007727886 6:43927648-43927670 CCACCAGGCCTTGCTACAACTGG + Intergenic
1007757192 6:44107496-44107518 CCACCGTGCCTGGCTGAGATGGG - Intergenic
1007932761 6:45707346-45707368 CTACAAAGCCTGTCTGAAACAGG - Intergenic
1008901994 6:56630933-56630955 CCACCATGCCTGGCTAACTTTGG + Intronic
1008925368 6:56886486-56886508 CCACCATGCCTGGCTGTTTCAGG - Intronic
1009386931 6:63096308-63096330 CCACCATGCCTGGCCCATATGGG - Intergenic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010218563 6:73427586-73427608 CCACCATGCCTGGCCAATACTGG + Intronic
1011102208 6:83735321-83735343 CCACCGCGCCTGGCCTAAACTGG + Intergenic
1011287004 6:85735570-85735592 CCACCATGCCTAGCCAATACTGG + Intergenic
1011406119 6:87017392-87017414 CCACCACGCCCGGCTGCAACTGG - Intergenic
1011425692 6:87226965-87226987 CCACCATGCCTGGCTTTAATGGG + Intronic
1011615595 6:89195171-89195193 CCACCATGCCCGGCCCAAATTGG - Intronic
1011630648 6:89320751-89320773 CCACCATGCCTGGCCTCAATAGG - Intergenic
1011662503 6:89606566-89606588 CCACCATGCCAGGCCAAAAAAGG - Intronic
1011667300 6:89647072-89647094 CCACCATGCCTAGATGATACAGG + Intronic
1011690435 6:89862017-89862039 CTACCATGCCTGGCCAAAGCTGG + Intronic
1011778180 6:90755863-90755885 CCACCATGCCTGGCTAATTTTGG + Intergenic
1012020177 6:93908209-93908231 CCACTGTGCCTGGCTGAAATAGG - Intergenic
1012309209 6:97700410-97700432 CCACCATGCCCGGCTGCATGTGG - Intergenic
1013120391 6:107135600-107135622 CCACCATGCCCGGCTAAAACAGG + Intergenic
1013332912 6:109123779-109123801 CCACCATGCCTGGCCAGAAGTGG - Intronic
1013604827 6:111738252-111738274 GAACCATGCCTACCTGAAACAGG + Intronic
1013779578 6:113715165-113715187 CCACCACGCCTGGCTTAACCAGG - Intergenic
1013948553 6:115751902-115751924 CCACCACTCCTGGCTGGACCCGG + Intergenic
1014111954 6:117628285-117628307 CCACCATGCCTGGCCTACATAGG - Intergenic
1014530785 6:122556924-122556946 CCACCACGCCCGGCTGAGCCTGG - Intronic
1014848200 6:126306416-126306438 CCACCATGCCTGGCCAAAGCTGG - Intergenic
1014981649 6:127952555-127952577 CCACCACGCCTGGCCTAAAGTGG - Intergenic
1014995208 6:128134656-128134678 CCACCATGCCTGGCTAATGTTGG - Intronic
1015047521 6:128794179-128794201 CCACCATGCCTGGCTCATCCCGG - Intergenic
1015177250 6:130323513-130323535 CCACCATGCCTGGCCTGGACAGG - Intronic
1015194975 6:130515821-130515843 CCACCATGCCAGGCCAAAAATGG - Intergenic
1015279583 6:131418913-131418935 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1015344417 6:132139026-132139048 CCACCATGACTGGCCAATACGGG - Intergenic
1016158589 6:140846151-140846173 CCACCATGCCTGGCTAATGTTGG - Intergenic
1016470837 6:144372645-144372667 CCACCATGCCTGGCTAATTTTGG + Intronic
1016832719 6:148449355-148449377 TCACCGTACCTGGCTGAGACTGG + Intronic
1016954069 6:149609515-149609537 CCACCATGCCTGGCCGAGACAGG - Intronic
1016960591 6:149669108-149669130 CCACCATACCTGGCTGGATAAGG + Intronic
1016960639 6:149669418-149669440 CCACCGTGCCTGGCTGGATGAGG + Intronic
