ID: 1135669203

View in Genome Browser
Species Human (GRCh38)
Location 16:24360785-24360807
Sequence GTCAACAGTCTTTCATCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1135669198_1135669203 29 Left 1135669198 16:24360733-24360755 CCAAGTTAGAACCCTAGTAAGTC 0: 1
1: 0
2: 0
3: 10
4: 66
Right 1135669203 16:24360785-24360807 GTCAACAGTCTTTCATCTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 117
1135669201_1135669203 -4 Left 1135669201 16:24360766-24360788 CCTTCTCTCACATGCCATCGTCA 0: 1
1: 0
2: 0
3: 9
4: 147
Right 1135669203 16:24360785-24360807 GTCAACAGTCTTTCATCTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 117
1135669200_1135669203 17 Left 1135669200 16:24360745-24360767 CCTAGTAAGTCATTCTCAATGCC 0: 1
1: 0
2: 1
3: 7
4: 119
Right 1135669203 16:24360785-24360807 GTCAACAGTCTTTCATCTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 117
1135669199_1135669203 18 Left 1135669199 16:24360744-24360766 CCCTAGTAAGTCATTCTCAATGC 0: 1
1: 0
2: 1
3: 9
4: 116
Right 1135669203 16:24360785-24360807 GTCAACAGTCTTTCATCTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1135669203 Original CRISPR GTCAACAGTCTTTCATCTCC TGG Intronic
905390291 1:37632049-37632071 GTCCAAAGTCTTTCAGATCCAGG - Intronic
908056566 1:60293418-60293440 ATCATCATTCTTTCCTCTCCTGG - Intergenic
919388319 1:196949828-196949850 GTCAACTGTCTTGCATTACCCGG + Intronic
920264351 1:204710775-204710797 GTCAACAGGCTTTAAACTACAGG + Intergenic
923752675 1:236760764-236760786 GTCAGAAGTCTTTCCTCTCTGGG - Intronic
1064411747 10:15111119-15111141 GTCAAGATGGTTTCATCTCCAGG + Intronic
1069757429 10:70781838-70781860 GTCACCACTCCTTCTTCTCCCGG - Exonic
1070404285 10:76080906-76080928 GTCAGCAGTCTCTCCTCTCTAGG + Intronic
1070551006 10:77490794-77490816 ACTCACAGTCTTTCATCTCCAGG + Intronic
1070563003 10:77581938-77581960 GTCATCGGTCTCTGATCTCCTGG + Intronic
1073477433 10:103763491-103763513 CTTAACAGTCTTTCAACCCCAGG - Intronic
1074526848 10:114270125-114270147 GCCAATACTCTTTCCTCTCCAGG - Intronic
1075721370 10:124589549-124589571 GTCAACAGTCCTGCTCCTCCCGG - Intronic
1079841409 11:25404770-25404792 TTCATCTGTCTTTCATCTTCAGG - Intergenic
1079841478 11:25406086-25406108 TTCATCTGTCTTTCATCTTCAGG + Intergenic
1080135394 11:28848291-28848313 TACAACAGTCTTTCTTCTACTGG - Intergenic
1083855397 11:65390665-65390687 GTCACCTCTCTTTCACCTCCGGG + Intronic
1084172120 11:67405777-67405799 CTCTACAGTCTTGCATCTCAGGG + Intronic
1084663222 11:70559435-70559457 GTTAACAGTCTGTCTGCTCCTGG + Intronic
1085749315 11:79146764-79146786 ATCCACAGACTTTCAGCTCCAGG + Intronic
1085845946 11:80064911-80064933 GTTCACAGTCTTTTTTCTCCAGG - Intergenic
1088560470 11:111110421-111110443 GTTAAGAGTCTTCCATATCCTGG - Intergenic
1090909262 11:131104348-131104370 TTCCACACTCTTTCCTCTCCAGG - Intergenic
1093885293 12:24452478-24452500 GTCATCAGTCTAGCCTCTCCAGG - Intergenic
1094450007 12:30574257-30574279 GTCAACTGTCTTTGGTCCCCAGG + Intergenic
1096845041 12:54401816-54401838 GTTTACAGTCCCTCATCTCCGGG - Exonic
1098897532 12:76081169-76081191 GTCAACATTCTTTCAAAACCAGG + Intronic
1100659828 12:96685129-96685151 ACCAACAGTCATTCACCTCCGGG + Exonic
1104489511 12:129181842-129181864 GTCCATTTTCTTTCATCTCCTGG + Intronic
1106231477 13:27824409-27824431 GTAAACAGTTTTGCATCACCGGG - Intergenic
1107143875 13:37036105-37036127 GTCAGCAGTCATTAATATCCAGG + Intronic
1108834619 13:54527260-54527282 ATCAACAGTCTTTGCTCTCAAGG + Intergenic