1016967859 6:149735342-149735364 CCAATGTGCCTGGCTTAAACTGG + Intronic
1017026245 6:150183791-150183813 CCACCGTGCCCGGCCCAAACTGG + Intronic
1017193051 6:151673593-151673615 CCACCATGCCTGGCTTAATTTGG - Intronic
1017509587 6:155102147-155102169 CCACCATGCCTGGCTAATTTTGG + Intronic
1017525188 6:155236373-155236395 CCACCATGCCTGGCTGTCATGGG - Intronic
1017566716 6:155695051-155695073 CCACCACGCCTGGCTTCAAAAGG - Intergenic
1017849813 6:158295600-158295622 CCACCATGCCTGGCCAATGCTGG - Intronic
1017999599 6:159567409-159567431 CCACCATGCCTGGCTGTACCAGG + Intergenic
1018050397 6:160004420-160004442 CCACCATGCCAGGCTGCACCAGG - Intronic
1018193062 6:161327833-161327855 CCACCATGCCTGGCTAACTTTGG + Intergenic
1018198044 6:161371924-161371946 CCACCATGCCTGGCCCAGAAGGG + Intronic
1018221146 6:161580912-161580934 CCACCATGTCTGGATGATAGAGG - Intronic
1018554072 6:165032815-165032837 CCACCATGCCTGGCTGAGGCTGG - Intergenic
1019021711 6:168924090-168924112 CCACCATGCCCGGCCAAGACAGG + Intergenic
1019680793 7:2347927-2347949 CCACCACGCCTGGCCCACACTGG + Intronic
1019765503 7:2846819-2846841 CCACCATGCCTGGCTCATTTTGG - Intergenic
1019898264 7:3999864-3999886 GCATCATTCCTGGCTGAAAAGGG + Intronic
1020062928 7:5166157-5166179 CCACCATGCCTGGCTAATTTTGG + Intergenic
1020084267 7:5302236-5302258 CCACCATACCTGGCTGAGACTGG + Intronic
1020198966 7:6064376-6064398 CCACCATGCCTGGCCGCCTCAGG + Intergenic
1020232757 7:6332528-6332550 CCACCACGCCTGGCTGAGGGTGG - Intronic
1020283116 7:6661040-6661062 CCACCATGCCTGGCTAATTTTGG - Intergenic
1020724917 7:11800259-11800281 CCACCGCGCCTGGCTCAAATAGG - Intronic
1020936590 7:14473250-14473272 GCACCATCCATGGCTGAAAGGGG + Intronic
1021272400 7:18605965-18605987 CCACCATGCCTGGCTGCCCCTGG + Intronic
1021470412 7:20996166-20996188 CCACAGCGCCTGGCTGAGACTGG + Intergenic
1022123818 7:27336540-27336562 CCACTGTGCCTGGCTAAAGCAGG - Intergenic
1022165989 7:27762797-27762819 CCACCATGCCTGGCTAATTTTGG - Intronic
1022252204 7:28619547-28619569 CCACCATGCCTAGCTCAAGAAGG - Intronic
1022255055 7:28647791-28647813 CCACTATGCCTGGCCCAAATTGG - Intronic
1023430643 7:40087428-40087450 CCACTGTGCCTGGCTGGAAATGG + Intronic
1023580523 7:41677497-41677519 CCACCATGCCTGGCCCCCACCGG - Intergenic
1023774863 7:43595561-43595583 GCACCATGCCTGGCTTCAACTGG + Intronic
1023927450 7:44680057-44680079 CCACCATGCCTGGCTAATTTTGG - Intronic
1024083387 7:45874070-45874092 CCACCATGCCTGGCTAATTTTGG + Intergenic
1024333610 7:48180712-48180734 CCACCATGCGTGGCCGATGCTGG + Intronic
1024990224 7:55228722-55228744 CCACCATGCCCAGCTGGAGCTGG - Intronic
1025065288 7:55849456-55849478 CCACCATGCCTGGCTGTTTTGGG - Intronic
1025100071 7:56127081-56127103 CCACCATGCCTGGCTAATTTTGG - Intergenic
1025188498 7:56879236-56879258 CCACCATGCCTGGCCAGAAAAGG + Intergenic
1025210022 7:57014961-57014983 CCACCACACCTGGCTGAGACTGG - Intergenic
1025661929 7:63561890-63561912 CCACCACACCTGGCTGAGACTGG + Intergenic
1025683431 7:63697684-63697706 CCACCATGCCTGGCCAGAAAAGG - Intergenic
1025774203 7:64544969-64544991 CCACCATGCCTGGCCAACACAGG - Intronic
1025998686 7:66544561-66544583 CCACTGTGCCTGGCTGTAGCTGG - Intergenic
1026039603 7:66856577-66856599 CCACCGTGCCTGGCCAAGACAGG + Intergenic
1026125873 7:67579055-67579077 CCATCATGCCCGGCCAAAACTGG - Intergenic
1026320927 7:69267038-69267060 CCACCATGCCCGGCTTATATTGG + Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026781135 7:73268262-73268284 CCACCATGCCTGGCTAACTTTGG + Intergenic
1026856602 7:73759139-73759161 CCACCGTGCCTGGCTGTCCCTGG - Intergenic
1026944960 7:74309909-74309931 CCACCATGCCTGGCCCAAAGTGG - Intronic
1026991642 7:74589408-74589430 CCACTGTGCCTGGCTGCAGCTGG - Intronic
1027003177 7:74668857-74668879 CCACCGTGCCTGGCTAAGAAGGG + Intronic
1027021988 7:74821704-74821726 CCACCATGCCTGGCTAACTTTGG + Intronic
1027059230 7:75072690-75072712 CCACTGTGCCTGGCTGAAAGAGG - Intronic
1027066033 7:75124213-75124235 CCACCATGCCTGGCTAACTTTGG - Intronic
1027129706 7:75582200-75582222 CCACCACGCCCGGCTGAGAGAGG - Intronic
1027146097 7:75695860-75695882 CCACCGTGCCTGGCTGGTACTGG + Intronic
1027165868 7:75833973-75833995 CCACCACACCCGGCTGACACAGG - Intergenic
1027174293 7:75893493-75893515 CCACCATGCCTGGCTAATTTAGG + Intergenic
1027227629 7:76254306-76254328 CCACTGTGCCTGGCTGAACTGGG + Intronic
1027372506 7:77521084-77521106 CCACCACGCCTGGCCAAAAATGG + Intergenic
1028051380 7:86192055-86192077 CCACCGCGCCCGGCTGAAAATGG + Intergenic
1028153444 7:87402712-87402734 CCACCTTGCCCGGCTGATAGTGG - Intronic
1028277836 7:88879749-88879771 CCACCATGCCTGCCTTCAAGTGG - Intronic
1028515404 7:91672765-91672787 CTACCATGCCTGGCCCAGACTGG - Intergenic
1029008955 7:97238645-97238667 CCACCGTGTCTGGCTGGAGCTGG + Intergenic
1029331645 7:99861159-99861181 CCACCATGCCTGGCCTAAACAGG + Intronic
1029406391 7:100376631-100376653 CCATCATGCCAGGCTAACACAGG + Intronic
1029472664 7:100764340-100764362 CCACCATGCCTGGCTAATTTTGG - Intronic
1029610004 7:101621871-101621893 CCACCATGCCTGGCCAAGGCAGG + Intronic
1029626188 7:101721717-101721739 CCACCGTGCCTGGCACAAACCGG - Intergenic
1029639294 7:101808818-101808840 CCACCATGCCAGGCCCACACAGG + Intergenic
1029865035 7:103618963-103618985 CCACCATGCCTGGCTAATTTTGG - Intronic
1030208707 7:106975416-106975438 TCACCATGCCTGGCTGAGCAGGG + Intergenic
1030259175 7:107544233-107544255 CCACAATGCCTGGCTTTCACTGG - Intronic
1030308502 7:108044798-108044820 CCACCATGCCTGGCTAATTTTGG - Intronic
1030490695 7:110230352-110230374 CCACCATGCATGTCTGTATCTGG + Intergenic
1030829521 7:114203629-114203651 CCACCATGCCTGGCAGCACCTGG + Intronic
1032025342 7:128437205-128437227 CGACCATGCCCGGCTACAACTGG + Intergenic
1032040793 7:128558902-128558924 CCACCATGCCTGGCTAATTTTGG + Intergenic
1032287775 7:130555537-130555559 CCACCGTGCCTGGCTGACACTGG - Intronic