1109318625 13:60782175-60782197 GCCAACATCCTTTCATCTACTGG - Intergenic
1109706898 13:66106598-66106620 GTGAACTGTCTTTCATCTAATGG - Intergenic
1110753205 13:79140015-79140037 TTCAAAAAACTTTCATCTCCAGG + Intergenic
1117382767 14:55181690-55181712 CTCAAAAGGCTTTCATCTCAGGG + Intronic
1133070658 16:3244588-3244610 GTCAACAGTCTTTTGTCTCTAGG - Exonic
1133533190 16:6674647-6674669 GTCTACATTCGTACATCTCCAGG - Intronic
1135488859 16:22889877-22889899 GTCAAAAGTCTGTTATTTCCAGG - Intronic
1135669203 16:24360785-24360807 GTCAACAGTCTTTCATCTCCTGG + Intronic
1137813799 16:51378977-51378999 GTAAATTGTCTATCATCTCCCGG - Intergenic
1141935136 16:87233544-87233566 GTCCACATGCTTTCATCTGCAGG - Intronic
1144790843 17:17858101-17858123 GTCAACCTTCTGTGATCTCCTGG - Intronic
1145035371 17:19537067-19537089 GTCATCAGCCTCTCATCACCTGG + Intronic
1153510604 18:5847464-5847486 GTCATGGGTCTCTCATCTCCCGG + Intergenic
1158081487 18:53597167-53597189 TTCAACAGTCTTGAATTTCCTGG - Intergenic
1159826556 18:73219717-73219739 ATCAACACTCTTTTATTTCCTGG + Intronic
1164034270 19:21439303-21439325 GTCTCCAGTCTTTCATTTCAGGG + Intronic
1164766137 19:30772704-30772726 TCCAACACTCTGTCATCTCCAGG + Intergenic
1165171052 19:33891886-33891908 GGCACCAGCCTTTCATCTCCTGG - Intergenic
927007387 2:18864920-18864942 GTCTATAGTCTTTCTTCTCCTGG + Intergenic
929425474 2:41840757-41840779 GTTAAAAGGCTTTCCTCTCCAGG + Intergenic
935081188 2:99796475-99796497 CTCATCAGTTTTTCATTTCCTGG - Intronic
937118901 2:119428643-119428665 GCAAACACTCTTTCATCTCGGGG - Intergenic
939384585 2:141479149-141479171 CTCAACACTCTTACATCTTCAGG + Intronic
941710426 2:168706007-168706029 GTCTAAAGACTTTCATCTCCAGG + Intronic
947101631 2:226627388-226627410 GGAAAGAGTCTTTCTTCTCCAGG - Intergenic
947754879 2:232554840-232554862 GTCTATGATCTTTCATCTCCTGG + Intronic
948589900 2:239042351-239042373 GTCACTAGCCTCTCATCTCCGGG + Intergenic
1169132132 20:3171825-3171847 GGCAACAGGCTGTCATCTCAGGG - Intronic
1178125252 21:29508887-29508909 GGCAACCTTCTTTCATCCCCAGG + Intronic
1179969670 21:44827732-44827754 GTCAGAGGTCTTCCATCTCCAGG + Intergenic
1182161818 22:28129918-28129940 ATCAACAGCATCTCATCTCCTGG - Intronic
950584304 3:13881446-13881468 GGCAACAGTCTTTCTTCTTGGGG + Intergenic
951739108 3:25900185-25900207 ATCAACAGGGTTTAATCTCCAGG - Intergenic
951931397 3:27971139-27971161 AGCAACAGTCTTTTCTCTCCTGG - Intergenic
951955990 3:28254064-28254086 CTCAACATTCTATCATCACCTGG - Intronic
953260599 3:41335321-41335343 GTCATCAGTCTTTAAATTCCAGG - Intronic
953572609 3:44083132-44083154 CTCAACGCTCTTTCATCCCCAGG + Intergenic
958031239 3:88113672-88113694 ATCAAATGTCTTTCATCTACAGG - Intronic
958833684 3:99118934-99118956 GGCAACGTTCTTTAATCTCCAGG - Intergenic
959179004 3:102954884-102954906 GCCTACAATCTTTCCTCTCCTGG - Intergenic
966219540 3:177536798-177536820 TTCAACTCTGTTTCATCTCCTGG - Intergenic
968380441 4:91227-91249 TTTAACAGTATTACATCTCCTGG + Intergenic
968748503 4:2373561-2373583 GTTGACAGTGTTTCAGCTCCAGG - Intronic
968863481 4:3191877-3191899 TTCAACAGTCTTTCAGTTGCAGG + Intronic
974550888 4:63372859-63372881 GTCTACAGGCCTTCATCTACAGG + Intergenic
978654481 4:111049645-111049667 GTCATCCGTCTCCCATCTCCAGG + Intergenic
982722980 4:158878244-158878266 GACCACAGTCTTTCATCCTCGGG - Intronic
984197901 4:176681426-176681448 GTCAAAATTATTACATCTCCAGG + Intergenic
984908940 4:184653765-184653787 GACAACACTCTTTCACCACCGGG + Intronic