1032599391 7:133277112-133277134 CCACCACGCCTGGCTATAACTGG + Intronic
1032626145 7:133593032-133593054 CCACCGTGCCTGGCCTAAATTGG + Intronic
1032783796 7:135185020-135185042 CCACCATGCCTGGCTAATTTTGG + Exonic
1033073632 7:138227816-138227838 CCACCATGCCTGGCTAAGAAAGG - Intergenic
1033160009 7:138987127-138987149 CCACCACGCCTGGCCAAAAAAGG - Intergenic
1033194470 7:139315768-139315790 CCTCCATGCCTGGCCGGAACTGG - Intergenic
1033312084 7:140268780-140268802 CCACCATGCCAGGCCTAGACTGG - Intergenic
1033434360 7:141319688-141319710 CCACCATGCCTGGCTAATTTTGG + Intronic
1033786703 7:144740431-144740453 CCACCATGCCTGGCCTCTACTGG - Intronic
1033920551 7:146386539-146386561 CCACCATGCCTGGCTAATTTTGG + Intronic
1034145428 7:148867037-148867059 CCACCACGCCTGGCCAAGACTGG - Intronic
1034152810 7:148929951-148929973 GCACGGTGCCTGGCTGAGACAGG - Intergenic
1034510908 7:151533866-151533888 CCACCGTGCCAGGCTGAGACAGG + Intergenic
1034572473 7:151968006-151968028 CCACCATGCCTGGCAAAACTAGG - Intronic
1034904286 7:154930192-154930214 CCACCATGCCTGGCTGAAATTGG + Intronic
1034937971 7:155211936-155211958 CCACCATGCAGGGCTGGGACAGG + Intergenic
1034947873 7:155275426-155275448 CCACCATACCTGGCACAAAAAGG - Intergenic
1035054120 7:156022601-156022623 CCACCGTGCCCGGCCGAGACTGG + Intergenic
1035183629 7:157108864-157108886 CCACCTTGACTGGCAGCAACTGG + Intergenic
1035296274 7:157868443-157868465 AAACCATGCCTGGAGGAAACTGG + Intronic
1035422053 7:158737977-158737999 CCACCATGACTGGCCTAATCAGG - Intronic
1035471876 7:159115559-159115581 CAGGCAAGCCTGGCTGAAACAGG + Intronic
1035960287 8:4128921-4128943 CCACCATGCCCGGCTAAAACAGG - Intronic
1036065835 8:5380476-5380498 CCACCATGCCTGCCATCAACAGG - Intergenic
1036130171 8:6102616-6102638 CCACCACACCCGGCCGAAACTGG + Intergenic
1036439578 8:8768615-8768637 CCACCATGCCTGGCCTATTCTGG + Intergenic
1036721894 8:11183516-11183538 CCACCATGCTGGGCTCAAGCTGG + Intronic
1037017650 8:13928570-13928592 CCACCATGTCTGGCTGATTCTGG - Intergenic
1037574884 8:20192514-20192536 CCACCATGCCTGGCTGTGTCAGG - Intergenic
1037688637 8:21164601-21164623 CCCCCAAGACTGGCAGAAACTGG - Intergenic
1037728714 8:21505771-21505793 CCACCATGCCTGGCTAATTTTGG - Intergenic
1038503639 8:28065445-28065467 CCACCGCGCCTGGCCGAAATTGG + Intronic
1038714249 8:29977603-29977625 CCACCATGCCTGGCTAATTTTGG - Intergenic
1038827634 8:31022121-31022143 CCACCATGCCTGGCTAATTTTGG + Intronic
1038989547 8:32853052-32853074 CCTCCATGACTGGCTCAAAAGGG + Intergenic
1039450690 8:37672736-37672758 TCACCATGCCTGGCTGACCCAGG - Intergenic
1039681487 8:39742456-39742478 CCACCACGCCCGGCTGAGGCTGG - Intergenic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1039814383 8:41080158-41080180 CCACCGTGCCTGGCCGCAAGAGG - Intergenic
1039960136 8:42239924-42239946 CCACCGTGCCTGGCCGTAAAAGG + Intergenic
1040025772 8:42780751-42780773 CCACCATGCCTGGCTAATTTTGG + Intronic
1040349819 8:46553383-46553405 CCACCATGCCTGGCTCCAGTTGG - Intergenic
1040432292 8:47355241-47355263 CCACCATGCCTGGCCGATGAAGG + Intronic
1040445726 8:47491694-47491716 CCACCATGCCAAGCTAATACTGG - Intronic
1040870216 8:52092851-52092873 CCACCATGCCTGGCCGAGATAGG + Intergenic
1041158313 8:55010724-55010746 CCACCATGCCTAGTTGAATGTGG + Intergenic
1041284762 8:56249046-56249068 CCACCATGCCCGGCCGAGAATGG - Intergenic
1041675101 8:60530431-60530453 CCCCCATGCCTGGCTGCTCCTGG + Intronic
1042134980 8:65624209-65624231 CCACCATGCCTAGCAAAAAAAGG - Intronic
1042410388 8:68459516-68459538 CCACCGTGCCCGGCTGAAAAGGG + Intronic
1042544072 8:69935254-69935276 CCACCATGCCTGCCTGATTTTGG + Intergenic
1042900279 8:73719114-73719136 CCACCACACCTGGCCAAAACTGG - Intronic
1043596855 8:81897554-81897576 CCACCATGCCTGGCTAATTTTGG - Intergenic
1043613287 8:82092569-82092591 CCACCATGCCTGGCCTGAATGGG - Intergenic
1043793861 8:84510521-84510543 CCACCGTGCCTGGCTGAAGCTGG - Intronic
1044239036 8:89867369-89867391 CCACCACGCCCGGCTAAAAATGG - Intergenic
1044679995 8:94767577-94767599 CCACCTTGCCTGGCTCAACGAGG + Intronic
1045031989 8:98145751-98145773 CCACCATGCCTGGCTAATTTTGG - Intronic
1045213912 8:100127933-100127955 CCACCATGCCTGGCCTAAGCCGG + Intronic
1045459575 8:102413761-102413783 CCACCACGCCTGGCCGAGATAGG + Intergenic
1045610505 8:103835386-103835408 CCACCGTGCCTGGCCAAGACTGG + Intronic
1045911804 8:107418783-107418805 CCACCATGGCTGGCCCCAACTGG - Intronic
1046175761 8:110573021-110573043 CCACCATGCCTGGTAGAGATGGG - Intergenic
1046537909 8:115539703-115539725 CCACCATGCCTGGCTAATTTTGG - Intronic
1046560203 8:115827000-115827022 CCACCATGCCTGGCTAATTTGGG + Intergenic
1047092476 8:121589229-121589251 CCACCATGCCCAGCCTAAACAGG - Intergenic
1047407554 8:124597984-124598006 CCATCATGCCTGGCCCAAAATGG - Intronic
1047487582 8:125345866-125345888 CCACCATGCCTGGCTGACCATGG - Intronic
1048351110 8:133617293-133617315 CCACCACGCCTGGCTGCTCCTGG + Intergenic
1048362382 8:133709080-133709102 CCACCATGCCCAGCTGAAGAAGG + Intergenic
1048854272 8:138673360-138673382 CCACCATGCCTGGCTAACTTTGG + Intronic
1048884821 8:138901652-138901674 CCACCATGCCTGGCCTTTACTGG + Intronic
1048942426 8:139413255-139413277 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
1049037312 8:140086632-140086654 CCACCACGCCTGGCCGAGAGAGG - Intronic
1049246043 8:141563142-141563164 CCCCCATGCCTGCCTGCAGCCGG - Intergenic
1049364394 8:142229830-142229852 CACCCATGCCTGGCTGACTCTGG - Intronic
1049432527 8:142571870-142571892 CCACCATGCCCAGCTCAAACAGG + Intergenic
1049695145 8:143980032-143980054 CCACCGCGCCCGGCTGAGACGGG - Intronic
1050152429 9:2630079-2630101 CCACCGTGCCTGGCCCAAACTGG + Intronic
1050433321 9:5584167-5584189 CCACCATGCCCAGCCCAAACTGG - Intergenic
1050958357 9:11693872-11693894 CCACCATGCCTGGCTAATTTTGG + Intergenic