990966700 5:61455881-61455903 TTCAAAAGACTTTCATCACCTGG + Intronic
991084186 5:62633499-62633521 GTCAATAGACTTTCCTCCCCTGG - Intergenic
993768539 5:91894027-91894049 GTCATCAGTCTTCCTTCTCCAGG + Intergenic
993913964 5:93718643-93718665 GTGATAAGTCTTTCATTTCCTGG - Intronic
994774202 5:104024192-104024214 GTTAAAAGTCTTGCTTCTCCAGG + Intergenic
997574717 5:134965858-134965880 GACAACAGGATTTCATCTCCAGG - Exonic
1000142488 5:158419079-158419101 GTCAAGAGTCTTTCATCTGAAGG + Intergenic
1001323912 5:170705594-170705616 ATCAACAGTCTTTCATCCAGAGG + Intronic
1002209011 5:177584784-177584806 GTCTCAAGTGTTTCATCTCCTGG + Intergenic
1003466872 6:6389108-6389130 GACAACAGTCTTTCCTATTCTGG - Intergenic
1003499455 6:6692329-6692351 GTGAACAGTAATTCATCTTCTGG - Intergenic
1003655560 6:8003897-8003919 GTCAATAGTCTGTCATCACCTGG - Intronic
1005571339 6:27148288-27148310 GTCACTAGACTTTCATCACCTGG - Intergenic
1005881417 6:30064676-30064698 GTCAAGAGTCTTCCTTCTCCTGG - Exonic
1010664139 6:78607206-78607228 CTCTCCAGTCTTTCAACTCCAGG - Intergenic
1010840485 6:80644029-80644051 TTCCACAGTCTTTCTGCTCCAGG + Intergenic
1013796115 6:113890996-113891018 TTCAACAGTGTTGCATCTCAGGG - Intergenic
1018886895 6:167946841-167946863 TTCATCAGTCTGTCATCACCAGG - Exonic
1019089505 6:169516587-169516609 GTCAGCAGTCTTCCCTCTCAAGG - Intronic
1020410988 7:7891213-7891235 GTCAACTGTCCTTCATTTCAAGG - Intronic
1021463685 7:20917247-20917269 GTGCACTGTCTTTCTTCTCCTGG - Intergenic
1021625908 7:22592905-22592927 GGCAACATTCTTTCCTCTACAGG - Intronic
1022671848 7:32463112-32463134 GGGATCATTCTTTCATCTCCTGG + Intergenic
1025641407 7:63375248-63375270 GTAAACATTCTTTCATCTCAGGG + Intergenic
1034745264 7:153518377-153518399 GTAAACAGTCTTTCTTATTCTGG + Intergenic
1036628749 8:10495641-10495663 GTGCAAATTCTTTCATCTCCTGG - Intergenic
1038990437 8:32861400-32861422 GTTATCAGTCTTTCATTTTCAGG - Intergenic
1040465585 8:47691964-47691986 GTCCCCAGTTTTTCATTTCCTGG + Intronic
1041607037 8:59793482-59793504 GTCACCACTTTTTCACCTCCAGG + Intergenic
1042076366 8:64999644-64999666 GTAAACATTATTTCATCTGCTGG + Intergenic
1042207033 8:66339700-66339722 ATCAAAAATCTTTCAGCTCCTGG - Intergenic
1045720015 8:105098043-105098065 GTCAGCAGGCTTTTCTCTCCAGG + Intronic
1046760479 8:118015162-118015184 GTAAACAGTCTTTAAACTGCTGG + Intronic
1047493962 8:125396641-125396663 GGCCACAAGCTTTCATCTCCAGG - Intergenic
1048665319 8:136654860-136654882 GTCCACAGCCTGTGATCTCCAGG + Intergenic
1049440341 8:142606812-142606834 GCCAAGGGTCTTTCAACTCCAGG - Intergenic
1050355799 9:4781657-4781679 GTCCACAGCCTGTCATCTCATGG + Intergenic
1059807457 9:117818194-117818216 GTAAACATTCTCTCTTCTCCCGG + Intergenic
1060753904 9:126195346-126195368 ATCAATAGTTTTTTATCTCCTGG - Intergenic
1185824515 X:3236980-3237002 GGCAACAGTCTCTCTTCTGCAGG + Intergenic
1188993194 X:36849595-36849617 GTCAACAGTACTTCCTCTTCAGG - Intergenic
1189578924 X:42385063-42385085 TTCACCAGGCTTTCATTTCCTGG - Intergenic
1189901834 X:45714331-45714353 GACAACAGTCTCTCCTCTCAGGG + Intergenic
1196290071 X:113929718-113929740 GTCAACCGTCTCTCAACTCCAGG - Intergenic
1197524967 X:127549366-127549388 TTCAACAGTCTTACTTGTCCAGG - Intergenic
1198139936 X:133792443-133792465 GTCCATAGTCTTTCAACTCAGGG - Intronic
1198175055 X:134146726-134146748 GTTGACACTCTGTCATCTCCTGG + Intergenic
1198221235 X:134604456-134604478 CTCATCAGCCTTTCATCTCTAGG + Intronic