1051270205 9:15348159-15348181 CCACCACACCCGGCTAAAACAGG - Intergenic
1051356166 9:16241358-16241380 GCTCCATGCCTGGCTGATTCAGG - Intronic
1051431109 9:16981474-16981496 CCACCATGCCCAGCTGAAAAGGG - Intergenic
1051504617 9:17813589-17813611 CCACCATGCCTGGCCAGGACAGG - Intergenic
1051640447 9:19220039-19220061 CCACCATGCCTGGCTAATTTTGG - Intergenic
1051754981 9:20389485-20389507 CCACCATGCCTGGTCTAAAGTGG - Intronic
1051970597 9:22882083-22882105 CCACCATCCCTGGCCCAAACTGG + Intergenic
1052310061 9:27057568-27057590 CCACCGTGCCTGGCCAAAAGAGG - Intronic
1052404570 9:28043282-28043304 ACACAATGGCTGTCTGAAACAGG - Intronic
1052660333 9:31420590-31420612 CCACCATGCCTGGCTAATTTTGG - Intergenic
1052967357 9:34350409-34350431 CCAACATGGCTGTCTGAAATTGG + Intergenic
1053318188 9:37070861-37070883 CCACCATGCCTGGCCTGCACTGG + Intergenic
1053326125 9:37153321-37153343 CCACCATGCCTGGCTAATTTTGG + Intronic
1053328094 9:37175414-37175436 CCACCACGCCTGGCCTAAAATGG - Intronic
1053549665 9:39062671-39062693 CCACCGCGCCCGGCTGAAAAAGG + Intergenic
1053583950 9:39436683-39436705 CCACCATGCCTATCTGAGCCTGG + Intergenic
1053789718 9:41678276-41678298 CCACCACACCTGGCTAACACCGG - Intergenic
1054105531 9:60995427-60995449 CCACCATGCCTATCTGAGCCTGG + Intergenic
1054155426 9:61636477-61636499 CCACCACACCTGGCTAACACCGG + Intergenic
1054178056 9:61889966-61889988 CCACCACACCTGGCTAACACCGG - Intergenic
1054475212 9:65567588-65567610 CCACCACACCTGGCTAACACCGG + Intergenic
1054659473 9:67690858-67690880 CCACCACACCTGGCTAACACCGG + Intergenic
1054895991 9:70311968-70311990 CCACCATGCTAGGCTAATACAGG - Intronic
1055061822 9:72076749-72076771 CCCCCATGCCTGGCTGATGATGG - Intergenic
1055383673 9:75737570-75737592 CCACCATGCCAGGCCAAGACTGG + Intergenic
1055710064 9:79050951-79050973 CCACCATGCCTGGCTAATTTTGG + Intergenic
1055955836 9:81772883-81772905 CCACCACGCCTGGCCGTAATTGG + Intergenic
1056180835 9:84080628-84080650 CCACCACGCTGGGCTGGAACTGG + Intergenic
1056378666 9:86037865-86037887 CCACCACGCCTGGCTGGGGCAGG - Intronic
1056514002 9:87333129-87333151 CCACCATGCCTGACTTCTACAGG - Intergenic
1056983188 9:91336342-91336364 CCACCATGCCTGGCCAATCCAGG - Intronic
1057089131 9:92240414-92240436 CCACCATGCCTGGCTAATTTTGG + Intronic
1057345067 9:94242960-94242982 CCACCGTGCCTGGTTGGAACGGG - Intergenic
1057525742 9:95798955-95798977 CCACCTTGCCTGGCCCCAACTGG - Intergenic
1057613773 9:96569873-96569895 CCACCGCGCCTGGCCGAAACAGG + Intronic
1057851778 9:98571711-98571733 ACAGCAGGCCTGGCTGAAACTGG + Intronic
1057995207 9:99816728-99816750 CCACCATGCCTGGCTGGAATAGG - Intergenic
1058145422 9:101405786-101405808 CCACCGTGCCTGGCCTAAAATGG - Intronic
1058255662 9:102759651-102759673 CCACCATGCCTGGCCCAATGTGG - Intergenic
1058345464 9:103955729-103955751 CCACCACGCCTGGCTGGATGGGG + Intergenic
1058697123 9:107568809-107568831 CCACCATGCCTGGCCAAGTCTGG + Intergenic
1058705093 9:107631279-107631301 CCACCACGCCTGGCTGGAGAGGG + Intergenic
1058847359 9:108974544-108974566 CCATCATGCCTGGCTGAAATTGG - Intronic
1059467761 9:114479773-114479795 CCACCACGCCCGGCTGAGAAAGG - Intronic
1059487550 9:114638327-114638349 CCACCATGCCTGGTTATAAAAGG + Intronic
1060107612 9:120883469-120883491 CCACCGTGCCCGGCTGGACCGGG - Intronic
1060403646 9:123362259-123362281 ACTCCATCCCTGGGTGAAACTGG - Intronic
1060613003 9:124985578-124985600 CCACCGTGCCCAGCTGAAATTGG - Intronic
1060664521 9:125424775-125424797 CCACCATGCCCGGCAAAGACAGG + Intergenic
1060920367 9:127416517-127416539 CCACCACGCCCGGCTGGCACAGG - Intergenic
1060945066 9:127565639-127565661 CCACCATGCTTGGCTGATTTTGG - Intronic
1061094475 9:128447294-128447316 CCACCACGCCTGGCCTAAAAAGG - Intergenic
1061240937 9:129371935-129371957 CCACCATGCCCGGCCGATAGAGG - Intergenic
1061250002 9:129421023-129421045 CCACCACTGCTGGCTGTAACTGG + Intergenic
1061407678 9:130401608-130401630 CCACCATGCCTGGCCTAACATGG + Intronic
1061675864 9:132215291-132215313 CCACCATGCCTGGCCCCCACTGG - Intronic
1061910934 9:133723473-133723495 CCACCATGCCTGGCAGAAGAAGG - Intronic
1061990619 9:134156817-134156839 CCAGCATGCCTGGCAGAACAGGG - Intronic
1062072343 9:134563388-134563410 CCACCATGCCTGGCTACACTGGG + Intergenic
1062246199 9:135567727-135567749 CCCCCATGCCTGGGTTAAAATGG - Intergenic
1062289189 9:135786969-135786991 CCAGCAGGCCTGGCTGCAGCTGG - Intronic
1185492998 X:533347-533369 CCGCCATGCCCGGCCGAAATTGG + Intergenic
1185691142 X:2156118-2156140 CCACCATGCCTGGCCTCAAGGGG - Intergenic
1185714971 X:2334315-2334337 CCACCATGCCTGGCTAATATTGG + Intronic
1185740524 X:2528280-2528302 CCACCATGCCTGGCCAAGACTGG + Intergenic
1186361727 X:8849472-8849494 CCACCATGTCTGGCTTAATGTGG + Intergenic
1186880922 X:13865442-13865464 CCACCGTGCCTGGCTGAGAATGG - Intronic
1187294939 X:17989860-17989882 CCACCATGCCTGGCTTATGGTGG + Intergenic
1187343004 X:18438349-18438371 CCACCATGCCTGGCCTGAAGAGG + Intronic
1187379257 X:18785593-18785615 CTACCATGCCTGGCTGCAACTGG - Intronic
1187587458 X:20679268-20679290 CCACCATGCCTGGCCTCAATTGG + Intergenic
1187871891 X:23771456-23771478 CCACCGTACCCGGCTGAGACAGG - Intergenic
1188223937 X:27574119-27574141 CCACCATGCCTGGCTTCAGTGGG + Intergenic
1188315269 X:28665776-28665798 CCACCATGCCCGGCTATAAGTGG + Intronic
1188592615 X:31857089-31857111 CCACCATGCCTGGCCAAGATTGG - Intronic
1188685162 X:33060543-33060565 CCACCACGCCTGGTCGAGACTGG - Intronic
1189223103 X:39389514-39389536 CCACCATACCTGGTGGAAAGAGG - Intergenic
1189345420 X:40237516-40237538 CCACCATGCCTGGCTAAAAGTGG + Intergenic
1189481931 X:41398657-41398679 CCACTGTGCCTGGCTGAAAATGG + Intergenic
1189541564 X:41996668-41996690 CCACCATGCCTGGCTAATTTTGG + Intergenic
1189827414 X:44933728-44933750 CCACCATGCCTGGCTAATTCTGG + Intronic
1189903768 X:45736165-45736187 CCACCATGCCTGGCCGAGTCAGG - Intergenic
1190085610 X:47392866-47392888 CCACCATGCCCGGCCTCAACAGG - Intronic
1190086787 X:47402022-47402044 CCACCATGCCTGACCGAGAACGG + Intronic
1190168323 X:48091730-48091752 CCACCATGCCTGGCCCAAGATGG - Intergenic
1190168920 X:48095955-48095977 CCACCATGCCTGGCCCAAGATGG + Intergenic
1190549266 X:51562486-51562508 CCACCGTGCCTGGCCTAAAATGG - Intergenic
1190692817 X:52926053-52926075 CCACCACGCCTGGCAAAACCTGG + Intergenic
1191776933 X:64824585-64824607 CCACTGTGCATGGCTGAAATTGG - Intergenic
1192259736 X:69498076-69498098 CCACCATGCCTGGCCCACACTGG - Intergenic
1192431577 X:71115994-71116016 CCACCATGCCTGGCCCACTCTGG + Intergenic
1193186847 X:78523430-78523452 CCACCACGCCCGGCACAAACAGG - Intergenic
1194489671 X:94530691-94530713 CCAGCATCCCTGGCTCCAACAGG - Intergenic
1194671991 X:96745157-96745179 CCACCATGCCTGGCTAATTTTGG + Intronic
1195004148 X:100670057-100670079 CCACCATGCCTGGCCGCAAAAGG + Intronic
1195264117 X:103163800-103163822 CCACCGCGCCTGGCCGAATCTGG - Intergenic
1195865193 X:109425052-109425074 CCACCATGCCCAGCTGAACAGGG + Intronic
1196742287 X:119035833-119035855 CCACCATGCCTGGCTAATTTTGG - Intergenic
1196781944 X:119391583-119391605 CCACCGTGCCTGGCCAAGACTGG - Intergenic
1196804365 X:119571509-119571531 CCACCATGCCTGGCCTCAAAAGG + Intergenic
1196902278 X:120397084-120397106 CCACCATGCCTGGTTGAGTTTGG - Intergenic
1197046886 X:122008355-122008377 CCACCATGCCTAGCTAGGACAGG + Intergenic
1197166602 X:123384335-123384357 CCACCACGCCTGGCCGAAAAGGG - Intronic
1197200896 X:123747665-123747687 CCACCATGCCTGGCCATAAAAGG + Intergenic
1197296370 X:124723884-124723906 CAACCATGCCCGGCCGAAGCTGG + Intronic
1197659320 X:129152613-129152635 CCACCATGCCTGGCCTAGAATGG + Intergenic
1198117742 X:133560449-133560471 CCACCATGCCCGGCCAAAATAGG - Intronic
1198227654 X:134660391-134660413 CCACCATGCCTGGCCGAAAGAGG + Intronic
1198257589 X:134938017-134938039 CCACCATGCCCGGCTAATTCGGG + Intergenic
1198532403 X:137559573-137559595 CCACCATGCCTGGCCCACCCTGG + Intergenic
1198558904 X:137826882-137826904 CCATCATGCCTGGCTTCTACTGG - Intergenic
1198617926 X:138479103-138479125 CCACCATGCCTGGCTAATTTTGG + Intergenic
1199315991 X:146378899-146378921 AGACCATGCCTGGCAGAAAATGG + Intergenic
1199746712 X:150776285-150776307 CCACCATGCCTGCGTGAAGAAGG + Exonic
1199751460 X:150823571-150823593 CCACCACGCCCAGCTGAAACTGG + Intronic
1199992465 X:152995048-152995070 CCACCACACCTGGCTGAAGAAGG - Intergenic
1200064629 X:153498540-153498562 CCACCCTGGCTGGCTGAAGGAGG + Intronic
1200238306 X:154479737-154479759 CCACTTTGCCTGGCCTAAACTGG - Intergenic
1200762314 Y:7051212-7051234 CCACCACACCTGGCTGGAAAAGG - Intronic
1200797512 Y:7354857-7354879 CCACTGTGCCTGGCAGAAAAGGG - Intergenic
1201294313 Y:12450658-12450680 CCACCATGCCCGGCCAAAAGTGG + Intergenic
1201860307 Y:18590558-18590580 CCATCATGGTTTGCTGAAACAGG - Intergenic
1201873016 Y:18729823-18729845 CCATCATGGTTTGCTGAAACAGG + Intergenic